SNP Molecular Marker of Gene SbDW1 Related to Above-Ground Dry Weight of Sorghum and Its Application

Abstract

The present invention discloses SNP molecular markers of gene SbDW1 related to the above-ground dry weight of sorghum and their applications. The present invention relates to the field of molecular biotechnology, and specifically relates to the application of haplotype molecular markers in identifying or assisting in the identification of the above-ground dry weight of sorghum. It includes detecting the polymorphism or genotype of SNPs or the haplotype of sorghum in the genome of the sorghum to be tested, and identifying or assisting in the identification of the above-ground dry weight of sorghum according to the genotype. The SNP1 is the 603rd nucleotide of SEQ ID No.1 in the sequence listing, which is T or G; the SNP2 is the 814th nucleotide of SEQ ID No.1 in the sequence listing, which is T or A. Substances for detecting the polymorphism and genotype of the SNPs or the haplotype of sorghum can be combined with other substances (such as substances for detecting the single nucleotide polymorphism or genotype of other molecular markers related to the above-ground dry weight of sorghum) to prepare products for identifying the above-ground dry weight of sorghum.

Description

Technical Field

[0001] The invention belongs to the field of plant breeding, and particularly relates to a SNP molecular marker of a gene SbDW1 related to the dry weight of the aboveground part of sorghum and an application thereof. Background Art

[0002] Sorghum (Sorghum bicolor), also known as millet, is an annual herbaceous plant in the genus Sorghum of the Poaceae family. It is one of the world's five major cereal crops and a C4 crop, widely cultivated in arid and semi-arid tropical, subtropical, and temperate regions. Globally, sorghum is used for animal feed, animal feed, and high-value products such as syrup and bioethanol. Its drought, waterlogging, and salinity tolerance make it a high-yield crop in environments that restrict the cultivation of other cereals. It is also an important source of food, feed, and brewing raw materials, and holds great promise as a promising bioenergy crop.

[0003] Land salinization is a widespread problem worldwide. Approximately 20% of arable land has experienced or is currently experiencing varying degrees of salinization. The loss of land available for crop cultivation has become a serious concern for agricultural sustainability. Salt is one of the most significant environmental stressors, significantly reducing the area of ​​arable land while also reducing crop yield and quality. The use of salt-tolerant crops is a key strategy for mitigating this problem. Sorghum was previously considered moderately salt-tolerant. Sorghum is primarily cultivated in temperate regions of western and northeastern China. Sorghum has strong resistance to drought, waterlogging, salinity, and high temperatures, making it suitable for cultivation on marginal lands such as saline-alkali and arid areas. Sorghum is renowned for its strong stress resistance and broad adaptability, with salt tolerance being one of its key characteristics. Therefore, cultivating salt-tolerant sorghum varieties is an effective measure to fully utilize saline-alkali land resources and increase sorghum yields.

[0004] Molecular marker-assisted selection breeding can select for target traits at the DNA level. Not only are the results stable, but selection can also be performed at the seedling stage, reducing the cost of phenotypic evaluation and improving sorghum breeding efficiency. Single nucleotide polymorphism (SNP) markers are genetically stable, numerous, widely distributed, and easy to detect, making them suitable for large-scale detection and analysis. After finding the key marker sites through genetic analysis, they need to be converted into easy-to-use molecular markers. KASP (Kompetitive allele-specific PCR), or competitive allele-specific PCR technology, has been widely used in high-throughput SNP typing detection due to its high stability, accuracy, and low cost.

[0005] Therefore, research on genes regulating aboveground dry weight, obtaining KASP molecular markers tightly linked to aboveground dry weight genes, and locating and detecting the major loci of sorghum aboveground dry weight genes are crucial for effectively regulating aboveground dry weight types in sorghum and breeding new sorghum varieties with desired aboveground dry weight types. Currently, there are few reports on the development and patenting of molecular markers tightly linked to target QTLs in sorghum, and no patents related to aboveground dry weight have been reported. Summary of the Invention

[0006] The problem to be solved by the present invention is how to identify or assist in identifying the dry weight trait of the aerial part of sorghum and / or how to assist in sorghum breeding.

[0007] In order to solve the above technical problems, the present invention first provides the use of a substance for detecting the polymorphism or genotype of SNPs in the sorghum genome or a substance for detecting haplotypes in any of the following:

[0008] (1) Identify or assist in identifying the dry weight of the aboveground parts of sorghum;

[0009] (2) screening or breeding sorghum plants, lines, strains, or varieties with high aboveground dry weight;

[0010] (3) screening or breeding sorghum plants, lines, strains, or varieties with low aboveground dry weight;

[0011] (4) Sorghum breeding;

[0012] (5) preparing products for identification or assisting in identification of the dry weight of the aerial parts of sorghum;

[0013] (6) preparing products for screening or breeding sorghum plants, lines, strains, or varieties with high aboveground dry weight;

[0014] (7) preparing products for screening or breeding sorghum plants, lines, strains or varieties with low aboveground dry weight;

[0015] (8) preparing sorghum breeding products;

[0016] The SNPs are two SNPs named SNP1 and SNP2 in the sorghum genome, wherein SNP1 is the 603rd nucleotide of SEQ ID No. 1 in the sequence list, and its nucleotide type is T or G; and SNP2 is the 814th nucleotide of SEQ ID No. 1 in the sequence list, and its nucleotide type is T or A;

[0017] The haplotype is a polymorphic combination of two SNPs, SNP1 and SNP2, on a chromosome of sorghum.

[0018] In the present application, the genotype of the SNP1 may be genotype GG, genotype TT or genotype TG, genotype GG is the homozygous type of SNP1 with G; genotype TT is the homozygous type of SNP1 with T; genotype TG is the heterozygous type of SNP1 with G and T; the genotype of the SNP2 may be genotype TT, genotype AA or genotype TA, genotype TT is the homozygous type of SNP2 with T; genotype AA is the homozygous type of SNP2 with A; genotype TA is the heterozygous type of SNP2 with T and A.

[0019] Taking the sorghum genome (BTx623 (v3.1)) sequence as the reference genome, the SNP1 and SNP2 are located in the SbDW1 gene, and the SbDW1 gene is located at positions 11318940-11322656 of sorghum chromosome 1 and is associated with the dry weight of the aboveground part of sorghum.

[0020] The present invention also provides a method for identifying or assisting in identifying the dry weight trait of the aerial part of sorghum, which is method A or method B.

[0021] The method A is a method for identifying or assisting in identifying the dry weight of the aboveground part of sorghum, comprising detecting the genotype of the SNP in the sorghum to be tested, and identifying or assisting in identifying the dry weight of the aboveground part of sorghum according to the genotype of the sorghum to be tested: the aboveground dry weight of the sorghum with the genotype TTTT is higher or is a candidate to be higher than that of the sorghum with the genotype TTAA and the sorghum with the genotype GGAA; the TTTT is a two-SNP combination genotype in which the genotype of the SNP1 is TT (the 603rd nucleotide of SEQ ID No. 1 in the sequence list is a homozygous type of T) and the genotype of the SNP2 is TT (the 814th nucleotide of SEQ ID No. 1 in the sequence list is a homozygous type of T); the genotype TTAA is a two-SNP combination genotype in which the genotype of the SNP1 is TT and the genotype of the SNP2 is AA (the 814th nucleotide of SEQ ID No. 1 in the sequence list is a homozygous type of A); the genotype GGAA is a two-SNP combination genotype in which the genotype of the SNP1 is GG (the genotype of the SNP1 is GG). The two SNP combination genotypes are: a homozygous G at position 603 of No. 1 and a genotype of AA of SNP 2;

[0022] The method B comprises detecting the haplotype of the sorghum to be tested, and identifying or assisting in identifying the dry weight of the aboveground part of the sorghum according to the haplotype of the sorghum to be tested:

[0023] The haplotype may specifically be haplotype SbDW1-Hap1 (TT) (abbreviated as SbDW1-Hap1), haplotype SbDW1-Hap2 (TA) (abbreviated as SbDW1-Hap2), and haplotype SbDW1-Hap3 (GA) (abbreviated as SbDW1-Hap3); the haplotype SbDW1-Hap1 (TT) is that the SNP1 is T and the SNP2 is T; the haplotype SbDW1-Hap2 (TA) is that the SNP1 is T and the SNP2 is A; the haplotype SbDW1-Hap3 (GA) is that the SNP1 is G and the SNP2 is A.

[0024] The dry weight of the aboveground part of the homozygous genotype sorghum corresponding to haplotype SbDW1-Hap1 is significantly higher or potentially higher than that of the homozygous genotype sorghum (such as sorghum inbred lines) corresponding to haplotypes SbDW1-Hap2 and SbDW1-Hap3; the haplotype SbDW1-Hap1 is a haplotype in which SNP1 is T and SNP2 is T, the haplotype SbDW1-Hap2 is a haplotype in which SNP1 is T and SNP2 is A, and the haplotype SbDW1-Hap3 is a haplotype in which SNP1 is G and SNP2 is A.

[0025] Alternatively, the method for identifying or assisting in identifying the dry weight trait of the aerial part of sorghum may be any of the following:

[0026] (1) the genotype TTTT of the two SNPs, SNP1 and SNP2, is or is a candidate sorghum having a high aboveground dry weight,

[0027] (2) The aboveground dry weight of the sorghum to be tested (such as sorghum inbred line) with the genotypes of the two SNPs, SNP1 and SNP2, being genotype TTTT, is higher or potentially higher than that of the sorghum to be tested with the genotype TTAA and the sorghum to be tested with the genotype GGAA.

[0028] As an embodiment, the method for identifying or assisting in identifying the dry weight of the aerial part of sorghum may include the following steps:

[0029] (1) Using the genomic DNA of the sorghum to be tested as a template, a primer combination F1 and a primer combination F2 are used to perform KASP; the primer combination F1 can be composed of primer F1-A, primer F1-B, and primer F1-C, and the primer combination F2 can be composed of primer F2-A, primer F2-B, and primer F2-C;

[0030] The primer composition F1 comprises primer F1-A which is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-42 of sequence 2 in the sequence list;

[0031] The primer composition F1 comprises primer F1-B, which is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-41 of sequence 3 in the sequence list;

[0032] The primer composition F1 is composed of a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence table;

[0033] The primer composition F2 comprises primer F2-A, which is a single-stranded DNA molecule whose nucleotide sequence is sequence 5 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-42 of sequence 5 in the sequence list;

[0034] The primer composition F2 comprises primer F2-B, which is a single-stranded DNA molecule whose nucleotide sequence is sequence 6 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-42 of sequence 6 in the sequence list;

[0035] The primer composition F2 is a single-stranded DNA molecule whose nucleotide sequence is primer F2-C, which is sequence 7 in the sequence table.

[0036] (2) After completing step (1), performing fluorescence detection to determine the genotypes of the SNP1 and SNP2 sites of the sorghum to be tested;

[0037] (3) Identifying the aboveground dry weight of the sorghum to be tested based on the genotype results: The average aboveground dry weight of the sorghum to be tested (such as the sorghum inbred line) with the genotypes of the two SNP sites, SNP1 and SNP2, being genotype TTTT, is significantly higher than or potentially higher than that of the sorghum to be tested with the genotype TTAA and the sorghum to be tested with the genotype GGAA.

[0038] The application of the above-mentioned method for identifying or assisting in identifying the dry weight of the above-ground part of sorghum in sorghum breeding also falls within the scope of protection of the present invention.

[0039] The invention also provides a sorghum breeding method.

[0040] The sorghum breeding method provided by the present invention can be M1 and M2:

[0041] The M1 method includes detecting the genotypes of the SNP1 and the SNP2 in the sorghum genome, selecting sorghum with a genotype of TTTT at the SNP site as a parent for breeding, wherein the TTTT is a homozygous type of SNP1 being T and the homozygous type of SNP2 being T, and the breeding purpose of the method includes breeding sorghum with high dry weight of the aboveground part.

[0042] The M2 method includes detecting the type of haplotype described above, selecting a sorghum inbred line with haplotype SbDW1-Hap1 (TT) as a parent for breeding, wherein the haplotype SbDW1-Hap1 (TT) is a combination of SNP1 being T and SNP2 being T, and the breeding purpose of the method includes breeding sorghum with high dry weight of the above-ground part.

[0043] As an implementation method, the sorghum breeding method may include the following steps:

[0044] (1) Using the genomic DNA of the sorghum to be tested as a template, KASP was performed using the primer set F1 and / or primer set F2;

[0045] (2) After completing step (1), performing fluorescence detection to determine the genotype of the SNP site in the sorghum to be tested;

[0046] (3) Select TTTT genotype sorghum for breeding of high aboveground dry weight, and select TTAA genotype sorghum for breeding of low aboveground dry weight.

[0047] The sorghum breeding described above is to cultivate sorghum varieties with higher dry weight of above-ground parts.

[0048] The above-ground dry weight of sorghum may specifically be the above-ground dry weight of sorghum at maturity.

[0049] In the above applications and methods, the sorghum may be a pure sorghum inbred line. In the above applications and methods, a sorghum inbred line may be selected as a parent for breeding.

[0050] In the above-mentioned uses and methods, the above-ground dry weight of the sorghum variety with a low above-ground dry weight is relative to the hybrid parent sorghum. If the above-ground dry weight of the two hybrid parent sorghums is the same, the above-ground dry weight of the sorghum variety with a high above-ground dry weight can be equal to or greater than the above-ground dry weight of the hybrid parent sorghum. If the above-ground dry weight of the two hybrid parent sorghums is different, the above-ground dry weight of the sorghum variety with a high above-ground dry weight can be equal to or greater than the hybrid parent sorghum with the higher above-ground dry weight.

[0051] The present invention also provides a product for detecting the polymorphism or genotype of SNPs in the sorghum genome.

[0052] The product provided by the present invention for detecting the polymorphism or genotype of the SNP in the sorghum genome is the above-mentioned substance for detecting the polymorphism or genotype of the SNP site in the sorghum genome, or a product containing the above-mentioned substance for detecting haplotype, and the product can be any of the following:

[0053] C1) Products for detecting single nucleotide polymorphisms or genotypes associated with aboveground dry weight of sorghum;

[0054] C2) Identify or assist in identifying products based on the dry weight of the aboveground parts of sorghum;

[0055] C3) Products used for sorghum breeding;

[0056] C4) Screening or breeding products of sorghum plants, lines, strains or varieties with high aboveground dry weight;

[0057] C5) Screening or breeding of sorghum plants, lines, strains or varieties with low above-ground dry weight.

[0058] In the above applications, methods, and products, the substance may be a reagent and / or instrument required for determining the polymorphism or genotype of the SNP by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. Among them, SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on "one-step" reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule DNA binding reactions.

[0059] Optionally, the substance is the following D1), D2) or D3):

[0060] D1) the substances are a primer composition F1 for amplifying a sorghum genomic DNA fragment including the SNP1 and a primer composition F2 for amplifying a sorghum genomic DNA fragment including the SNP2;

[0061] D2) the substance is a PCR reagent containing the primer combination described in D1);

[0062] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0063] Alternatively, the primer composition for amplifying the sorghum genomic DNA fragment including the SNP1 may consist of primer F1-A, primer F1-B, and primer F1-C, and the primer composition for amplifying the sorghum genomic DNA fragment including the SNP2 may consist of primer F2-A, primer F2-B, and primer F2-C;

[0064] The primer composition F1 can be composed of primer F1-A, which is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-42 of sequence 2 in the sequence list;

[0065] The primer composition F1 can be composed of primer F1-B, which is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-41 of sequence 3 in the sequence list;

[0066] The primer composition F1 can be composed of a single-stranded DNA molecule whose nucleotide sequence of primer F1-C is sequence 4 in the sequence table;

[0067] The primer composition F2 can be composed of primer F2-A, which is a single-stranded DNA molecule whose nucleotide sequence is sequence 5 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-42 of sequence 5 in the sequence list;

[0068] The primer composition F2 can be composed of primer F2-B, which is a single-stranded DNA molecule whose nucleotide sequence is sequence 6 in the sequence list or a single-stranded DNA whose nucleotide sequence is positions 22-42 of sequence 6 in the sequence list;

[0069] The primer composition F2 can be composed of a single-stranded DNA molecule whose nucleotide sequence is primer F2-C, which is sequence 7 in the sequence table.

[0070] In the above-mentioned applications, methods and products, the primer composition may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include but are not limited to dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or alternatively, it can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence comprising the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker.

[0071] For example, the primer composition F1 may be a primer composition composed of a single-stranded DNA having a nucleotide sequence of positions 22-42 of Sequence 2 in the sequence listing, a single-stranded DNA having a nucleotide sequence of positions 22-41 of Sequence 3 in the sequence listing, and a single-stranded DNA having a nucleotide sequence of positions 4 in the sequence listing. The primer composition F1 may also be a primer set consisting of a single-stranded DNA represented by Sequence 2 in the sequence listing, a single-stranded DNA represented by Sequence 3 in the sequence listing, and a single-stranded DNA represented by Sequence 4 in the sequence listing. Sequence 2 in the sequence listing consists of 42 nucleotides, with nucleotides 1-21 being a FAM sequence (as a marker), and nucleotides 22-42 being a specific sequence; Sequence 3 in the sequence listing consists of 41 nucleotides, with nucleotides 1-21 being a HEX sequence (as a marker), and nucleotides 22-41 being a specific sequence.

[0072] For example, the primer composition F2 may be a primer composition composed of a single-stranded DNA having a nucleotide sequence of positions 22-42 of Sequence 5 in the sequence listing, a single-stranded DNA having a nucleotide sequence of positions 22-42 of Sequence 6 in the sequence listing, and a single-stranded DNA having a nucleotide sequence of positions 7 in the sequence listing. The primer composition F2 may also be a primer set consisting of a single-stranded DNA represented by Sequence 5 in the sequence listing, a single-stranded DNA represented by Sequence 6 in the sequence listing, and a single-stranded DNA represented by Sequence 6 in the sequence listing. Sequence 5 in the sequence listing consists of 42 nucleotides, with nucleotides 1-21 being a FAM sequence (as a marker) and nucleotides 22-42 being a specific sequence; Sequence 6 in the sequence listing consists of 42 nucleotides, with nucleotides 1-21 being a HEX sequence (as a marker) and nucleotides 22-42 being a specific sequence.

[0073] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown as Sequence 1 in the sequence listing.

[0074] The application of the above-mentioned DNA molecules also falls within the scope of protection of the present invention. The application is specifically any of the following:

[0075] (1) Identify or assist in identifying the dry weight of the aboveground parts of sorghum;

[0076] (2) screening or breeding sorghum plants, lines, strains, or varieties with high aboveground dry weight;

[0077] (3) Screening or breeding sorghum plants, lines, strains or varieties that are sensitive to aboveground dry weight;

[0078] (4) Sorghum breeding;

[0079] (5) preparing products for identification or assisting in identification of the dry weight of the aerial parts of sorghum;

[0080] (6) preparing products for screening or breeding sorghum plants, lines, strains, or varieties with high aboveground dry weight;

[0081] (7) preparing products for screening or breeding sorghum plants, lines, strains or varieties with low aboveground dry weight;

[0082] (8) Prepare sorghum breeding products.

[0083] Optionally, in the above application, the DNA molecule serves as a detection target.

[0084] The substances for detecting the SNP polymorphism and genotype or the haplotype can be combined with other substances (such as substances for detecting single nucleotide polymorphism or genotype of other molecular markers related to the dry weight of sorghum aboveground parts) to prepare products for identifying varieties of sorghum aboveground dry weight.

[0085] The present invention analyzes the genetic variation of the SbDW1 gene in an associated population of sorghum inbred lines and finds that two SNPs, SNP1 and SNP2, are located in the SbDW1 gene, a gene related to the aboveground dry weight in the sorghum genome, i.e., positions 603 and 814 of SEQ ID No. 1 in the sequence table. The two SNPs are combined to form three haplotypes: haplotype SbDW1-Hap1 (TT), haplotype SbDW1-Hap2 (TA), and haplotype SbDW1-Hap3 (GA). A primer combination for amplifying a sorghum genomic DNA fragment including the SNP1 and a primer combination for amplifying a sorghum genomic DNA fragment including the SNP2 are provided. A method for identifying or assisting in identifying the aboveground dry weight of sorghum using the primer combination is also provided. The method established by the present invention can be used to predict the phenotype of sorghum for aboveground dry weight, can be used for early screening of sorghum to be screened, and can be used for sorghum molecular marker-assisted breeding. It has important application value in the research of exploring sorghum germplasm resources with heavier aboveground dry weight and breeding sorghum varieties with higher aboveground dry weight. DETAILED DESCRIPTION

[0086] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0087] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0088] The 226 sorghum inbred line association groups in the following examples were provided by Jing Haichun Laboratory, Key Laboratory of Northern Resource Plants, Institute of Botany, Chinese Academy of Sciences. Detailed information on the association group can be found in the published article: Xiaoyuan Wu, et al.. Genomic footprints of sorghum domestication and breeding selection for multiple end uses. Molecular Plant, 2022, VOLUME 15, ISSUE 3, P537-551 (DOI: https: / / doi.org / 10.1016 / j.molp.2022.01.002). Its germplasm resource information can also be obtained from the SorGSD website (https: / / ngdc.cncb.ac.cn / sorgsd / ). The variety details are shown in Table 1.

[0089] Example 1. Discovery of Haplotype Combinations and Related Haplotype Molecular Markers Related to the Dry Weight of Sorghum Aerial Parts I. Statistics of Aerial Dry Weight of Test Materials

[0090] 1. Planting of test materials

[0091] In 2021, 226 sorghum inbred line related population germplasm resources were planted in mildly saline-alkali soil in the Agricultural High-tech Zone of Dongying City, Shandong Province, China. A randomized complete block design was adopted. The experimental plot was 3m long and 2m wide, with 5 rows planted, 10 plants per row, 0.3m spacing between plants, 0.5m spacing between rows, and normal irrigation.

[0092] 2. Statistics of dry weight of above-ground parts of test materials

[0093] After the 226 sorghum inbred line related populations were fully mature, three plants were selected from each material, and the aboveground dry weight of the main stem of each plant was counted. The average value of the three replicates was taken as the final result of the aboveground dry weight of the sample, as shown in Table 1.

[0094] 2. Discovery of Haplotype Combinations Related to the SbDW1 Gene and Its Haplotype Molecular Markers

[0095] 1. Whole-genome sequencing of 226 sorghum inbred line association populations

[0096] The whole genome sequencing data of 226 sorghum inbred line association populations were provided by Jing Haichun Laboratory, Key Laboratory of Northern Resource Plants, Institute of Botany, Chinese Academy of Sciences.

[0097] 2. Discovery of haplotype combinations related to the SbDW1 gene and its related haplotype molecular markers

[0098] Based on genome-wide association analysis of aboveground dry weight and genotype data from sorghum inbred lines, a haplotype combination for the gene SbDW1, which is associated with the salt-alkali tolerance phenotype of sorghum, was identified. This haplotype combination includes two single nucleotide polymorphisms (SNPs)—SNP1 and SNP2. SNP1 corresponds to position 11321912 on chromosome 1 of the sorghum inbred line BTx623 (BTx623 (v3.1) sorghum genome sequence information), with a nucleotide sequence of either T or G, corresponding to position 603 in the sequence listing. SNP2 corresponds to position 11322123 on chromosome 1 of the sorghum inbred line BTx623, with a nucleotide sequence of either T or A, corresponding to position 814 in the sequence listing. In the sequence listing, k in SEQ ID No. 1 represents t or g, and w represents t or a.

[0099] The genotype testing results for each sorghum variety are shown in Table 1. The results showed that there were two genotypes at the SNP1 locus (referred to as SNP1 genotypes): TT or GG. Genotype TT is the homozygous form of SNP1 with a T, while genotype GG is the homozygous form of SNP1 with a G. There were two genotypes at the SNP2 locus (referred to as SNP2 genotypes): TT or AA. Genotype TT is the homozygous form of SNP2 with a T, while genotype AA is the homozygous form of SNP2 with an A. In the test population, these two SNP combinations, or haplotype combinations, resulted in three haplotypes: haplotype SbDW1-Hap1 (TT) (referred to as SbDW1-Hap1), haplotype SbDW1-Hap2 (TA) (referred to as SbDW1-Hap2), and haplotype SbDW1-Hap3 (GA) (referred to as SbDW1-Hap3). Haplotype SbDW1-Hap1(TT) is a combination of SNP1 being T and SNP2 being T, haplotype SbDW1-Hap2(TA) is a combination of SNP1 being T and SNP2 being A, and haplotype SbDW1-Hap3(GA) is a combination of SNP1 being G and SNP2 being A.

[0100] The aboveground dry weight of the homozygous sorghum genotype corresponding to the haplotype SbDW1-Hap1(TT) was significantly higher than that of the homozygous sorghum genotypes corresponding to other haplotypes. The genotype of the homozygous sorghum genotype corresponding to the haplotype SbDW1-Hap1(TT) is TTTT, which is a combination of two SNPs: SNP1 genotype TT and SNP2 genotype TT. The genotype of the homozygous sorghum genotype corresponding to the haplotype SbDW1-Hap2(TA) is TTAA, which is a combination of two SNPs: SNP1 genotype TT and SNP2 genotype AA. The genotype of the homozygous sorghum genotype corresponding to the haplotype SbDW1-Hap3(GA) is GGAA, which is a combination of two SNPs: SNP1 genotype GG and SNP2 genotype AA.

[0101] Therefore, the haplotype combination related to the gene SbDW1 obtained above was selected for identifying or assisting in identifying the dry weight of the aboveground parts of different sorghum varieties; the SbDW1-Hap1 (TT) haplotype in the haplotype combination was used as a molecular marker for identifying or assisting in identifying the dry weight of the aboveground parts of different sorghum varieties.

[0102] 3. Design of Haplotype Combinations Related to the SbDW1 Gene and the Establishment of a Method for the Design of Specific Primers for the SbDW1-Hap1(TT) Haplotype Molecular Markers

[0103] 1. Design of genome-specific primers for haplotype combination-related SNP sites

[0104] The specific primer sequences for SNP1 (SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4 in the sequence listing) and the specific primer sequences for SNP2 (SEQ ID No. 5, SEQ ID No. 6, and SEQ ID No. 7 in the sequence listing) were designed and synthesized by Zhongyu Gold Labeling (Beijing) Biotechnology Co., Ltd.

[0105] The primer set F1 for identifying the polymorphism of SNP1 is as follows:

[0106] Specific primer F1-A: 5'- GAAGGTGACCAAGTTCATGCT CGCCATGGATCCCAAGCTCTT-3' (SEQ ID No. 2, the underlined part is the specific fluorescent tag sequence FAM)

[0107] Specific primer F1-B: 5'- GAAGGTCGGAGTCAACGGATT GCCATGGATCCCAAGCTCTG-3' (SEQ ID No. 3, the underlined part is the specific fluorescent tag sequence HEX)

[0108] Universal primer F1-C (SEQ ID No. 4): 5'-GGTCTACGGACCTCCGCCAATAA-3'

[0109] The primer set F2 for identifying the polymorphism of SNP2 is as follows:

[0110] Specific primer F2-A: 5'- GAAGGTGACCAAGTTCATGCT GAGTTCCAGCTGTTTGGCGCT-3' (SEQ ID No. 5, the underlined part is the specific fluorescent tag sequence FAM)

[0111] Specific primer F2-B: 5'- GAAGGTCGGAGTCAACGGATT GAGTTCCAGCTGTTTGGCGCA-3' (SEQ ID No. 6, the underlined part is the specific fluorescent tag sequence HEX)

[0112] Universal primer F2-C (SEQ ID No. 7): 5'-GCCGAAATGGTCCAGGAGCTGAT-3'

[0113] The primer set F1 for identifying the polymorphism of the SNP1 site and the primer set F2 for identifying the polymorphism of the SNP2 site are designed based on the sequence SEQ ID No.1.

[0114] The underlined sequences in the above primers F1-A and F2-A are FAM sequences; the underlined sequences in F1-B and F2-B are HEX sequences.

[0115] The single-stranded DNA molecule amplification sequence shown in SEQ ID No. 2 and SEQ ID No. 4, wherein the SNP1 site in SEQ ID No. 1 is T, can be read using a microplate reader or a fluorescence quantitative PCR instrument to obtain the fluorescent signal of the fluorescent group bound to the FAM sequence in the template;

[0116] The single-stranded DNA molecule amplification sequence shown in SEQ ID No. 3 and SEQ ID No. 4 is a fragment in which the SNP1 site is G in SEQ ID No. 1. The fluorescent signal of the fluorescent group bound to the HEX sequence in the template can be read using an enzyme reader or a fluorescence quantitative PCR instrument.

[0117] The single-stranded DNA molecule amplification sequence shown in SEQ ID No. 5 and SEQ ID No. 7, wherein the SNP2 site in SEQ ID No. 1 is T, can read the fluorescent signal of the fluorescent group bound to the FAM sequence in the template using a microplate reader or a fluorescence quantitative PCR instrument;

[0118] The single-stranded DNA molecules shown in the above sequences SEQ ID No.6 and SEQ ID No.7 amplify the fragment in which the SNP2 site in SEQ ID No.1 is A. The fluorescent signal of the fluorescent group bound to the HEX sequence in the template can be read using an enzyme reader or a fluorescence quantitative PCR instrument.

[0119] 2. Establishment of a method for detecting the aboveground dry weight of sorghum using KASP molecular markers

[0120] 2.1 DNA extraction

[0121] The genomic DNA of the tested sorghum varieties was extracted by conventional CTAB method and dissolved in ddH2O and used as a template for PCR amplification.

[0122] 2.2 PCR amplification and fluorescence signal detection

[0123] Use SNP1 primer set F1 and SNP2 primer set F2 in step 1 to PCR amplify the template obtained in 2.1, respectively, to detect the polymorphism (nucleotide type) and genotype of the SNP1 site and the SNP2 site; use the Douglas-Araya high-throughput pipeline fluorescence signal scanner to read the fluorescence data of the PCR products of the F1 and F2 primer sets, and use Douglas's dedicated software - Kraken for fluorescence signal processing.

[0124] Prepare primer mixture: dilute primer F1-A, primer F1-B, primer F1-C, primer F2-A, primer F2-B and primer F2-C to 100 mmol / L with ddH2O. -1 , respectively, to obtain primer F1-A solution, primer F1-B solution, primer F1-C solution, primer F2-A solution, primer F2-B solution, and primer F2-C solution. Add 230 μL of 10 mM Tris-HCl to 60 μL of primer F1-A solution, 60 μL of primer F1-B solution, and 150 μL of primer F1-C solution to obtain primer mixture F1. Add 230 μL of 10 mM Tris-HCl to 60 μL of primer F2-A solution, 60 μL of primer F2-B solution, and 150 μL of primer F2-C solution to obtain primer mixture F2.

[0125] The 2 μL PCR reaction system for fluorescence quantitative detection consisted of 50 ng of genomic DNA, 0.02 μL of primer mix, 0.6 μL of LGC 1× KASP Mix (Low Rox), and the remainder in ddH2O. The program was edited and run according to the operating manuals of the Douglas-Nexar and Soellex water bath systems, and the data were saved.

[0126] If the PCR product of the F1 primer group shows only the fluorescent signal of the fluorescent group bound to the FAM sequence, the genotype of the sorghum SNP1 site to be tested is TT (i.e., the SNP1 site in the sorghum genome is the homozygous type of T); if it shows only the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP1 site to be tested is GG (i.e., the SNP1 site in the sorghum genome is the homozygous type of G); if it shows both the fluorescent signal of the fluorescent group bound to the FAM sequence and the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP1 site to be tested is TG (i.e., the SNP1 site in the sorghum genome is the heterozygous type of T and G).

[0127] If the PCR product of the F2 primer group shows only the fluorescent signal of the fluorescent group bound to the FAM sequence, the genotype of the sorghum SNP2 site to be tested is TT (i.e., the SNP2 site in the sorghum genome is the homozygous type of T); if it shows only the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP2 site to be tested is AA (i.e., the SNP2 site in the sorghum genome is the homozygous type of A); if it shows both the fluorescent signal of the fluorescent group bound to the FAM sequence and the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP2 site to be tested is TA (i.e., the SNP2 site in the sorghum genome is the heterozygous type of T and A).

[0128] Determine the haplotype and genotype of the haplotype combination associated with the gene SbDW1, thereby identifying or assisting in identifying the aboveground dry weight of the test sorghum variety: the aboveground dry weight of sorghum (e.g., a sorghum inbred line) whose genotypes of the two SNPs SNP1 and SNP2 are TTTT is higher than, or is a candidate for being higher than, sorghum (e.g., a sorghum inbred line) whose genotypes of the two SNPs SNP1 and SNP2 are GGAA or TTAA. The aboveground dry weight of sorghum (e.g., a sorghum inbred line) homozygous for the haplotype SbDW1-Hap1(TT) is higher than, or is a candidate for being higher than, sorghum (e.g., a sorghum inbred line) homozygous for the haplotype SbDW1-Hap2 (e.g., a sorghum inbred line) and homozygous for the haplotype SbPDW1-Hap3 (e.g., a sorghum inbred line).

[0129] Example 2: Application of haplotype combinations significantly associated with sorghum aerial dry weight and SbDW1-Hap1 (TT) haplotype molecular markers

[0130] Sorghum to be tested: 226 sorghum inbred line related populations in Table 1

[0131] 1. Determination of dry weight of aboveground parts of sorghum

[0132] The method was the same as in Example 1. The results showed that 226 sorghum inbred lines were planted in slightly saline-alkali soil in the Agricultural High-tech Zone of Dongying City, Shandong Province, China. The aboveground dry weight of different sorghum varieties was significantly different. The aboveground dry weight of sorghum ranged from 0.045 to 0.3 kg. Among them, 143 sorghum inbred lines had an aboveground dry weight exceeding 0.12 kg, accounting for approximately 63.27% of the associated population.

[0133] 2. Molecular Identification or Assisted Identification of Aboveground Dry Weight of Sorghum Inbred Lines

[0134] Genomic DNA of the sorghum to be tested was extracted and dissolved in ddH2O to serve as a template. PCR amplification was performed using the genomic-specific primers for the SNP sites associated with the haplotype combination described in Example 1, namely, primer set F1 for the SNP1 site and primer set F2 for the SNP2 site. Polymorphism information for the two SNP sites in the haplotype combination associated with the SbDW1 gene was obtained, thereby determining the haplotype and genotype of the haplotype combination associated with the SbDW1 gene of the sorghum to be tested, thereby identifying or assisting in the identification of the aboveground dry weight of the test sorghum variety.

[0135] The aboveground dry weight of sorghum (e.g., a sorghum inbred line) with the genotypes of the two SNPs SNP1 and SNP2 to be tested being TTTT is higher, or is a candidate for being higher, than that of sorghum (e.g., a sorghum inbred line) with the genotypes of the two SNPs SNP1 and SNP2 being GGAA or TTAA. The aboveground dry weight of sorghum (e.g., a sorghum inbred line) homozygous for the haplotype SbDW1-Hap1(TT) is higher, or is a candidate for being higher, than that of sorghum (e.g., a sorghum inbred line) homozygous for the haplotype SbDW1-Hap2 and homozygous for the haplotype SbDW1-Hap3.

[0136] The genotypes of the two SNPs and the aboveground dry weight of the 226 sorghum accessions tested are shown in Tables 1 and 2. The SNP1 locus contained two genotypes: TT and GG (shown in the SNP1 genotype column); the SNP2 locus contained two genotypes: TT and AA (shown in the SNP2 genotype column). Three haplotype combinations were present at the two SNPs in the sorghum genomes, according to the genomic sequence: SbDW1-Hap1 (TT), SbDW1-Hap2 (TA), and SbDW1-Hap3 (GA). The test results showed that among the 226 sorghum varieties, 81 of the 105 haplotype SbDW1-Hap1(TT) sorghum varieties had an aboveground dry weight higher than 0.12 kg; 39 of the 75 haplotype SbDW1-Hap2(TA) sorghum varieties had an aboveground dry weight lower than 0.12 kg; and 20 of the 46 haplotype SbDW1-Hap3(GA) sorghum varieties had an aboveground dry weight lower than 0.12 kg. 77.14% of the sorghum varieties with the haplotype SbDW1-Hap1(TT) had an aboveground dry weight higher than 0.12 kg, and 52% of the sorghum varieties with the haplotype SbDW1-Hap2(TA) had an aboveground dry weight lower than 0.12 kg. 43.48% of sorghum varieties with haplotype SbDW1-Hap3(GA) had above-ground dry weights below 0.12 kg. This suggests that using haplotype SbDW1-Hap1(TT) to select sorghum varieties with high above-ground dry weights and eliminating haplotypes SbDW1-Hap2(TA) and SbDW1-Hap3(GA) with low above-ground dry weights is effective as haplotype molecular markers for assisted selection of sorghum varieties with high above-ground dry weights.

[0137] Table 1. Aboveground dry weight and genotypes of two SNPs in 226 sorghum inbred lines

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149] Note: IS: Sweet Sorghum; IG: Grain Sorghum; LG: Grain Sorghum; AL: unknown; LB: Broom Sorghum

[0150] A significant difference analysis was conducted between the three haplotypes and the aboveground dry weight. The results are shown in Table 2. The aboveground dry weight of sorghum homozygous genotypes corresponding to haplotype SbDW1-Hap1 was extremely significantly different from that of sorghum homozygous genotypes corresponding to haplotype SbDW1-Hap2 (P < 0.0001), and the aboveground dry weight of sorghum homozygous genotypes corresponding to haplotype SbDW1-Hap1 was significantly different from that of sorghum homozygous genotypes corresponding to haplotype SbDW1-Hap3 (P < 0.05). The aboveground dry weight of sorghum homozygous genotypes corresponding to haplotype SbDW1-Hap1 was higher or significantly higher than that of sorghum homozygous genotypes corresponding to haplotypes SbDW1-Hap2 and SbDW1-Hap3.

[0151] Table 2 Aerial dry weight of 226 sorghum inbred lines according to genotype and haplotype combination homozygous types of SbDW1 gene

[0152] genotype Haplotype type Haplotype combination Number of varieties / pieces Dry weight (kg) TTTT SbDW1-Hap1 TT 105 <![CDATA[0.1573±0.0480 a ]]> TTAA SbDW1-Hap2 TA 75 <![CDATA[0.1204±0.0419 b ]]> GGAA SbDW1-Hap3 GA 46 <![CDATA[0.1349±0.0522 b ]]>

[0153] A significance analysis was performed on the difference between the genotype of SNP1 or the genotype of SNP2 and the dry weight of the aboveground part. The results showed that there was an extremely significant difference (P<0.0001) in the dry weight of the aboveground part of sorghum between the homozygous genotype (TT) of SNP2 and the homozygous genotype (AA) of sorghum. The dry weight of the aboveground part of sorghum corresponding to the genotype SNP2-TT was higher or potentially higher than that corresponding to SNP2-AA.

[0154] Table 3 Aboveground dry weight of 226 sorghum inbred lines corresponding to different genotypes at the two SNP loci of the SbDW1 gene

[0155]

[0156] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Use of a substance for detecting the polymorphism or genotype of SNPs in the sorghum genome or a substance for detecting haplotypes in any of the following: (1) Identifying or assisting in identifying the above-ground dry weight of sorghum; (2) Screening or breeding sorghum individual plants, lines, strains or varieties with high above-ground dry weight; (3) Screening or breeding sorghum individual plants, lines, strains or varieties with low above-ground dry weight; (4) Preparing a product for identifying or assisting in identifying the above-ground dry weight of sorghum; (5) Preparing a product for screening or breeding sorghum individual plants, lines, strains or varieties with high above-ground dry weight; (6) Preparing a product for screening or breeding sorghum individual plants, lines, strains or varieties with low above-ground dry weight; The SNPs are two SNPs named SNP1 and SNP2 in the sorghum genome. SNP1 is the 603rd nucleotide of SEQ ID No.1 in the sequence listing, and its nucleotide type is T or G. SNP2 is the 814th nucleotide of SEQ ID No.1 in the sequence listing, and its nucleotide type is T or A. The haplotype is a polymorphic combination of these two SNPs, SNP1 and SNP2, on one chromosome of sorghum; The above-ground dry weight of sorghum with the genotype TTTT is higher than or potentially higher than that of sorghum with the genotypes TTAA and GGAA. TTTT is a combined genotype of two SNPs where the genotype of SNP1 is TT and the genotype of SNP2 is TT. The genotype TTAA is a combined genotype of two SNPs where the genotype of SNP1 is TT and the genotype of SNP2 is AA. The genotype GGAA is a combined genotype of two SNPs where the genotype of SNP1 is GG and the genotype of SNP2 is AA; Haplotype SbDW1 - The dry weight of the above-ground part of sorghum with the homozygous genotype corresponding to Hap1 is higher than or potentially higher than that of the haplotype SbDW1 - Sorghum with the homozygous genotype corresponding to Hap2 and the haplotype SbDW1 - Sorghum with the homozygous genotype corresponding to Hap3; the haplotype SbDW1 - Hap1 is the haplotype where SNP1 is T and SNP2 is T, the haplotype SbDW1 - Hap2 is the haplotype where SNP1 is T and SNP2 is A, the haplotype SbDW1 - Hap3 is the haplotype where SNP1 is G and SNP2 is A.

2. A method for identifying or assisting in identifying the above-ground dry weight of sorghum, and the method is Method A or Method B. Method A is a method for identifying or assisting in identifying the above-ground dry weight of sorghum, including detecting the genotype of the SNPs described in claim 1 in the sorghum to be tested, and identifying or assisting in identifying the above-ground dry weight of sorghum according to the genotype of the sorghum to be tested: The above-ground dry weight of sorghum with the genotype TTTT is higher than or potentially higher than that of sorghum with the genotypes TTAA and GGAA. TTTT is a combined genotype of two SNPs where the genotype of SNP1 is TT and the genotype of SNP2 is TT. The genotype TTAA is a combined genotype of two SNPs where the genotype of SNP1 is TT and the genotype of SNP2 is AA. The genotype GGAA is a combined genotype of two SNPs where the genotype of SNP1 is GG and the genotype of SNP2 is AA; Among them, The genotype of SNP1 being TT means a homozygous type where the 603rd nucleotide of SEQ ID No.1 in the sequence listing is T; The genotype of SNP1 being GG means a homozygous type where the 603rd nucleotide of SEQ ID No.1 in the sequence listing is G; The genotype of SNP2 being TT means a homozygous type where the 814th nucleotide in SEQ ID No.1 in the sequence listing is T; The genotype of SNP2 being AA means a homozygous type where the 814th nucleotide in SEQ ID No.1 in the sequence listing is A; The method B is a method for identifying or assisting in identifying the above-ground dry weight of sorghum, including detecting the haplotype described in claim 1 in the sorghum to be tested, and identifying or assisting in identifying the above-ground dry weight of sorghum according to the haplotype of the sorghum to be tested: haplotype SbDW1 - The above-ground dry weight of sorghum with a homozygous genotype corresponding to Hap1 is higher than or candidate higher than the haplotype SbDW1 - The sorghum with a homozygous genotype corresponding to Hap2 and the haplotype SbDW1 - The sorghum with a homozygous genotype corresponding to Hap3; the haplotype SbDW1 - Hap1 is the haplotype in which SNP1 is T and SNP2 is T, and the haplotype SbDW1 - Hap2 is the haplotype in which SNP1 is T and SNP2 is A, and the haplotype SbDW1 - Hap3 is the haplotype in which SNP1 is G and SNP2 is A.

3. The application according to claim 1 or the method according to claim 2, characterized in that: The sorghum is a sorghum inbred line.

4. Use of the method according to claim 2 or 3 in sorghum breeding.

5. A method for sorghum breeding, characterized in that: The method is M1 and M2: M1. The method includes detecting the genotype of the SNP described in claim 1 in the sorghum genome, and selecting sorghum with the genotype of TTTT of the SNP as a parent for breeding. The TTTT is a homozygous type where SNP1 is T and SNP2 is T. The purpose of the breeding of the method includes breeding sorghum with high above-ground dry weight; M2. The method includes detecting the type of the haplotype described in claim 1 in the sorghum genome and selecting the sorghum with the haplotype SbDW1 -Hap1 as a parent for breeding, and the haplotype SbDW1 -Hap1 is the haplotype where SNP1 is T and SNP2 is T.

6. The application according to claim 1, characterized in that: The substance is any of the following D1), D2), or D3): D1) The substance is a primer composition for amplifying a sorghum genomic DNA fragment including the SNP1 and a primer composition for amplifying a sorghum genomic DNA fragment including the SNP2; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

7. The application according to claim 6, wherein: The primer composition for amplifying a sorghum genomic DNA fragment including the SNP1 consists of primer F1-A, primer F1-B, and primer F1-C. The primer composition for amplifying a sorghum genomic DNA fragment including the SNP2 consists of primer F2-A, primer F2-B, and primer F2-C; The primer F1-A is a single-stranded DNA molecule with a nucleotide sequence that is the sequence 2 in the sequence listing or a single-stranded DNA of positions 22 - 42 of the sequence 2 in the sequence listing; The primer F1-B is a single-stranded DNA molecule with a nucleotide sequence that is the sequence 3 in the sequence listing or a single-stranded DNA of positions 22 - 41 of the sequence 3 in the sequence listing; The primer F1-C has a nucleotide sequence that is a single-stranded DNA molecule of the sequence 4 in the sequence listing; The primer F2-A is a single-stranded DNA molecule with a nucleotide sequence that is the sequence 5 in the sequence listing or a single-stranded DNA of positions 22 - 42 of the sequence 5 in the sequence listing; The primer F2-B is a single-stranded DNA molecule with a nucleotide sequence that is the sequence 6 in the sequence listing or a single-stranded DNA of positions 22 - 42 of the sequence 6 in the sequence listing; The primer F2-C has a nucleotide sequence that is a single-stranded DNA molecule of the sequence 7 in the sequence listing.

8. Use of a DNA molecule with a nucleotide sequence that is the sequence 1 in the sequence listing in any of the following, (1) Identifying or assisting in identifying the above-ground dry weight of sorghum; (2) Screening or breeding sorghum single plants or lines or strains or varieties with high above-ground dry weight; (3) Screening or breeding sorghum single plants or lines or strains or varieties with low above-ground dry weight; (4) Preparing a product for identifying or assisting in identifying the above-ground dry weight of sorghum; (5) Preparation of products for screening or breeding sorghum single plants or lines or strains or varieties with high above-ground dry weight; (6) Preparation of products for screening or breeding sorghum single plants or lines or strains or varieties with low above-ground dry weight; SNP1 is a SNP in the sorghum genome, which is the 603rd nucleotide of SEQ ID No.1 in the sequence listing, and its nucleotide type is T or G; SNP2 is a SNP in the sorghum genome, which is the 814th nucleotide of SEQ ID No.1 in the sequence listing, and its nucleotide type is T or A; the above-ground dry weight of sorghum with the genotype TTTT is higher than or candidate higher than that of sorghum with the genotypes TTAA and GGAA; the TTTT is a combined genotype of two SNPs where the genotype of SNP1 is TT and the genotype of SNP2 is TT; the genotype TTAA is a combined genotype of two SNPs where the genotype of SNP1 is TT and the genotype of SNP2 is AA; the genotype GGAA is a combined genotype of two SNPs where the genotype of SNP1 is GG and the genotype of SNP2 is AA.

Images