A closed-tube visual detection method for RNA viral nucleic acids

By integrating reverse transcription, nucleic acid amplification, and gold nanoparticle probe hybridization colorimetric reaction into a single closed tube system, the problems of cumbersome operation and low sensitivity in RNA virus nucleic acid detection have been solved, achieving efficient and convenient RNA virus nucleic acid detection.

CN115807131BActive Publication Date: 2026-06-09NANJING GENERAL HOSPITAL NANJING MILLITARY COMMAND P L A

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING GENERAL HOSPITAL NANJING MILLITARY COMMAND P L A
Filing Date
2022-12-21
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing RNA virus nucleic acid detection methods require RNA reverse transcription into cDNA outside the tube, which is cumbersome and time-consuming. Furthermore, existing closed-tube detection methods have low sensitivity and poor specificity, making it difficult to meet the needs of point-of-care testing (POCT).

Method used

This system integrates reverse transcription, nucleic acid amplification, nucleic acid invasion, and gold nanoparticle probe hybridization and colorimetric reactions in a single closed-tube system, enabling direct detection of RNA virus nucleic acids through HiScript II reverse transcriptase and temperature control.

Benefits of technology

It simplifies the operation process, shortens the detection time, improves the detection sensitivity and specificity, allows results to be interpreted by the naked eye without additional equipment, reduces costs, and reduces aerosol pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115807131B_ABST
    Figure CN115807131B_ABST
Patent Text Reader

Abstract

The application discloses a new method for closed tube visual detection of RNA virus nucleic acid, and the whole detection comprises three parts: reverse transcription reaction (target RNA is reversely transcribed into cDNA), nucleic acid amplification reaction coupling nucleic acid invasion reaction (product detection is converted into nucleic acid fragment detection), and nano gold probe hybridization color reaction (nucleic acid fragment detection is converted into visual detection). All reactions can be sequentially carried out in a single closed system by controlling temperature, without other additional operations, so that the nucleic acid visual detection of "sample in, result out" is realized. The method has the characteristics of simple operation, low cost, high sensitivity and high specificity, does not depend on fluorescence detection equipment, and can directly judge the result by naked eyes, is suitable for visual detection of nucleic acid of various pathogens, and has a good application prospect in on-site instant detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention patent relates to a closed-tube visualization detection method for RNA virus nucleic acids, belonging to the field of nucleic acid detection technology. Background Technology

[0002] In recent years, infectious diseases caused by RNA viruses have posed a significant threat to global human health. Therefore, many nucleic acid-based rapid pathogen detection technologies have been widely applied in the early diagnosis and prevention and control of infectious diseases. Polymerase Chain Reaction (PCR), considered the "gold standard" for nucleic acid detection, primarily uses the TaqMan probe method or fluorescent dye method. This method requires sophisticated experimental equipment, including complex fluorescence reading instruments, making it unsuitable for widespread use in resource-constrained areas. In contrast, visual nucleic acid detection methods do not require expensive instruments and can be interpreted visually, thus attracting increasing attention from researchers.

[0003] Visual detection methods for point-of-care testing (POCT) mainly include colorimetry and transverse flow test strips. Colorimetry based on pH-sensitive and metal ion indicators shows little color difference between positive and negative results when detecting low viral loads, making visual interpretation difficult and prone to misinterpretation. Transverse flow test strips, as a low-cost and easy-to-use paper-based visual detection tool, provide a clear and easily interpretable result, but their detection target is amplification products, which can easily cause serious aerosol contamination. While gold nanoparticles possess unique photochemical properties, making them an ideal material for visual detection, their hybridization colorimetric reaction suffers from low sensitivity and poor specificity, rendering it unsuitable for clinical sample testing. This study aims to couple the gold nanoparticle hybridization colorimetric reaction with nucleic acid amplification and nucleic acid invasion reactions to establish a highly sensitive, highly specific, and fluorescence-free closed-tube visual detection method, providing a new strategy for nucleic acid visualization detection in POCT.

[0004] Currently, there is a closed-tube nucleic acid detection technology that integrates nucleic acid amplification, cascaded nucleic acid invasion reaction, and nanoparticle probe hybridization reaction (see patent "A Novel Closed-Tube Visual Nucleic Acid Detection Method Coupled with Nucleic Acid Amplification Reaction, Nucleic Acid Invasion Reaction, and Nanoparticle Colorimetric Reaction", patent application number "201310478388.1"). However, this method requires DNA as the initial template. When detecting RNA viruses, RNA needs to be reverse transcribed into cDNA outside the tube, and then the cDNA is added to the closed system as a template for the reaction, which is cumbersome and time-consuming. Therefore, we have developed a method that can sequentially perform reverse transcription reaction, nucleic acid amplification coupled with invasion reaction, and nanoparticle probe hybridization colorimetric reaction in a single closed tube system, realizing closed-tube visual detection of RNA virus nucleic acids. Summary of the Invention

[0005] The purpose of this invention is to provide the application of HiScript II reverse transcriptase in the closed-tube visualization detection of RNA viral nucleic acids.

[0006] This invention also provides a closed-tube visualization detection method for RNA virus nucleic acids, the steps of which include:

[0007] (1) Add all components of the reverse transcription reaction, nucleic acid amplification reaction coupled with nucleic acid invasion reaction, and nano-gold probe hybridization colorimetric reaction to the reaction tube, and add the target nucleic acid RNA;

[0008] (2) Adjust the reaction temperature to be lower than the reaction temperature of the nano-gold probe hybridization colorimetric reaction and carry out the reverse transcription reaction;

[0009] (3) Increase the reaction temperature to carry out the nucleic acid amplification reaction, and at the same time set the annealing temperature in the nucleic acid amplification reaction to the reaction temperature of the nucleic acid invasion reaction, so that the nucleic acid amplification reaction and the nucleic acid invasion reaction are carried out simultaneously.

[0010] Alternatively, the reaction temperature can be increased to carry out the nucleic acid amplification reaction, and then the temperature can be decreased to carry out the nucleic acid invasion reaction;

[0011] (4) Lower the reaction temperature to the hybridization and color development temperature of the gold nanoprobe, carry out the hybridization and color development reaction of the gold nanoprobe, and judge the result by observing the color change with the naked eye.

[0012] The reverse transcriptase used in the reverse transcription reaction is HiScript II reverse transcriptase.

[0013] Preferably, the nucleic acid invasion reaction includes an upstream and downstream probe specific to the target nucleic acid, a 5'flap exonuclease or a 5'flap endonuclease, and a hairpin probe; the 3' end of the upstream probe contains an invasion base and has a Tm value higher than the temperature of the nucleic acid invasion reaction, allowing it to bind stably to the target nucleic acid; the 5' end of the downstream probe contains a raised flap fragment and has a Tm value close to the temperature of the nucleic acid invasion reaction; the upstream probe, downstream probe, and target nucleic acid form a three-base overlapping structure that can be recognized and cleaved by the 5'flap exonuclease or the 5'flap endonuclease, and the flap fragment is cleaved off; the 5' and 3' ends of the hairpin probe each contain a sequence that can bind to the two nucleic acid probes modified on the surface of the gold nanoparticles, and the middle part also contains a sequence complementary to the flap fragment, forming a three-base overlapping structure with the cleaved flap fragment that can be recognized and cleaved by the 5'flap exonuclease or the 5'flap endonuclease;

[0014] The hybridization and colorimetric reaction of the gold nanoparticles described therein uses two nucleic acid probes whose surfaces are modified with thiol groups, and the unmodified probe portions of the gold nanoparticles are blocked.

[0015] Preferably, the maximum temperature of the reverse transcription reaction is at least 5°C lower than the reaction temperature of the gold nanoparticle probe hybridization colorimetric reaction.

[0016] Preferably, the surface of the gold nanoparticles is blocked with a silanizing agent, PEG, or oligopeptide.

[0017] Preferably, the downstream probe and hairpin probe 3' ends in the nucleic acid invasion reaction are blocked and modified.

[0018] Preferably, the annealing temperature in the nucleic acid amplification reaction is 60-63°C, which is also the reaction temperature for the nucleic acid invasion reaction.

[0019] Preferably, the nucleic acid amplification reaction refers to polymerase chain reaction (PCR), nucleation endonuclease-assisted nucleic acid amplification (NEAA), loop-mediated isothermal amplification (LAMP), or ligation amplification (LCR), with polymerase chain reaction being the most preferred.

[0020] Preferably, the enzyme used in the nucleic acid amplification reaction is Taq DNA polymerase, Tth DNA polymerase, or pfu DNA polymerase, with Taq DNA polymerase being the most preferred.

[0021] Preferably, the 5'flap exonuclease or 5'flap endonuclease refers to Afu FEN, Mth FEN or Pfu FEN, with Afu FEN being preferred.

[0022] Preferably, the temperature of the reverse transcription reaction is 35-45℃, and more preferably 45℃.

[0023] Preferably, the two nucleic acid probes modified on the surface of the gold nanoparticles bind to the 5' end fragment and the 3' end fragment of the hairpin probe, respectively. When the target nucleic acid sequence is present in the sample to be tested, the 5' end fragment of the hairpin probe is cleaved, and then the gold nanoparticle hybridization colorimetric reaction is performed, so that the gold nanoparticles are in a dispersed state; otherwise, they are in an aggregated state.

[0024] Preferably, the temperature for the hybridization and colorimetric reaction of the gold nanoparticle probe is 53-58℃.

[0025] Preferably, the reaction system contains 5-30 mM Tris, 4-10 mM magnesium ions and 20-80 mM sodium ions.

[0026] The two gold nanoparticle probe sequences used for the hybridization and colorimetric reaction of the gold nanoparticle probes are SH-AAAAAAAAAAATGGTTCATCACGAT-C3 and GCAGTACCACAAGACAAA AAAAAAA-SH.

[0027] The hairpin probe sequence used for the hybridization and colorimetric reaction of the gold nanoparticle probe is GTCTTGTGGTACTGCACTCGTCTCGGTTTTCCGAGACGAGTCCTCGGCGCGATCGTGA TGAACCAT-C3.

[0028] The temperature control described in the method of the present invention can be performed on a conventional PCR instrument, a handheld PCR instrument, or a device with cyclic temperature control, preferably a conventional PCR instrument.

[0029] The reaction principle of this invention is as follows: Figure 1 As shown, the entire detection process is performed in a closed system and consists of three parts: target nucleic acid reverse transcription, nucleic acid amplification coupled with nucleic acid invasion, and gold nanoparticle probe hybridization and colorimetric reaction. These three reactions are carried out sequentially by controlling the temperature. First, the target nucleic acid undergoes reverse transcription under the action of reverse transcriptase to synthesize cDNA. Then, using the cDNA as a template, highly sensitive nucleic acid amplification is performed, and the amplification product is detected using a highly specific nucleic acid invasion reaction that can distinguish single-base differences. To achieve simultaneous nucleic acid amplification and nucleic acid invasion reactions, the annealing temperature is set to the optimal temperature for the nucleic acid invasion reaction. When the upstream and downstream probes hybridize with the target nucleic acid to form a three-base overlapping structure, the 5'flap exonuclease or 5'flap endonuclease can recognize this structure and cleave the downstream probe containing the flap fragment, releasing the flap-1 portion. The generated flap-1 sequence can then invade the hairpin probe to form a three-base overlapping structure again. The 5'flap exonuclease or 5'flap endonuclease again recognizes and cleaves this structure to produce flap-2 and the remaining hairpin probe, thus continuously amplifying the signal. Finally, the generated flap-2 can hybridize with the gold nanoparticle probe (AuNP-1), and the remaining hairpin 3' end can hybridize with the gold nanoparticle probe (AuNP-2). After centrifugation, the gold nanoparticle probe remains dispersed, and the solution is red. Conversely, when the target is absent, a triple-base overlapping structure cannot be formed, the flap fragment cannot be cleaved, and the intact hairpin probe can crosslink with multiple nucleic acid probes on the gold nanoparticle, forming a spatial network structure of AuNP-1-hairpin probe-AuNP-2. After centrifugation, the solution is colorless, and there is a deposit of gold nanoparticle probe aggregation and crosslinking at the bottom. Therefore, the results can be interpreted by visually observing the color change. In the reaction system of this invention, the temperature of the reverse transcription reaction is the lowest, followed by the temperature of the gold nanoparticle probe hybridization reaction, and the temperature of the amplification reaction is the highest. The annealing temperature of the amplification reaction is equal to the temperature of the nucleic acid invasion reaction, while the temperature of the nucleic acid invasion reaction is still higher than the temperature of the gold nanoparticle probe hybridization reaction.

[0030] The upstream probe structure used for nucleic acid invasion reactions is as follows: Figure 2As shown, the 3' end contains an invading base, and the Tm value is higher than the temperature of the nucleic acid invading reaction, which allows it to bind stably to the target nucleic acid.

[0031] The downstream probe structure used for nucleic acid invasion reaction is as follows: Figure 3 As shown, the 5' end contains a raised flap fragment, and the Tm value is close to the temperature of the nucleic acid invasion reaction. When the raised flap fragment is cleaved by 5' flap exonuclease or 5' flap endonuclease, the Tm value decreases, and the downstream probe detaches from the target nucleic acid.

[0032] Among them, the 5'flap exonuclease or 5'flap endonuclease used in nucleic acid invasion reactions is a type of enzyme that can recognize the triple-base overlap structure formed by the upstream probe, downstream probe, and target nucleic acid, such as... Figure 4 As shown, the enzyme is cleaved to release the 5'-flap fragment, which exhibits the highest activity at 63°C.

[0033] The hairpin probe used for nucleic acid invasion reaction contains sequences at its 5' and 3' ends that can bind to two nucleic acid probes modified on the surface of gold nanoparticles. The middle portion also contains sequences complementary to the flap fragment, such as... Figure 5 As shown, the triple-base overlap structure formed by the hairpin probe and the flap fragment can be recognized and cleaved by 5' flap exonuclease or 5' flap endonuclease, such as... Figure 6 As shown.

[0034] The method of the present invention can also be used in the novel closed visualization nucleic acid detection method that couples nucleic acid amplification reaction, nucleic acid invasion reaction and nanoparticle colorimetric reaction disclosed in Chinese patent document CN201310478388.1. It is only necessary to replace the target sequence with an RNA virus and add HiScript II reverse transcriptase to perform reverse transcription reaction before nucleic acid amplification reaction.

[0035] The present invention also found that only HiScript II reverse transcriptase can be used for closed-tube visualization detection of RNA virus nucleic acids in the one-tube unopened method of the present invention. Other common reverse transcriptases, such as Tth DNA polymerase, M-MLV reverse transcriptase, and AMV reverse transcriptase, cannot be used in the present invention.

[0036] The beneficial effects of this invention are:

[0037] (1) In the method of the present invention, the viral RNA to be tested is added to a closed tube system for reaction, and the detection result can be obtained without additional operation steps, realizing the direct detection of viral RNA. The operation steps of this method are simple, shortening the entire detection reaction time, and there is no need to open the tube for operation, which greatly reduces aerosol contamination.

[0038] (2) In the method of the present invention, four reactions can be carried out sequentially in a single closed tube system by controlling the temperature, including reverse transcription reaction, nucleic acid amplification reaction coupled with nucleic acid invasion reaction and nano gold probe hybridization color development reaction.

[0039] (3) In the method of the present invention, the nucleic acid amplification reaction and the nucleic acid invasion reaction are carried out simultaneously, which improves the detection sensitivity.

[0040] (4) In the method of the present invention, polymerase chain reaction (PCR) is used to exponentially amplify the template. As the most classic nucleic acid amplification method, it has the characteristics of high sensitivity, high stability and simple composition.

[0041] (5) In the method of the present invention, PCR is coupled with a highly specific nucleic acid invasion reaction that can distinguish single base differences, the product detection is converted into nucleic acid fragment detection, and then the signal is further amplified to achieve highly sensitive and highly specific nucleic acid amplification detection.

[0042] (6) In the method of the present invention, the detection of nucleic acid fragments is transformed into a visual detection by using nano-gold hybridization colorimetric reaction. The results can be interpreted by observing the color change with the naked eye. The negative result is colorless and the positive result is red. This method does not rely on fluorescence detection equipment, which greatly reduces the cost.

[0043] In the method of this invention, the components of the closed-tube visualization detection reaction system, including buffer, reverse transcriptase, DNA polymerase, Afu FEN1 enzyme, hairpin probe, and gold nanoparticle probe, are all universal. Only the upstream and downstream primers and probes need to be designed according to different target nucleic acids, making it easy to promote and use. Attached Figure Description

[0044] Figure 1 This is a schematic diagram illustrating the principle of the method of the present invention.

[0045] Figure 2 This relates to an upstream probe in the method of the present invention that contains an intruding base at its 3' end.

[0046] Figure 3 This relates to the downstream probe in the method of the present invention, which contains a raised flap fragment at its 5' end.

[0047] Figure 4 It relates to the triple-base overlap structure formed by the upstream probe, downstream probe, and target nucleic acid in the method of this invention.

[0048] Figure 5 This is a schematic diagram of the hairpin probe in the method of the present invention.

[0049] Figure 6 It relates to the three-base overlap structure formed by the hairpin probe and the flap fragment in the method of the present invention.

[0050] Figure 7 This is a diagram showing the absorption wavelengths of gold nanoparticles and gold nanoparticle probes in the 300–700 nm range in the method of this invention.

[0051] Figure 8 This is a transmission electron microscope image of the gold nanoparticles used in the method of this invention.

[0052] Figure 9 This relates to the absorption wavelength of the nano-gold probe hybridization colorimetric reaction in the method of this invention, which is between 300 and 700 nm.

[0053] Figure 10 This is a graph showing the sensitivity results of the method of this invention in detecting the novel coronavirus and mutant RNA.

[0054] Figure 11 This is a diagram showing the specific results of the method of this invention for detecting the novel coronavirus and its mutant typing.

[0055] Figure 12 This is a diagram showing the results of detecting SARS-CoV-2 nucleic acid samples using the method of this invention.

[0056] Figure 13 This relates to the screening results of reverse transcriptase in the reverse transcription reaction of the method of the present invention.

[0057] Figure 14 This refers to the detection results of nucleic acid amplification reaction and nucleic acid invasion reaction performed simultaneously or in steps according to the method of the present invention.

[0058] Figure 15 This is a flowchart of the method of the present invention. Detailed Implementation

[0059] The present invention will be further described below with reference to the embodiments, but the description of the embodiments does not limit the scope of protection of the present invention in any way. Figure 1 This demonstrates the principle of the invention. Figure 15 The process of this invention is illustrated.

[0060] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of this invention is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0061] Unless otherwise specified, all substances or instruments used in the following examples can be obtained from conventional commercial sources.

[0062] Example 1: Preparation of all relevant components of a closed-tube visualized nucleic acid detection reaction

[0063] (1) Preparation of reaction buffer: Take 0.6057g Tris, 0.7624g MgCl2·6H2O, 0.8775g NaCl, 250μL NP-40 and 250μL Tween-20 into a beaker, add an appropriate amount of DEPC water, stir and mix at room temperature, adjust the pH to 8.5 with HCl, and finally make up to 50mL with DEPC water.

[0064] (2) PCR primer design: Since the annealing temperature is set to 63℃, the Tm value of the primer is higher than that of ordinary PCR primers. The Tm value can be increased by increasing the number of bases in the primer. The primer length is best between 30 and 35 bases. Otherwise, if the primer is too long, it will lead to the formation of secondary structures. The G / C content is controlled between 40% and 60%. The amplification product length is best between 100 and 200 bp.

[0065] (3) Probe design for nucleic acid invasion reaction: Based on the sequence information of the target nucleic acid, invader probes are designed using Universalinvader™ software, and IDT online sequence analysis tool is used to analyze whether there are special structures such as dimers, hairpins and stem loops between upstream and downstream probes. In particular, probe pairs with special structures formed at the invasion site should be excluded.

[0066] (4) Expression of FEN1 enzyme: The FEN1 gene sequence derived from Archaeococcus thermophilus was synthesized. Using pET24a(+) as the expression vector, the pET24a(+)-FEN1-His recombinant plasmid was constructed. The recombinant plasmid was transformed into Escherichia coli BL21(DE3). The E. coli was cultured overnight at 37℃ and 200 r / min for 8 h. IPTG was added to the final concentration of 0.05 mmol / L, and expression was induced at 37℃ and 200 r / min for 11 h. Finally, the recombinant FEN1 was successfully purified by nickel affinity chromatography.

[0067] (5) Preparation of gold nanoparticles:

[0068] Nano-gold solutions were prepared using the sodium citrate-chloroauric acid reduction method. All containers were cleaned with aqua regia (concentrated hydrochloric acid: concentrated nitric acid = 3:1 mixture). A 38.8 mmol / L sodium citrate solution and a 5 mmol / L chloroauric acid solution were prepared. 100 mL of the 5 mmol / L chloroauric acid solution and 400 mL of Watson's distilled water were added to a 1 L three-necked round-bottom flask. The mixture was stirred magnetically and heated to boiling in a silicone oil bath. After the reflux stabilized, 50 mL of the 38.8 mmol / L sodium citrate solution was quickly added. Once the solution color changed from yellow to deep red, heating and stirring continued for 15 min. The heat source was then removed, and the solution was allowed to cool naturally to room temperature. The prepared nano-gold solutions were stored at 4 °C protected from light. A small amount of the solution was taken to measure its absorption wavelength in the 300–700 nm range (e.g., ...). Figure 7 ), and the uniformity of particle size was examined by transmission electron microscopy (e.g. Figure 8 ).

[0069] (6) Preparation of gold nanoprobes:

[0070] Take 500 μL of gold nanoparticle solution, centrifuge at 7500g for 15 min, discard the supernatant, and resuspend in 500 μL of H2O. Add 90 μL of 0.1 mol / L DTT solution to the thiol-modified nucleic acid probe powder for reduction for 2.5 h, and purify using a NAP-5 column. Collect the purified nucleic acid solution, mix well by pipetting, and aliquot into the washed gold nanoparticle solution. Incubate at 26°C in the dark for 16 h, then add 100 μL of 0.01 mol / L PB buffer (pH 7.5) and 250 μL of 1.2 mol / L NaCl to each tube, and incubate at 26°C in the dark for 24 h. After incubation, centrifuge at 7500g and wash three times with water. Finally, add 1 mL of 10 mmol / L PB buffer (pH 7.5) and mix by pipetting, then allow for silanization. Add 800 μL of PB buffer (10 mmol / L, pH 7.5), 100 μL of gold nanoparticle solution, and 100 μL of 5 mmol / L MPTMS solution sequentially to the same tube. Incubate at room temperature in the dark for 24 h, then wash the gold nanoparticle probe with water, centrifuge at 7500g for 45 min, discard the supernatant, and resuspend in 1 mL of H2O. Centrifuge three times, and finally resuspend the gold nanoparticle probe in 1 mL of H2O. The prepared silanized gold nanoparticle probe needs to be stored at 4℃ in the dark for more than two weeks. After verifying the hybridization performance and thermal stability through preliminary experiments, it can be used for subsequent experiments. Take a small amount of solution to measure its absorption wavelength in the 300–700 nm range (e.g., ...). Figure 9 ).

[0071] Example 2 uses a closed-tube visualization nucleic acid detection method to detect the RNA of SARS-CoV-2 and its mutants (A570D, D80A and T547K) and examines its sensitivity.

[0072] The reaction system was prepared as follows: 2 μL of reaction buffer, 50 U HiScript II reverse transcriptase, 0.25 mM dNTPs, 0.5 μM upstream primer, 0.5 μM downstream primer, 0.25 U GoTaq DNA polymerase, 3.5% PEG8000, 0.1 μM upstream probe, 0.4 μM downstream probe, 0.2 μM hairpin probe, 100 ng FEN1 endonuclease, 2 μL of gold nanoparticle probe-1, and 2 μL of gold nanoparticle probe-2 were added to a reaction tube. Water was added to bring the volume to 19 μL, and finally, 1 μL of RNA template at different concentrations was added. The reaction program was: 45℃ for 20 min, 94℃ for 30 s, 35 cycles (94℃ for 10 s, 63℃ for 20 s, 72℃ for 30 s), 72℃ for 2 min, and 55℃ for 20 min. The designed primers are shown in Table 1, and the probes are shown in Table 2.

[0073] Table 1. PCR primer sequences

[0074]

[0075]

[0076] Note: F is the upstream primer; R is the downstream primer.

[0077] Table 2. Nucleic acid invasion reaction probe sequences

[0078]

[0079] Note: UP stands for upstream probe; DP stands for downstream probe.

[0080] The results are as follows Figure 10 As shown, the sensitivity of this method for detecting the SARS-CoV-2 N gene, ORFlab gene, and D80A is 5 copies / reaction, and the sensitivity for detecting the S gene, A570D, and T547K is 20 copies / reaction, indicating that the method has good sensitivity.

[0081] Example 3 uses a closed-tube visualization nucleic acid detection method to detect the N gene of the novel coronavirus and the RNA of five respiratory pathogens (influenza A virus, influenza B virus, parainfluenza type 1 virus, parainfluenza type 2 virus, and parainfluenza type 3 virus) and to detect the typing of three novel coronavirus mutant strains, to examine the specificity of the method.

[0082] The reaction system was prepared as follows: 2 μL of reaction buffer, 50 U HiScript II reverse transcriptase, 0.25 mM dNTPs, 0.5 μM upstream primer, 0.5 μM downstream primer, 0.25 U GoTaq DNA polymerase, 3.5% PEG8000, 0.1 μM upstream probe, 0.4 μM downstream probe, 0.2 μM hairpin probe, 100 ng FEN1 endonuclease, 2 μL of gold nanoparticle probe-1, and 2 μL of gold nanoparticle probe-2 were added to a reaction tube. Water was added to bring the volume to 19 μL, and finally 1 μL of RNA template was added. The reaction program was: 45℃ for 20 min, 94℃ for 30 s, 35 cycles (94℃ for 10 s, 63℃ for 20 s, 72℃ for 30 s), 72℃ for 2 min, 55℃ for 20 min.

[0083] The results are as follows Figure 11 As shown, only the N gene of the SARS-CoV-2 virus was detected positive, indicating that the closed-tube visualization nucleic acid detection method does not produce false positives, demonstrating its good specificity. Furthermore, the specificity in the typing of SARS-CoV-2 mutant strains was investigated. This study used a crossover experiment to type three SARS-CoV-2 mutant strains. No positive signals were generated in any of the results, proving that this method has good specificity in the typing of SARS-CoV-2 mutant strains.

[0084] Example 4 uses a closed-tube visualization nucleic acid detection method to detect the N gene and ORFlab gene in 50 SARS-CoV-2 nucleic acid samples to examine the feasibility of the method.

[0085] The reaction system was prepared as follows: 2 μL of reaction buffer, 50 U HiScript II reverse transcriptase, 0.25 mM dNTPs, 0.5 μM upstream primer, 0.5 μM downstream primer, 0.25 U GoTaq DNA polymerase, 3.5% PEG8000, 0.1 μM upstream probe, 0.4 μM downstream probe, 0.2 μM hairpin probe, 100 ng FEN1 endonuclease, 2 μL of gold nanoparticle probe-1, and 2 μL of gold nanoparticle probe-2 were added to a reaction tube. Water was added to bring the volume to 19 μL, and finally, 5 μL of clinical sample nucleic acid was added. The reaction program was: 45℃ for 20 min, 94℃ for 30 s, 35 cycles (94℃ for 10 s, 63℃ for 20 s, 72℃ for 30 s), 72℃ for 2 min, 55℃ for 20 min.

[0086] The results are as follows Figure 12 As shown, 10 cases tested positive and 40 cases tested negative. The results were consistent when compared with a commercially available COVID-19 nucleic acid test kit (multiplex fluorescent RT-PCR method), indicating that this method has the potential for clinical application.

[0087] The above embodiments are only for illustrating the technical concept and features of the present invention. Their purpose is to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be used to limit the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

[0088] Comparative Example 1: Screening of Reverse Transcriptase

[0089] The reaction system was prepared as follows: Take 2 μL of reaction buffer, different reverse transcriptases (5 U Tth DNA polymerase, 200 μM-MLV reverse transcriptase, 5 U AMV reverse transcriptase, or 200 U HiScript II reverse transcriptase), 0.25 mM dNTPs, 0.5 μM upstream primer, 0.5 μM downstream primer, 0.25 U GoTaq DNA polymerase, add water to make up to 18 μL, and finally add 1 μL of 10 5 The RNA template of the N gene (copy / μL) was vortexed and placed in a PCR amplification instrument for reaction. Finally, 3.5 μL of the RT-PCR product was subjected to agarose gel electrophoresis at 120V for 30 min with an agarose gel concentration of 2%. Different reverse transcriptases correspond to different reaction procedures.

[0090] The RT-PCR reaction program using Tth DNA polymerase was as follows: 65℃ for 30 min, 94℃ for 30 s, 40 cycles (94℃ for 10 s, 63℃ for 20 s, 72℃ for 30 s), 72℃ for 2 min.

[0091] The RT-PCR reaction program using M-MLV reverse transcriptase or AMV reverse transcriptase was as follows: 42℃ for 30 min, 94℃ for 30 s, 40 cycles (94℃ for 10 s, 63℃ for 20 s, 72℃ for 30 s), 72℃ for 2 min.

[0092] HiScript II reverse transcriptase was used, and the RT-PCR reaction program was: 50℃ for 30 min, 94℃ for 30 s, 40 cycles (94℃ for 10 s, 63℃ for 20 s, 72℃ for 30 s), 72℃ for 2 min.

[0093] The results are as follows Figure 13As shown, compared with the positive control, only HiScript II reverse transcriptase successfully reverse transcribed RNA into cDNA in the closed-tube reaction system, producing a PCR product band of approximately 200 bp, consistent with the positive control. Other reverse transcriptases (Tth DNA polymerase, M-MLV reverse transcriptase, and AMV reverse transcriptase) produced cDNA PCR product bands smaller than 100 bp, possibly due to non-specific amplification caused by primer dimers. This indicates that these three reverse transcriptases are not adapted to the buffer's pH and ionic strength, leading to reverse transcription reaction failure. Therefore, HiScript II reverse transcriptase was chosen for the reverse transcription reaction in the closed-tube visualization detection method for RNA viral nucleic acids.

[0094] Comparative Example 2 investigated the sensitivity of PCR nucleic acid amplification and nucleic acid invasion reactions to be carried out simultaneously or in steps.

[0095] The reaction system was prepared as follows: 2 μL of reaction buffer, 50 U HiScript II reverse transcriptase, 0.25 mM dNTPs, 0.5 μM upstream primer, 0.5 μM downstream primer, 0.25 U GoTaq DNA polymerase, 3.5% PEG8000, 0.1 μM upstream probe, 0.4 μM downstream probe, 0.2 μM hairpin probe, 100 ng FEN1 endonuclease, 2 μL of gold nanoparticle probe-1 and 2 μL of gold nanoparticle probe-2 were added to a reaction tube, and water was added to bring the volume to 19 μL. Finally, 1 μL of the N gene RNA template was added.

[0096] (1) The PCR nucleic acid amplification reaction and the nucleic acid invasion reaction are carried out simultaneously:

[0097] The reaction program was as follows: 45℃ for 20 min, 94℃ for 30 s, 35 cycles (94℃ for 10 s, 63℃ for 20 s, 72℃ for 30 s), 72℃ for 2 min, 55℃ for 20 min.

[0098] (2) The PCR nucleic acid amplification reaction and the nucleic acid invasion reaction are carried out in separate steps:

[0099] The reaction program was as follows: 45℃ for 20 min, 94℃ for 30 s, 35 cycles (94℃ for 10 s, 72℃ for 30 s), 72℃ for 2 min, 63℃ for 10 min, 55℃ for 20 min.

[0100] The results are as follows Figure 14 As shown, when the PCR nucleic acid amplification reaction and the nucleic acid invasion reaction are carried out simultaneously, 10 copies of the N gene RNA template can be detected. However, when the PCR nucleic acid amplification reaction and the nucleic acid invasion reaction are carried out step by step, 10 copies of the N gene RNA template cannot be detected. Therefore, the PCR nucleic acid amplification reaction and the nucleic acid invasion reaction are carried out simultaneously in the subsequent steps to improve the detection sensitivity.

Claims

1. A closed-tube visualization detection method for RNA virus nucleic acids, characterized in that... The steps include: (1) Add all components of reverse transcription reaction, nucleic acid amplification reaction coupled with nucleic acid invasion reaction and gold nanoparticle probe hybridization colorimetric reaction to the reaction tube, and add target nucleic acid RNA. The 10× reaction buffer in the reaction system is prepared as follows: each 50 ml contains 0.6057 g Tris, 0.7624 g MgCl2·6H2O, 0.8775 g NaCl, 250 μL NP-40 and 250 μL L between-20, with the remainder being DEPC water, and the pH value is 8.5; (2) Adjust the reaction temperature to be lower than the reaction temperature of the gold nanoparticle probe hybridization colorimetric reaction and carry out the reverse transcription reaction; (3) Increase the reaction temperature to carry out the nucleic acid amplification reaction, and set the annealing temperature in the nucleic acid amplification reaction to the reaction temperature of the nucleic acid invasion reaction, so that the nucleic acid amplification reaction and the nucleic acid invasion reaction are carried out simultaneously. The nucleic acid amplification reaction refers to polymerase chain reaction PCR. (4) Lower the reaction temperature to the hybridization and color development temperature of the gold nanoprobe, carry out the hybridization and color development reaction of the gold nanoprobe, and judge the result by observing the color change with the naked eye; The reverse transcriptase used in the reverse transcription reaction is HiScript II reverse transcriptase.

2. The closed-tube visualization detection method for RNA virus nucleic acid according to claim 1, characterized in that... The nucleic acid invasion reaction described therein includes an upstream and downstream probe specific to the target nucleic acid, a 5' flap exonuclease or a 5' flap endonuclease, and a hairpin probe; the 3' end of the upstream probe contains an invasion base, and the Tm value is higher than the temperature of the nucleic acid invasion reaction, so that it can bind stably to the target nucleic acid; The downstream probe has a raised flap fragment at its 5' end, and the Tm value is close to the temperature of the nucleic acid invasion reaction. The upstream probe, downstream probe and target nucleic acid form a three-base overlapping structure that can be recognized and cleaved by 5' flap exonuclease or 5' flap endonuclease, and the flap fragment is cut off. The hairpin probe contains a sequence at its 5' and 3' ends that can bind to two nucleic acid probes modified on the surface of gold nanoparticles. The middle part also contains a sequence complementary to the flap fragment, forming a three-base overlapping structure with the cleaved flap fragment that can be recognized and cleaved by 5' flap exonuclease or 5' flap endonuclease. The hybridization and colorimetric reaction of the gold nanoparticles described therein uses two nucleic acid probes whose surfaces are modified with thiol groups, and the unmodified probe portions of the gold nanoparticles are blocked.

3. The closed-tube visualization detection method for RNA virus nucleic acid according to claim 1, characterized in that: The maximum temperature of the reverse transcription reaction is at least 5°C lower than the reaction temperature of the gold nanoparticle probe hybridization colorimetric reaction.

4. The closed-tube visualization detection method for RNA virus nucleic acid according to claim 2, characterized in that: The surface of the gold nanoparticles is blocked using silanizing agents, PEG, or oligopeptides.

5. The closed-tube visualization detection method for RNA virus nucleic acid according to claim 2, characterized in that: The downstream probe and hairpin probe in the nucleic acid invasion reaction are blocked at their 3' ends.

6. The closed-tube visualization detection method for RNA virus nucleic acid according to any one of claims 1-5, characterized in that: The annealing temperature in the nucleic acid amplification reaction is 60-63℃.

7. The closed-tube visualization detection method for RNA virus nucleic acid according to any one of claims 1-5, characterized in that: The Tm value of the PCR primers used in the nucleic acid amplification reaction is not lower than 65℃.

8. The closed-tube visualization detection method for RNA virus nucleic acid according to any one of claims 1-5, characterized in that: The enzyme used in the nucleic acid amplification reaction is Taq DNA polymerase, Tth DNA polymerase, or pfu DNA polymerase.

9. The closed-tube visualization detection method for RNA virus nucleic acid according to claim 2, characterized in that: The 5' flap exonuclease or 5' flap endonuclease refers to Afu FEN, Mth FEN, or Pfu FEN.

10. The closed-tube visualization detection method for RNA virus nucleic acid according to any one of claims 1-5, characterized in that: The temperature for reverse transcription is 35-45℃.

11. The closed-tube visualization detection method for RNA virus nucleic acid according to any one of claims 1-5, characterized in that: The temperature range for the hybridization and colorimetric reaction of the nano-gold probe is 53-58℃.

12. The closed-tube visualization detection method for RNA virus nucleic acid according to claim 2, characterized in that: Two nucleic acid probes modified on the surface of gold nanoparticles bind to the 5' end fragment and the 3' end fragment of the hairpin probe, respectively. When the target nucleic acid sequence is present in the sample to be tested, the 5' end fragment of the hairpin probe is cleaved, and then the gold nanoparticle probe hybridization and colorimetric reaction is performed, so that the gold nanoparticle probe is in a dispersed state; otherwise, it is in an aggregated state.