Transcription Factors Related to Capsanthin Synthesis and Their Applications

Abstract

The present invention belongs to the field of genetics, and particularly relates to a transcription factor related to capsanthin synthesis and its application. The technical solution is: the CaDIV1 transcription factor, and the amino acid sequence of the CaDIV1 transcription factor is shown in SEQ NO ID.2. The present invention provides an R-R type MYB transcription factor CaDIV1 that is highly related to capsanthin biosynthesis. Through a series of experiments, it is found that the transcription factor CaDIV1 participates in the regulation of capsanthin biosynthesis and is highly positively correlated with the synthesis amount of capsanthin. The expression level of CaDIV1 can indicate the capsanthin content of different pepper varieties. The transcription factor CaDIV1 provides a new theoretical basis and foundation for cultivating new pepper varieties with high capsanthin content, and has important application prospects in the field of pepper breeding.

Description

Technical Field

[0001] The present invention belongs to the field of genetics, and specifically relates to transcription factors related to capsanthin biosynthesis and their applications. Background Art

[0002] Capsanthin is the characteristic carotenoid of red pepper fruits, with powerful antioxidant functions. Existing studies have shown that consuming red peppers can significantly reduce the mortality rate. At the same time, capsanthin is also a natural anti-cancer substance and has great potential in aspects such as weight loss, anti-diabetes, photoprotection of the skin, analgesia and anti-inflammation, protection of the heart and liver, and reduction of blood lipids. Therefore, improving the biosynthesis rate of capsanthin has always been a research focus in this field.

[0003] The biosynthesis of capsanthin is as follows: It is catalyzed by capsanthin-capsorubin synthase (CCS) to generate its 5,6-epoxy carotenoid precursor, antheraxanthin, and violaxanthin. Since the CCS gene is highly expressed during the brown and red ripening processes of pepper (C. annuum), the transcriptional level of CCS is the highest in these two stages. The biosynthetic pathway of capsanthin is specifically as Figure 1 shown.

[0004] Numerous studies have shown that in flowers and fruits, the diversity of carotenoid pigments depends to a large extent on the differential expression of carotenoid biosynthesis genes at the transcriptional level. This differential expression usually involves the upregulation or downregulation of multiple structural genes or the entire carotenoid biosynthesis pathway, indicating that transcription factors (TFs) play an important role in carotenoid synthesis.

[0005] Due to the dramatic color changes during tomato fruit ripening (due to the accumulation of lycopene), and the existence of a large number of fruit color mutants, the transcriptional control of carotenoids has been most extensively studied in tomatoes. Several transcription factors (TFs) are involved in the regulation of carotenoid accumulation during tomato fruit ripening, including the MADS-box proteins RIN, TAGL1, and TDR4, the SQUAMOSA promoter-binding protein CNR, the HD-Zip homologous protein Le-HB1, the AP2 / ERF family proteins SlAP2a and SlERF6, and the NAC domain proteins NOR, NOR-like1, and SlNAC4. However, the above-mentioned transcription factors (TFs) all have extensive ripening effects (such as ethylene synthesis, fruit softening, aroma, and flavor production), so they are unlikely to be specific regulators of carotenoid biosynthesis. Some of these transcription factors (TFs) have been confirmed to directly interact with the promoters of ethylene biosynthesis genes, and ethylene induces carotenoid biosynthesis during tomato fruit ripening, indicating that these transcription factors (TFs) may indirectly regulate carotenoid production through the ethylene signal rather than directly acting on the structural genes in the carotenoid synthesis pathway.

[0006] In other species, transcription factors involved in regulating carotenoid biosynthesis have also been successively identified. For example, the transcription factor AtPIF1 of the bHLH family and the transcription factor AtHY5 of the bZIP family in Arabidopsis thaliana. These transcription factors can respond to light signal stimulation and directly bind to the promoter of the key rate-limiting enzyme PSY for carotenoid synthesis, negatively regulating carotenoid synthesis.

[0007] Although transcription factors related to carotenoid biosynthesis in other species have been successively identified, there are few reports on the regulatory mechanism of carotenoid (capsanthin) biosynthesis in peppers. If transcription factors directly involved in regulating capsanthin biosynthesis in peppers can be discovered, it will have important research value and breeding value. Summary of the Invention

[0008] The object of the present invention is to provide an MYB transcription factor related to capsanthin synthesis and its application.

[0009] To achieve the above object of the invention, the technical solution adopted by the present invention is: the CaDIV1 transcription factor, and the amino acid sequence of the CaDIV1 transcription factor is as shown in SEQ NO ID.2.

[0010] Correspondingly, the DNA encoding the CaDIV1 transcription factor.

[0011] Correspondingly, a recombinant vector containing the transcription factor.

[0012] Correspondingly, an expression vector containing the said DNA.

[0013] Correspondingly, a host microorganism containing the said CaDIV1 transcription factor or the said DNA.

[0014] Correspondingly, the application of the said CaDIV1 transcription factor or the said DNA in the synthesis of capsanthin.

[0015] Correspondingly, a method for increasing the synthesis amount of capsanthin, encoding the said DNA into peppers.

[0016] Correspondingly, a method for detecting the content of capsanthin in peppers, detecting the expression amount of the said CaDIV1 transcription factor in peppers.

[0017] The present invention has the following beneficial effects: The present invention provides an MYB transcription factor CaDIV1 highly related to the biosynthesis of capsanthin, and through a series of experiments, it is proved that the transcription factor CaDIV1 participates in regulating the biosynthesis of capsanthin and is highly positively correlated with the synthesis amount of capsanthin. The transcription factor CaDIV1 provides a new theoretical basis and foundation for cultivating new varieties of capsanthin with high content and has important application prospects in the field of pepper breeding. Description of the Drawings

[0018] Figure 1 It is a schematic diagram of the biosynthesis pathway of capsanthin;

[0019] Figure 2 It is a schematic diagram of gel electrophoresis for amplifying CaDIV1;

[0020] Figure 3 It is a schematic diagram of a fluorescence microscope after Agrobacterium tumefaciens GV3101 containing the 35S:CaDIV1-GFP vector infects tobacco;

[0021] Figure 4 It is a schematic diagram of the transcriptional activation ability of CaDIV1 in Nicotiana benthamiana;

[0022] Figure 5 It is a liquid chromatography peak diagram of capsanthin for pTRV1 + pTRV2-CaDIV1 and pTRV1 + pTRV2;

[0023] Figure 6 It is a schematic diagram of the situation where CaDIV1 activates the promoters of PSY, β-CH1, and CCS;

[0024] Figure 7 It is a schematic diagram of the content difference of capsanthin among different materials. Detailed Embodiments

[0025] The present invention provides a MYB transcription factor CaDIV1 related to capsanthin synthesis. The cDNA sequence of CaDIV1 is shown in SEQ NO ID.1, and the amino acid sequence is shown in SEQ NO ID.2. There is a stop codon at the end of the amino acid sequence. The N-terminus of the CaDIV1 protein contains only one MYB conserved domain and is a 1R-MYB (MYB-related) transcription factor, containing the typical SHAQK(Y / F)F sequence and belonging to the DIVARICATA (DIV)-like protein subfamily. The transcriptional level of CaDIV1 is positively correlated with the content of capsanthin, and its transcriptional level in high-capsanthin materials is higher than that in low-capsanthin materials. Higher transcriptional levels are also observed in fruit parts where more capsanthin accumulates.

[0026] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well-known to those skilled in the art. The data obtained are all averages obtained after at least 3 repetitions, and all data obtained from each repetition are valid data.

[0027] Unless otherwise specified, the samples in the embodiments of the present invention are all from the pepper "59" inbred line selected by the College of Horticulture, South China Agricultural University. The pepper is cultivated in a greenhouse with 12 hours of light, 12 hours of darkness, and a temperature of 25°C.

[0028] The method for extracting total RNA from the samples in the embodiments of the present invention is as follows: Cut the samples and grind them into powder, and extract the total RNA of the sample tissue according to the instructions of the Eastep Super total RNA extraction kit (Promega Biotechnology Co., Ltd., Shanghai).

[0029] The method for synthesizing the first-strand cDNA in the embodiments of the present invention is as follows: According to the instructions of the HiSeript Q RT SuperMix for qPCR (tgDNA wiper) reverse transcription kit, reverse transcribe the extracted total RNA to synthesize the first-strand cDNA.

[0030] Example 1: Cloning and sequence analysis of CaDIV1

[0031] Using weighted co-expression network analysis on the transcriptome of the fruits of pepper inbred line "59" at 7 developmental stages, a transcription factor CA12g06700 with unknown function was identified, which was highly co-expressed with CCS (capsanthin synthase gene). Using the cDNA of the red-ripe pepper pulp of pepper inbred line "59" as a template, primers were designed to amplify the full-length cDNA sequence of the transcription factor CA12g06700. Sequence analysis showed that the encoded protein belongs to the DIVARICATA subgroup of the R-R type MYB family, so it was named CaDIV1. The cDNA sequence of CaDIV1 is shown in SEQ NO ID.1, and the amino acid sequence is shown in SEQ NO ID.2.

[0032] The primers for amplifying CaDIV1 were: CaDIV1-F: ATGATGTACACAACGAACAATCGGT; CaDIV1-R: AGAAAGAACGGAAAAGATCGAGC.

[0033] The results of gel electrophoresis detection are as Figure 2 shown. After the PCR products obtained by amplification were recovered by gel, they were ligated to the pMD19-T vector and transformed into Escherichia coli. Subsequently, monoclonal bacteria with positive colony PCR were selected and sent to the company for sequencing. The sequencing results showed that the full-length cDNA sequence of CaDIV1 was 669bp, encoding 222 amino acids.

[0034] Example 2: Analysis of the expression patterns of CaDIV1 and the structural genes of capsanthin biosynthesis in pepper

[0035] The expression patterns of the transcription factor CaDIV1 and the structural genes of capsanthin biosynthesis in different tissue parts and different developmental stages of the pepper pulp of pepper inbred line "59" were analyzed. The results showed that CaDIV1 was mainly expressed in pepper fruits, started to be activated at the mature green (MG; 30 DPA) stage, and increased significantly at the breaker (Br; 33 DAP) stage of the fruit. This result also matches the biosynthesis process of capsanthin: capsanthin mainly accumulates in the pulp and starts to be synthesized in large amounts at the fruit color-changing stage.

[0036] Further analyze the expression patterns of the structural genes PSY, β-LCY1, ZDS, β-CH1, and CCS in the biosynthesis process of capsanthin in different tissue parts of peppers and at different development stages of the pulp. It was found that the expression pattern of CaDIV1 was basically the same as that of these structural genes, with the highest expression level in the pepper pulp and a large amount of expression starting at the breaker stage (Br) of the pepper fruit. Moreover, the expression pattern of CaDIV1 was closer to that of these structural genes, with a large amount of expression starting at the breaker stage, reaching the peak ten days after the breaker stage, and then starting to decline. This proves that CaDIV1 may be involved in regulating the biosynthesis of capsanthin in pepper fruits.

[0037] Example 3: Subcellular localization and transcriptional activation of CaDIV1

[0038] 1. To further explore the function of CaDIV1 and determine its expression site, the full-length CDS sequence of CaDIV1 after removing the stop codon was cloned into the pEAQ-EGFP vector containing the CaMV 35S promoter to construct the 35S:CaDIV1-GFP vector.

[0039] A The constructed vector was transformed into Agrobacterium tumefaciens GV3101. By the method of Agrobacterium-mediated transformation, with the nuclear localization gene DsRed as a reference, the activated Agrobacterium tumefaciens GV3101 containing the nuclear localization reference and the Agrobacterium tumefaciens GV3101 containing the vector of the target gene (35S:CaDIV1-GFP vector) were mixed at a volume ratio of 1:1. Then, the activated Agrobacterium tumefaciens GV3101 containing the nuclear localization reference and the Agrobacterium tumefaciens with the pEAQ-GFP empty vector were mixed at a volume ratio of 1:1 (control). Select tobacco plants with consistent growth, and use a 1 mL disposable syringe to inject the two mixed bacterial solutions into the back of the tobacco leaves respectively. After culturing for 2 days, take the injected tobacco leaves, make slides, and observe under a fluorescence microscope. The results are as Figure 3 shown. The results showed that green fluorescence was only observed in the nucleus of the tobacco leaves injected with the 35S:CaDIV1-GFP vector, while green fluorescence signals were observed in both the nucleus and cytoplasm of the tobacco leaves transformed with the pEAQ-GFP empty vector. The results proved that CaDIV1 was localized in the nucleus and had the characteristics of a general transcription factor.

[0040] To clarify whether CaDIV1 has transcriptional activation ability, the dual luciferase reporter system was used to analyze its transcriptional activation activity in vivo. Tobacco was transformed by the Agrobacterium-mediated method, and a microplate reader was used to detect the experimental results. The results are as Figure 4As shown in the figure. The results showed that CaDIV1 could significantly increase the activity of firefly luciferase, which was 4 times higher than that of the control, demonstrating that CaDIV1 has transcriptional activation ability in plants. In summary, CaDIV1 is a transcription factor located in the nucleus with transcriptional activation ability.

[0041] Example 4: Effect of silencing CaDIV1 gene on the biosynthesis of capsanthin

[0042] In this example, the CaDIV1 gene was silenced by virus-induced gene silencing technology to reduce the expression level of CaDIV1 in peppers. The full-length sequence of the CaDIV1 gene was selected through the online tool vigs.solgenomics.net for a region with low homology, and corresponding primers were designed using CE Design software. The CaDIV1 gene fragment was cloned into the pTRV2 vector to obtain the pTRV2-CaDIV1 vector. Using the pTRV2 empty vector as a control and pTRV1 as an auxiliary, each vector was transformed into Agrobacterium tumefaciens. The pepper seedlings were transformed by the method of Agrobacterium-mediated transformation. The specific method was as follows: The Agrobacterium tumefaciens carrying pTRV1 and the Agrobacterium tumefaciens carrying pTRV2-CaDIV1 were mixed at a volume ratio of 1:1 (pTRV1 + pTRV2-CaDIV1), and the Agrobacterium tumefaciens carrying pTRV1 and the Agrobacterium tumefaciens carrying pTRV2 were mixed at a volume ratio of 1:1 as a control (pTRV1 + pTRV2 empty vector). Each mixed bacterial solution was injected into the back of the leaves of the "59" inbred line pepper plants at the stage when the cotyledons were flattened and the seedlings were growing.

[0043] The treated pepper seedlings were cultured under the same temperature and light conditions (constant temperature and humidity culture at 20°C, dark treatment for 48 h followed by illumination) until the flowering stage. Artificial pollination was carried out on each plant, and the fruit setting stage was recorded.

[0044] The results showed that compared with the control group plants (pTRV1 + pTRV2 empty vector), the pepper fruits of the plants in the pTRV1 + pTRV2-CaDIV1 treatment group would change color 3 - 4 days later. When the fruits of the control group entered the color-breaking stage, the fruits of the pTRV2-CaDIV1 treatment group were still in the green-ripe stage. When the fruits of the control group entered the red-ripe stage, some of the fruits in the pTRV2-CaDIV1 treatment group were still orange-red instead of the bright red color of the red-ripe pepper fruits in the control group, and some were significantly incompletely colored with chlorophyll remaining. Since the patent cannot provide color pictures, no color comparison pictures of each plant are provided in the text.

[0045] Further extract the flesh of pepper fruits at the color-breaking stage from the control group plants and pTRV1 + pTRV2-CaDIV1-silenced plants, extract RNA, and analyze the expression levels of CaDIV1 and the structural genes involved in capsanthin biosynthesis by fluorescence quantitative analysis. The results showed that: compared with the control plants, the expression level of CaDIV1 in pTRV1 + pTRV2-CaDIV1-silenced plants decreased significantly. Further analysis found that the expression levels of the structural genes related to capsanthin biosynthesis in the lines with effective silencing of CaDIV1 also decreased by more than 50% accordingly.

[0046] To further explore the effect of silencing CaDIV1 on capsanthin biosynthesis in pepper fruits, the flesh of red-ripe peppers from the control group and the pTRV1 + pTRV2-CaDIV1 experimental group were taken respectively. After freeze-drying in a freeze dryer, capsanthin was extracted by the method of organic solvent extraction, and the content of capsanthin was determined by high-performance liquid chromatography. By calibration with standard samples, it was determined that the peak time of capsanthin was around 11 minutes. The liquid chromatography peak maps of pTRV1 + pTRV2-CaDIV1 and pTRV1 + pTRV2 are as Figure 5 shown. The results showed that: compared with the control, the peak height corresponding to capsanthin in pTRV1 + pTRV2-CaDIV1 was lower, indicating that its capsanthin content was lower.

[0047] Furthermore, the content of capsanthin was calculated by the calculation formula obtained from the standard curve. Compared with the control group, the content of capsanthin in the flesh of red-ripe peppers from the CaDIV1-silenced lines decreased by about 50%.

[0048] In summary, the expression level of CaDIV1 is closely related to the capsanthin content in pepper fruits. Silencing CaDIV1 will cause the expression of the structural genes involved in capsanthin biosynthesis to decrease accordingly, and then lead to a decrease in the capsanthin content in pepper fruits, affecting fruit coloring, which proves that CaDIV1 is involved in regulating the biosynthesis of capsanthin.

[0049] Example 5: Activation effect of CaDIV1 on genes related to capsanthin biosynthesis

[0050] According to Example 4, after virus-induced silencing of CaDIV1, the expression levels of the structural genes PSY, β-CH1, and CCS involved in capsanthin biosynthesis in peppers all decreased to varying degrees. In this example, the dual-luciferase system was used to analyze the regulation of the above genes by CaDIV1 and its activation activity on the promoters of these genes in vivo.

[0051] First, the promoters of the capsanthin synthetic structural genes PSY, β-CH1, and CCS were respectively constructed onto the pGeenII-0800-Luc vector, and CaDIV1 was constructed onto the pEAQ vector. Then, the constructed vectors were transformed into tobacco plants by the method of Agrobacterium infection. The transformation method was as follows: The reporter gene vectors containing the promoter sequences of the key capsanthin synthetic structural genes and the expression vector containing the CDS sequence of the CaDIV1 transcription factor were mixed and shaken well according to a 1:10 volume ratio of the bacterial solutions. A 1 mL syringe without a needle was used to gently rub the leaves and inject the mixed bacterial solution onto the fully expanded leaves of Nicotiana benthamiana, so that the leaves were all filled with water stains. After injection, it was cultured at 25 °C in the dark for 24 h, and then transferred to the light condition for 3 days. At the same time, the pEAQ empty vector was used to replace the expression vector containing the CDS sequence of the CaDIV1 transcription factor, and the same experiment was carried out under exactly the same conditions as a control.

[0052] After 3 days, according to the instructions of the dual-luciferase system detection kit, the corresponding data were measured on an enzyme-labeling instrument. The results were as Figure 6 shown, indicating that CaDIV1 could significantly activate the promoters of the three genes PSY, β-CH1, and CCS. Compared with the control of the empty vector (pEAQ), its activation ability was increased by 2-4 times. It was proved that CaDIV1 had promoter activation activity in vivo, could activate the transcription of the promoters of the capsanthin biosynthetic structural genes, and thus regulate the biosynthesis of capsanthin.

[0053] Example 6: Indication of the effect of CaDIV1 expression on the capsanthin content

[0054] Twenty varieties (lines) with different capsanthin contents were selected (respectively: 41, 43, 48, 59, CA1, CA2, CA3, CA4, CA5, CA6, Cf1, Cf2, Cf6, 678, 732, LXJ1, YDH, BJ, HL13, HL23). The pepper pulp at the full-ripening stage of each pepper was taken. Part of it was used to extract RNA, reverse-transcribed into cDNA, and stored at -20 °C for subsequent quantitative analysis experiments; the other part was freeze-dried, and capsanthin was extracted by the method of organic solvent extraction, and the capsanthin content was determined by the method of high-performance liquid chromatography. The results were as Figure 7 shown, and there were obvious differences in the capsanthin content among different materials.

[0055] Fluorescent quantitative PCR primers were designed according to the CDS sequence of CaDIV1. The PCR primers were: qDIV1-F: GGGCTGGACAAATACGGGAA; qDIV1-R: TCCACTGCGGTGGTAATGTC. Using the cDNA of each pepper extracted above as a template, a fluorescent quantitative experiment was carried out. The results are shown inFigure 7 : The expression level of CaDIV1 is significantly correlated with the content of capsanthin, confirming that CaDIV1 is involved in the biosynthesis of capsanthin, and the expression of this gene can be used as an indicator of capsanthin.

[0056] The embodiments described above are only for describing the preferred mode of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations, variations, modifications, and substitutions made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. CaDIV1 Application of transcription factor in promoting capsanthin synthesis, characterized in that: The said CaDIV1 The amino acid sequence of the transcription factor is shown in SEQ NO ID.2 2. Application of DNA in promoting the synthesis of capsanthin, characterized in that: The DNA encodes CaDIV1 a transcription factor, and the CaDIV1 amino acid sequence of the transcription factor is as shown in SEQ NO ID.

2.

3. Application of the recombinant vector in promoting capsanthin synthesis, characterized in that: The recombinant vector is a recombinant vector containing CaDIV1 a transcription factor, and the CaDIV1 amino acid sequence of the transcription factor is as shown in SEQ NO ID.

2.

4. Use of an expression vector in promoting the synthesis of capsanthin, characterized in that: The expression vector is an expression vector containing DNA encoding CaDIV1 a transcription factor, and the CaDIV1 amino acid sequence of the transcription factor is as shown in SEQ NO ID.

2.

5. Use of host microorganisms in promoting the synthesis of capsanthin, characterized in that: The host microorganism contains CaDIV1 a transcription factor or DNA encoding CaDIV1 a transcription factor, and the CaDIV1 amino acid sequence of the transcription factor is as shown in SEQ NO ID.2.

Images