Construction method and application of a genetically engineered bacterium for highly efficient synthesis of lipopolysaccharide

Abstract

The present invention discloses a method for constructing a genetically engineered bacterium capable of efficiently synthesizing lipopolysaccharide and its application, belonging to the technical field of genetic engineering. The genetically engineered bacterium of the present invention, E. coli W3110△npr△yhbJ△fabF△P BAD(lpxD ‑fabZ‑lpxA‑lpxB), has undergone deletion mutations of three genes, npr, yhbJ, and fabF, and at the same time, a promoter P has been inserted in front of the chromosomal gene cluster lpxD‑fabZ‑lpxA‑lpxB sequence BAD . The genetically engineered bacterium of the present invention has no resistance markers, has good growth conditions, can be adapted to large-scale production, and the yield of synthesized lipopolysaccharide is 13.0 mg / g DCW, which is 91.2% higher than that of the wild-type E. coli W3110.

Description

Technical Field

[0001] The present invention relates to a method for constructing a genetically engineered bacterium capable of efficiently synthesizing lipopolysaccharide and its application, belonging to the technical field of genetic engineering. Technical Background

[0002] There are various Toll-like receptors (TLRs) in mammalian cells. Specific TLRs recognize specific structural components of bacteria, fungi, and viruses invading the body, such as peptidoglycan, LPS, lipids, sugar chains, peptides, RNA, or DNA. LPS is one of the most active pathogen-associated molecular patterns (PAMPs) known, and picogram levels can trigger an immune response. Lipopolysaccharide-mediated signal transduction is an important part of the body's own defense response. The lipid A of lipopolysaccharide can be recognized by the pathogen recognition receptor TLR4 (Toll-like receptor) on the surface of host cells. After recognition, it can activate intracellular signal cascades, release various pro-inflammatory cytokines such as IL-6, IL-8, TNF-α, and produce co-stimulatory molecules that ultimately activate humoral and cellular responses.

[0003] When vaccines containing bacterial components such as LPS, such as attenuated vaccines and inactivated vaccines, or vaccines inoculated with purified antigens adjuvanted with LPS or its derivatives are administered, the immune strength of the vaccines can be enhanced. This molecule that provides "help" for antigens is defined as a vaccine adjuvant, and immune adjuvants play an important role in the generation and enhancement of immune responses. Lipopolysaccharide is the active component that reflects the virulence of Gram-negative bacteria, and its key structure is lipid A. Different structures of lipid A have different immune functions. Through genetic engineering modification, people can obtain lipopolysaccharides or lipid A structures with different structures to obtain vaccine adjuvants or immunological experimental reagents with different functions, such as MPL, MPLA, and Kdo2-lipidA. However, the yield of Escherichia coli strains that naturally synthesize these lipopolysaccharide molecules is low. Summary of the Invention

[0004] To solve the above problems, the present invention constructs a genetically engineered Escherichia coli bacterium that produces lipopolysaccharide without resistance and has a clear genetic background. By means of gene editing, the lipopolysaccharide synthesis pathway is reasonably enhanced, and the lipopolysaccharide synthesis amount is effectively increased. The genetically engineered bacterium for synthesizing lipopolysaccharide of the present invention has no resistance markers, has good growth conditions, and is suitable for large-scale production.

[0005] To solve the above technical problems, the genetically engineered bacterium provided by the present invention has the npr, yhbJ, and fabF genes deleted and inactivated by mutation, and a promoter P is inserted in front of the gene cluster lpxD-fabZ-lpxA-lpxB sequence BAD .

[0006] The genetically engineered bacterium is E. coli W3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) , which is constructed on the basis of Escherichia coli W3110 and named strain WOZF01.

[0007] In the present invention, the amino acid sequences of the deleted fragments of the npr, yhbJ, and fabF genes are the sequences shown by "BAE77250.1", "BAE77249.1", and "BAA35903.1" on NCBI, respectively.

[0008] In the present invention, the sequence of the promoter P BAD is the sequence shown by SEQ ID NO.37.

[0009] In the present invention, the promoter P BAD is inserted in front of the gene cluster lpxD-fabZ-lpxA-lpxB and directly expressed on the original chromosome.

[0010] In one embodiment, the deletion mutation inactivation is performed by gene knockout.

[0011] In one embodiment, the deletion mutation is performed by using the CRISPR-Cas9 knockout system to knockout genes in Escherichia coli W3110.

[0012] In one embodiment, for the knockout, fragment recombination mediated by the Cas enzyme of the CRISPR-Cas9 knockout system is used, and finally the pCas plasmid is removed by culturing at 42°C to obtain a genetically engineered bacterium that is resistant-free and can effectively synthesize lipopolysaccharide.

[0013] The present invention also provides a method for producing lipopolysaccharide using the genetically engineered bacterium.

[0014] In one embodiment, the method is an arabinose-induced fermentation method.

[0015] In one embodiment, in the method, fermentation is carried out in an LB liquid medium with a final concentration of arabinose added at 22.5 mM.

[0016] In one embodiment, in the method, the fermentation conditions are 37°C and 200 rpm.

[0017] The present invention also provides the application of the genetically engineered bacterium, which is to use the genetically engineered bacterium to produce lipopolysaccharide, and then use the lipopolysaccharide for cellular immunity or to prepare a vaccine containing lipopolysaccharide components.

[0018] The beneficial effects of the present invention:

[0019] The genetically engineered bacterium E. coli W3110△npr△yhbJ△fabF△P of the present invention BAD(lpxD-fabZ-lpxA-lpxB) has undergone deletion mutations of three genes, npr, yhbJ, and fabF, and at the same time, a promoter P has been inserted in front of the chromosomal gene cluster lpxD-fabZ-lpxA-lpxB sequence BAD . The genetically engineered bacterium of the present invention has no resistance markers, has good growth conditions, can be adapted to large-scale production, and the yield of synthesized lipopolysaccharide is 13.0 mg / g DCW, which is 91.2% higher than that of the wild-type E. coli W3110 Description of the Drawings

[0020] Figure 1 : Genetically engineered bacterium E. coli W3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) (WOZF01) SDS-PAGE silver staining analysis of lipopolysaccharide

[0021] Figure 2 : Genetically engineered bacterium E. coli W3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) (WOZF01) Lipopolysaccharide yield analysis

[0022] Figure 3 : Strains E. coli W3110, genetically engineered bacterium E. coli W3110△npr△yhbJ△fabF(WOZF), and E. coli W3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) (WOZF01) Growth curve

[0023] Figure 4 : SDS-PAGE silver staining analysis and quantitative analysis of lipopolysaccharide of the recombinant strain WOZF / pWSK29-DZAB Detailed Embodiments

[0024] 1. Lipopolysaccharide extraction method:

[0025] The LPS of Escherichia coli was extracted by the hot phenol hydrolysis method. After overnight culture of the seeds, they were transferred to 200 mL of LB medium at an initial OD 600 = 0.02 and cultured at 37°C and 200 rpm for 16 h. The cell concentration was measured and recorded. Based on the empirical value OD 600 = 0.323 g DCW·L -1Taking [standard], the dry matter content is specified as 258.4 g, and the volume of the bacterial solution (denoted as V1) is calculated. Transfer bacterial solutions of different volumes but the same dry weight to a large centrifuge bottle, centrifuge at 8000 g for 20 min, and discard the supernatant. Pipette the precipitate with 15 mL of ddH2O and transfer all of it to a clean 50 mL centrifuge tube. Add 15 mL of 90% (v / v) hot phenol, tighten the lid, and place it in a 68 °C water bath shaker to shake at 150 rpm for 1 h. During this period, invert the centrifuge tube up and down every 20 minutes to ensure complete lysis of the bacteria. After the water bath shaking is completed, cool it to room temperature by ventilation, centrifuge at 4000 g and 4 °C for 20 min for phase separation, and then let it stand for 4 - 8 hours. Carefully transfer 5 mL of the upper phase (denoted as V2) to a dialysis bag and dialyze it in deionized water for 24 h, changing the water every 4 h. After dialysis is completed, pour the liquid in the dialysis bag completely into another clean 50 mL centrifuge tube, freeze it at -80 °C for 2 - 3 h. After freezing until it becomes opaque, put it into a vacuum freeze dryer and freeze-dry for 2 days to obtain a white, fluffy, lumpy crude sample of LPS. Purification of the crude sample: Resuspend the crude LPS sample containing impurities in 10 mL of Tris-HCl buffer (formulation: 100 mM pH 7.5 Tris-HCl, 25 mM MgCl2, 1 mM CaCl2). Add Dnase I and RNaseA to remove nucleic acid contamination, and the working concentration of both is 1 μg·mg-1. React in a 37 °C water bath shaker for 2 h. Then add 1 μg·mg-1 proteinase K to remove residual proteins, and also place it in a 37 °C water bath shaker to react for 2 h. At this time, add 5 mL of water-saturated phenol to terminate the reaction and precipitate all proteins (water-saturated phenol needs to be prepared one day in advance. Add 80 mL of deionized water to 300 g of phenol, heat it in a water bath and stir until it dissolves, then transfer it to a 1 L separatory funnel containing 200 mL of deionized water, gently shake and mix to form an emulsion. Let it stand for 6 h to separate layers, and the lower colorless and transparent liquid is water-saturated phenol. Drain the lower layer from the separatory funnel into a brown reagent bottle for storage). Mix well to form a turbid liquid, centrifuge at 4000 rpm for 30 min, take the upper phase, and dialyze for 24 h. Then repeat the freeze-drying operation. The obtained fluffy solid is redissolved in a chloroform:methanol = 2:1 mixture, centrifuged at 12000 rpm for 20 min, pour out the supernatant and repeat the washing once. Freeze-dry again, redissolve in water, and freeze-dry again to obtain pure LPS.

[0026] 2. Detection and Quantification of LPS:

[0027] Polyacrylamide Gel Electrophoresis and Silver Staining: Detection by Polyacrylamide Gel Electrophoresis (SDS-PAGE): Dissolve the freeze-dried crude LPS sample in 1 mL of deionized water. Sonication can be used to promote dissolution until a light yellow homogeneous solution is obtained. Add commercial loading buffer SDS loading buffer to the LPS solution at a volume ratio of 4:1. Heat in a water bath at 100 °C to remove the spatial structure and boil for a total of 10 min to completely denature the LPS. After the water bath, cool slightly to room temperature and perform sample loading, adding 10 μL to the gel wells. When the LPS sample is in the upper 5% stacking gel, set a constant current of 12 mA. When the band runs to the interface of the separating gel, switch the constant current to 25 mA. Stop electrophoresis when the blue band runs to about 1 cm from the bottom. Silver Staining: First, prepare the fixing solution: 30% ethanol, 10% glacial acetic acid; oxidation solution: 30% ethanol, 10% glacial acetic acid, 0.7% periodic acid; silver ammonia solution: 28 mL of 0.1 mol·L-1 NaOH, 1 g of AgNO3, 125 mL of deionized water, 2 mL of ammonia water, which needs to be prepared freshly before use; developing solution: 0.05 g·L-1 citric acid, 0.02% formaldehyde. Silver staining steps: (1) Rinse. Briefly wash away the impurities on the gel surface with deionized water; (2) Fix. Fix with the fixing solution for 20 min to increase the staining sensitivity of LPS; (3) Oxidize. Oxidize with the oxidation solution for 20 min; (4) Rinse. Gently shake and wash with deionized water for 20 min and repeat three times. The rinsing time can be appropriately extended; (5) Silver stain. Treat the gel with the freshly prepared silver ammonia solution for 10 min. Sometimes, if the sample concentration is too high, the oxidation time can be reduced; (6) Wash with double-distilled water by shaking for 20 min and repeat three times; (7) Treat with the developing solution until the LPS band appears on the gel. Quickly and carefully pour out the developing solution to prevent overreaction and too dark bands.

[0028] 3. LPS Quantification:

[0029] (1) Standard curve determination: Weigh a certain amount of purified LPS on an analytical balance, vortex and sonicate to dissolve it, and prepare gradient standard solutions with concentrations of 2 - 20 mg·mL-1. Take 50 μL of samples with different concentration gradients of this solution, in triplicate, and place them in clean 1.5 mL centrifuge tubes on ice. Freshly prepared 6% cysteine hydrochloride solution, protected from light, is also placed on ice. Set up a blank sample by adding 50 μL of deionized water. The volume ratio of sulfuric acid to water in the concentrated sulfuric acid used in the experiment is 6:1. Since a large amount of heat will be released, it needs to be prepared in advance and cooled, and then placed in an ice box as well. Add 450 μL of concentrated sulfuric acid to the centrifuge tube containing 50 μL of LPS solution; then add 5 μL of cysteine hydrochloride solution to the centrifuge tube, shake vigorously, and then put it back on ice; after 3 minutes, place the sample in boiling water and boil for 20 minutes; after 1 hour, transfer 100 μL of the reaction mixture to a 96-well plate, and use an enzyme-linked immunosorbent assay (ELISA) reader to measure the absorbance at wavelengths of 505 and 545 nm, and calculate the difference to obtain the required value; make a standard curve based on the LPS concentration (X) and this difference (Y).

[0030] For various mutant strains whose production needs to be determined, dilute the crude LPS sample obtained by quantitative extraction with deionized water to 1 mL, and detect the concentration of the LPS solution. The operation is the same as that for standard curve determination above.

[0031] (2) LPS quantification of each mutant strain

[0032] For various mutant strains whose production needs to be determined, dilute the crude LPS sample obtained by quantitative extraction with deionized water to 1 mL, and detect the concentration of the LPS solution. The operation is the same as that for standard curve determination above.

[0033] Example 1: Construction of mutant strain E. coli W3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) Construction

[0034] In this example, first construct a triple-gene deletion strain E. coli W3110△npr△yhbJ△fabF (named WOZF), and then add an arabinose-inducible promoter P BAD (the sequence is shown in SEQ ID NO. 37) in front of the gene cluster lpxD - fabZ - lpxA - lpxB on the chromosome to obtain the mutant strain E. coli W3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) (named WOZF01).

[0035] Among them, the amino acid sequences of the gene knockout fragments of npr, yhbJ, and fabF genes are the sequences shown in "BAE77250.1", "BAE77249.1", and "BAA35903.1" on NCBI respectively. All primers used are listed in Table 1.

[0036] 1. Construction of mutant strain E. coli W3110△npr△yhbJ△fabF (named WOZF)

[0037] (1) Construction of knockout plasmid and knockout fragment

[0038] Using the CRISPR-Cas9 knockout system, the genomic fragment was obtained by PCR with the W3110 genome as the template, the fragment from the plasmid was obtained by PCR with the corresponding plasmid as the template and adding the corresponding primers, and using 2×pfx polymerase. After the recovery and purification of the fragment, and confirming that the band was correct by nucleic acid gel electrophoresis, the gel extraction kit was used to obtain it.

[0039] First, the npr gene was knocked out in W3110, and then the yhbJ and fabF genes were successively knocked out in series. Taking the construction of W31105Δnpr as an example, the gene knockout operation in the present invention was briefly described. The website CHOPCHOP (uib.no) was used to predict the NGG sequence that could be recognized by pTargetF-npr, and this sequence should be in the middle position of the npr gene sequence. The sequence of 20bp before NGG in the npr sequence was introduced at the 5' end of the primer, and the primer pair sg-npr-F / sg-npr-R was designed. Using pTargetF as the template, the linear plasmid pTargetF-npr was obtained by PCR. It was introduced into JM109 chemically competent cells, spread on the spectinomycin selection culture plate, cultured overnight, and transformants were selected. Using N20-npr-F / N20-R as primers, single colonies were picked as templates for colony PCR verification. The correctly selected transformants were inoculated into the liquid medium containing spectinomycin, and the plasmid pTargetF-npr was extracted. Using the W3110 genome as the template, the upstream fragment was amplified with the primer pair npr-U-F / npr-U-R, and the downstream fragment was amplified with npr-D-F / npr-D-R. Through the reverse complementary fragments on the primers, the upstream and downstream fragments were overlapped by fusion PCR to obtain the knockout fragment npr-UD.

[0040] Construction of W3110ΔnprΔyhbJ: The plasmid pTargetF-yhbJ was constructed using the primer pair sg-yhbJ-F / sg-yhbJ-R, and the plasmid was verified with N20-yhbJ-F / N20-R. The upstream fragment for knockout was amplified with yhbJ-U-F / yhbJ-U-R, and the downstream fragment was amplified with yhbJ-D-F / yhbJ-D-R. When overlapping the upstream and downstream, the primer yhbJ-U-F / yhbJ-D-R was selected to obtain the knockout fragment yhbJ-UD.

[0041] Construction of W3110ΔnprΔyhbJΔfabZ: The pTargetF-fabF plasmid was constructed using the primer pair sg-fabF-F / sg-fabF-R, and the plasmid was verified with N20-fabF-F / N20-R. The upstream fragment for knockout was amplified using fabF-U-F / fabF-U-R, and the downstream fragment was amplified using fabF-D-F / fabF-D-R. When overlapping the upstream and downstream fragments, the primers fabF-U-F / fabF-D-R were selected to obtain the knockout fragment fabF-UD.

[0042] (2) Construction of knockout transformants by homologous recombination

[0043] Taking the knockout of npr as an example, 200 ng of the knockout plasmid and 300 ng of the knockout fragment were co-electroporated into the electrocompetent W3110 / pCas9 cells, and cultured on a double antibiotic plate of spectinomycin and kanamycin at 30 °C for 20 h. The transformants were verified using the primer pair npr-U-F / npr-D-R, with W3110 as the negative control. The correctly knocked-out transformants were obtained, and kanamycin and IPTG were added, and cultured overnight at 30 °C to induce the removal of the knockout plasmid pTargetF-npr. The procedures for the single knockout or tandem knockout of the other two genes were the same.

[0044] (3) Obtaining antibiotic-free knockout mutants by removing resistance

[0045] Finally, the pCas9 resistance was removed. The pCas9 was removed by subculturing for two generations at 42 °C. Taking the npr knockout strain as an example for resistance removal, the verification primer pair was npr-U-F / npr-D-R. Finally, the successfully knocked-out W3110Δnpr without other plasmids was obtained. The procedures for the single knockout or tandem knockout of the other two genes were the same. And PCR verification of the corresponding gene knockout was carried out. Finally, the genetically engineered strains E. coli W3110△npr, E. coli W3110△yhbJ, E. coli W3110△fabF, and E. coliW3110△npr△yhbJ△fabF (named WOZF) were obtained.

[0046] 2. Construction of the mutant E. coli W3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) (named WOZF01)

[0047] (1) Construction of the knockout fragment and pTargetF-P BAD plasmid

[0048] Using the CRISPR-Cas9 knockout system, genomic fragments were obtained with the W3110 genome as a template, and fragments from plasmids were based on the corresponding plasmids as templates. After adding the corresponding primers, they were obtained by PCR using 2×pfx polymerase. For the recovery and purification of the fragments, after confirming the correct bands by nucleic acid gel electrophoresis, they were obtained using a gel extraction kit.

[0049] The website CHOPCHOP (uib.no) was used to predict the NGG sequences recognizable by pTargetF-P BAD The recognized NGG sequences used the primer pair sg-P BAD -F / sg-P BAD -R to construct the pTargetF-P BAD plasmid, and the N20-P BAD -F / N20-R was used to verify the plasmid. The upstream fragment for knock-in was amplified using the primer pair bamA-U-F / bamA-U-R with the W3110 genome as a template; the middle fragment was amplified using the primer pair P BAD -M-F / P BAD -M-R with the plasmid pBAD33 as a template; the downstream fragment was amplified using the primer pair yhbJ-D-F / yhbJ-D-R with the W3110 genome as a template. When overlapping the upstream, middle, and downstream fragments, the primer pair bamA-U-F / skp-D-R was used, and the equimolar mixture of the upstream, middle, and downstream fragments was used as a template to obtain the knockout fragment P BAD -UMD.

[0050] (2) Promoter P BAD Obtaining the knock-in strain

[0051] Kanamycin and IPTG were added to remove pTargetF-P BAD , and the verification primer pair was N20-P BAD -F / N20-R. After obtaining the correct transformants, they were transferred twice at 42°C to remove pCas9. The transformants without resistance were those with successful removal of pCas9. Finally, the W3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) without other plasmids and with successful knock-in was obtained. And T-P BAD -F

[0052] / T-P BAD -R was used for PCR verification of the corresponding gene knock-in. Finally, the genetically engineered bacterium E.coliW3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) (named WOZF01) was obtained.

[0053] Example 2: Semi-quantitative analysis of lipopolysaccharide in mutant strains

[0054] Polyacrylamide gel electrophoresis and silver staining were used to compare the band sizes, intensities, and thicknesses of LPS from the wild-type E. coli W3110, the genetically engineered strains WOZF01 and WOZF, and analyze the relative contents. As Figure 1 shown, the results of SDS-PAGE silver staining indicated that the LPS sizes of the mutant strain WOZF01 were consistent with those of W3110 and WOZF. The LPS band of WOZF was darker and thicker than that of W3110, and the LPS band of WOZF01 was darker and thicker than that of WOZF, indicating an increase in content.

[0055] Example 3: Analysis of LPS Content in Each Mutant Strain

[0056] Strain Cultivation Method: Activate E. coli W3110 and its mutant strains WOZF and WOZF01 on a plate, pick single colonies and transfer them into test tubes. After overnight cultivation, transfer them to a 500 mL Erlenmeyer flask containing 200 mL of LB medium at an initial OD 600 = 0.02. Add an arabinose inducer with a final concentration of 22.5 mM to the LB liquid medium inoculated with WOZF01. Each strain was cultured at 37 °C and 200 rpm for 16 h, the cell concentration was measured and recorded, and the fermentation was completed. Among them, the LB medium contained 50 g / L yeast extract, 100 g / L peptone, and 100 g / L NaCl.

[0057] Quantify the LPS of the mutant strains. As Figure 2 shown, the LPS quantification results showed that the LPS of the mutant strain WOZF01 increased by 91.2% and 36.0% compared to the wild-type E. coli W3110 and WOZF, respectively, and the yield was 13.0 mg / g.

[0058] Example 4: Comparison of Strain Growth States

[0059] Activate the three strains of E. coli W3110, WOZF, and WOZF01 on an LB solid plate, and pick five single colonies and transfer them to 5 mL of LB liquid medium respectively. After culturing in a test tube for 6 h until the OD 600 is approximately 2.5, transfer them according to the initial OD 600 = 0.02 to a 250 mL Erlenmeyer flask containing 50 mL of LB liquid medium, and culture at 37 °C for 24 h. Take the bacterial liquid at different time points and measure the OD of the bacterial liquid. Repeat three times and take the average value. As Figure 3 shown, the results showed that the mutant strain WOZF01 had no resistance marker, no pollution hazard, and its growth status was not affected too much.

[0060] Control Example 5

[0061] In this control example, based on the genetically engineered bacterium WOZF, the gene cluster lpxD-fabZ-lpxA-lpxB was overexpressed using the plasmid pWSK29, which is different from Example 1 where an inducible promoter was added before the gene cluster lpxD-fabZ-lpxA-lpxB for direct expression on the original chromosome.

[0062] The primer sequences used are listed in Table 1.

[0063] 1. Construction of the recombinant strain WOZF / pWSK29-lpxD-fabZ-lpxA-lpxB (named WOZF / pWSK29-DZAB)

[0064] Here, a one-step cloning kit was used to construct the plasmid pWSK29-DZAB. Using the primer pair DZAB-F / DZAB-R and the W3110 genomic DNA as a template, the gene cluster sequence of lpxD-fabZ-lpxA-lpxB was amplified. The plasmid pWSK29 was linearized with a restriction endonuclease at the corresponding restriction sites. At the same time, the gene fragment to be inserted was obtained by PCR amplification and gel recovery purification, and then the two were ligated using a one-step cloning kit. Through chemical transformation and colony PCR verification with the primer pair T-DZAB-F / DZAB-R, the correct transformant was obtained.

[0065] Among them, 2 μL of restriction endonuclease was required, 10 μL of 10×Q.Cut Buffer was required, 2000 ng of pWSK29 plasmid, and the system was made up to 100 μL with sterilized ddH2O to prepare the enzyme digestion reaction system, and incubated in a 37°C constant temperature water bath for 30 min. After enzyme digestion, the digested fragment was recovered using the PCR product SanPrep column purification kit. The ClonExpress one-step cloning kit was used to ligate the linearized plasmid after enzyme digestion and the DNA fragment obtained from the PCR amplification reaction and gel recovery.

[0066] The system of the ClonExpressTM II recombination reaction is as follows: 4 μL of 5×CE II Buffer, 2 μL of ExnaseTM II, the optimal amount of cloning vector used, the optimal amount of insert fragment used, and the system was made up to 100 μL with sterilized ddH2O. Among them, the optimal amount of cloning vector used = (0.02 × the base pair number of the cloning vector) ng; the optimal amount of insert fragment used = (0.04 × the base pair number of the insert fragment) ng.

[0067] The correct recombinant plasmid pWSK29-lpxD-fabZ-lpxA-lpxB was transferred into the mutant strain WOZF, and the recombinant strain WOZF / pWSK29-lpxD-fabZ-lpxA-lpxB was obtained and named WOZF / pWSK29-DZAB.

[0068] 2. Semi - quantitative and quantitative analysis of lipopolysaccharide in recombinant strain WOZF / pWSK29 - DZAB

[0069] Refer to Example 2 and Example 3.

[0070] Figure 4 The quantitative results show that the amount of LPS synthesized by the recombinant strain WOZF / pWSK29 - DZAB constructed by overexpressing the gene cluster lpxD - fabZ - lpxA - lpxB using plasmid pWSK29 is lower than that of WOZF. Therefore, using the promoter insertion method on the genome in Example 1 and inducing with the addition of arabinose to enhance the expression of the gene cluster lpxD - fabZ - lpxA - lpxB to construct the genetically engineered bacterium WOZF01 is a key step of the present invention.

[0071] Table 1 Primer sequences used in the present invention

[0072]

[0073]

[0074] P BAD The promoter sequence is as follows:

[0075] GATGCGTCCGGCGTAGAGGATCTGCTCATGTTTGACAGCTTATCATCGATGCATAATGTG

[0076] CCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCA

[0077] ATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCAC

[0078] AACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAA

[0079] TAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGT

[0080] GCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAA

[0081] TCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTG

[0082] TGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAG

[0083] CCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCC

[0084] GCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTT

[0085] GCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCC

[0086] GGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTA

[0087] GGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGA

[0088] CCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAA

[0089] TTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACC

[0090] TTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGT

[0091] TAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCG

[0092] CTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCAT

[0093] CAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCC

[0094] GCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACA

[0095] AAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTT

[0096] GCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCA

[0097] ACTCTCTACTGTTTCTCCATACCCG

[0098] Although the present invention is disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A genetically engineered bacterium, characterized in that, Using Escherichia coli W3110 as the starting strain, the npr, yhbJ, and fabF of the genetically engineered bacterium are deleted and inactivated by mutation, and a promoter P is inserted in front of the gene cluster lpxD-fabZ-lpxA-lpxB sequence BAD ; the sequences of the npr, yhbJ, and fabF are shown as "BAE77250.1", "BAE77249.1", and "BAA35903.1" on NCBI respectively; the promoter P BAD has the sequence shown in SEQ ID NO.

37.

2. The genetically engineered bacterium according to claim 1, characterized in that, The genetically engineered bacterium is constructed on the basis of Escherichia coli W3110 and is E. coli W3110△npr△yhbJ△fabF△P BAD(lpxD-fabZ-lpxA-lpxB) .

3. The genetically engineered bacterium according to claim 1, wherein The construction of the genetically engineered bacterium is carried out in Escherichia coli E. coli W3110△npr△yhbJ△fabF in which npr, yhbJ and fabF are deleted and inactivated by the CRISPR-Cas9 knockout system, and the promoter P is BAD knocked in, so that before the chromosomal gene cluster lpxD-fabZ-lpxA-lpxB of E. coli W3110△npr△yhbJ△fabF, a promoter P whose transcriptional intensity increases with the increase of the arabinose addition amount is inserted BAD .

4. The genetically engineered bacterium according to claim 3, characterized in that, The knockout is Cas enzyme-mediated fragment recombination using the CRISPR-Cas9 knockout system. Finally, the pCas plasmid is removed by culturing at 42°C to obtain a genetically engineered bacterium that can effectively synthesize lipopolysaccharide without resistance.

5. A method for producing lipopolysaccharide using the genetically engineered bacterium according to any one of claims 1 to 4.

6. The method according to claim 5, characterized in that It is a method of inducing fermentation by adding arabinose.

7. The method according to claim 6, wherein In the method, fermentation is carried out in an LB liquid medium with a final concentration of arabinose added at 22.5 mM.

8. The application of the genetically engineered bacterium according to any one of claims 1 to 4 is to produce lipopolysaccharide using the genetically engineered bacterium, and then use the lipopolysaccharide for cellular immunity or prepare a vaccine containing lipopolysaccharide components.

Images