A method for regulating expression of a target gene by using a lipid transport protein gene promoter, a transformation vector and application thereof

By utilizing the AaLTP1 promoter, which is specifically expressed in secretory glandular trichomes in Artemisia annua, the problem of constitutive promoters harming plant growth has been solved, enabling specific expression and metabolic regulation of artemisinin in production and promoting genetic engineering breeding.

CN115820725BActive Publication Date: 2026-06-02SHANGHAI JIAOTONG UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI JIAOTONG UNIV
Filing Date
2022-11-09
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

In existing technologies, constitutive promoters cause harm to plant growth and development during artemisinin production, failing to achieve effective regulation of genes in specific tissues and organs, thus affecting normal plant growth.

Method used

By using the AaLTP1 promoter, a lipid transporter gene specifically expressed in the secretory glandular trichomes of Artemisia annua, a transformation vector was constructed to specifically express the gene in the secretory glandular trichomes of plants, thus avoiding harm to plant growth.

Benefits of technology

This study enabled the specific expression of the gene in the secretory glandular trichomes of Artemisia annua, avoiding the burden on plant growth, promoting the metabolic engineering of artemisinin, and providing a new method for genetic engineering breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115820725B_ABST
    Figure CN115820725B_ABST
Patent Text Reader

Abstract

The present application relates to a method for regulating expression of a target gene in plant secretory trichomes by using a lipid transfer protein gene promoter, a vector used in the method and its application in genetic engineering breeding of plant trichome tissue for expression and production of metabolites. The promoter is the promoter of AaLTP1 gene, which can regulate specific expression of a target gene in plant secretory trichomes. The present application also relates to the use of the aforementioned gene promoter in genetic engineering breeding of plant trichome tissue for expression and production of metabolites. Since the promoter for specific expression in plant trichomes does not harm the growth and development of plants when the trichome system of plants is genetically manipulated, the present application is of great significance in genetic engineering breeding of plant trichome tissue for expression and production of metabolites.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a method, transformation vector and application of regulating the expression of a target gene using a lipid transporter gene promoter. Background Technology

[0002] Artemisia annua L. is an annual herbaceous plant belonging to the genus Artemisia in the family Asteraceae. The plant has a strong volatile aroma and contains many secondary metabolites, including artemisinin, volatile oils, α-pinene, camphor, and artemisininone, as well as numerous flavonoids. Artemisinin is a sesquiterpene lactone compound containing a peroxy-bridged structure isolated from its aerial parts. It is the main active ingredient in artemisinin-based combination therapies (ACTs) recommended by the World Health Organization (WHO). Currently, the primary source of artemisinin is extraction from the aerial parts of Artemisia annua; however, the content of artemisinin in Artemisia annua is very low (0.01%-1%), which greatly limits the large-scale commercial production of this drug.

[0003] Artemisia annua leaves have two types of epidermal trichomes: secretory glandular trichomes (GSTs) and non-secretory trichomes (TSTs). Both types of trichomes play crucial roles in plant growth, development, defense, and pollen dispersal. A promoter is a specific nucleotide sequence located upstream of the 5' end of a gene, acting like a "switch" to exert its specific function through the interaction of cis-acting elements and trans-acting factors. There are three types of promoters: constitutive promoters, specific promoters, and inducible promoters. Current genetic engineering research on Artemisia annua primarily uses constitutive promoters, such as the cauliflower mosaic virus 35S promoter (CaMV35S). This type of promoter can drive the expression of exogenous genes in all tissues and organs, but cannot regulate the expression of target genes in specific tissues and organs. It can excessively consume intracellular substances and energy, potentially causing a burden and harm to the plant, and affecting its normal growth. Therefore, there is an urgent need to find promoters specifically expressed in plant tissues and organs to replace constitutive promoters and better regulate plant genes. Since promoters specifically expressed in glandular trichomes can genetically manipulate the plant's glandular trichome system without harming plant growth and development, they can overcome the various drawbacks of constitutive promoters. Plant lipid transporter genes (LTPs) have multiple physiological functions, including plant signal transduction, cuticle and wax metabolism and synthesis, cell wall elongation, pollen development, somatic embryogenesis, seed germination, and responses to biotic and abiotic stresses. Therefore, cloning the AaLTP1 gene promoter, which is specifically expressed in plant glandular trichome tissue, is of great significance for artemisinin metabolic engineering.

[0004] Therefore, those skilled in the art are dedicated to developing a promoter that will not harm plant growth. Summary of the Invention

[0005] To overcome the shortcomings of existing plant genetic engineering techniques and to facilitate in-depth research on the initiation and development of secretory glandular trichomes and the metabolic regulation of their secondary metabolites, this invention provides a promoter specifically expressed in plant secretory glandular trichomes. This promoter guides the specific expression of genes in the secretory glandular trichomes of transgenic plants without harming plant growth and development.

[0006] To achieve the above objectives, the present invention provides a method for regulating the expression of a target gene in plant secretory glandular trichomes using a lipid transporter gene promoter, characterized in that the lipid transporter gene is the AaLTP1 gene specifically expressed in plant glandular trichome tissue, and the promoter of the gene is the nucleotide sequence shown in SEQ ID NO.1.

[0007] In a preferred embodiment of the present invention, the method includes the following steps:

[0008] Step 1: Cultivate sterile Artemisia annua seedlings;

[0009] Step 2: The AaLTP1 promoter was obtained by PCR cloning using the sterile Artemisia annua seedlings cultured in Step 1.

[0010] Step 3: Analyze the cis-acting elements on the AaLTP1 promoter to determine the AaLTP1 gene promoter type;

[0011] Step 4: The promoter cloned in Step 2 is ligated into the pCAMBIA1391z vector and fused with the reporter gene to construct a transformation vector;

[0012] Step 5: Transform the transformation vector constructed in Step 4 into Agrobacterium tumefaciens and then detect its activity.

[0013] Step six: Stable transformation of Artemisia annua with Agrobacterium tumefaciens carrying the transformation vector obtained in step five;

[0014] Step 7: PCR detection of the transgenic Artemisia annua plants obtained in Step 6;

[0015] Step 8: Determining the expression site of the GUS reporter gene guided by the promoter in the plant.

[0016] In another preferred embodiment of the present invention, step two specifically includes:

[0017] Genomic DNA was extracted from the leaves of the sterile Artemisia annua seedlings obtained in step one, and amplified using the genomic DNA as a template via a two-round nested PCR method. The primer sequences used in the two rounds of nested PCR included:

[0018] PF1: ACGTTAGCTCTTTTGCTAAGGACCAT

[0019] PR1: TACTGGTTAGGTAGGTCACACACG

[0020] PF2:CTTACACGTTTCTTACTTTAATTTTATA

[0021] PR2: ACCATTTCTCCACTTGCTATTACT.

[0022] In another preferred embodiment of the present invention, in step four, the transformation vector is the pCAMBIA1391z-proLTP1 vector. To construct the transformation vector, a BamHI restriction site is introduced into the forward primer and an NcoI restriction site is introduced into the reverse primer.

[0023] In another preferred embodiment of the present invention, the primer sequence in step four is as follows:

[0024] 1391z-proLTP1-F:

[0025] CAGGTCGACGGATCCCTTACACGTTCTTACTTTAATTTTATA;

[0026] 1391z-proLTP1-R:

[0027] TCAGATCTACCATGGTTCTCCACTTGCTATTACTTTAATT. In another preferred embodiment of the present invention, the Agrobacterium tumefaciens used in step five is EHA105.

[0028] In another preferred embodiment of the present invention, step six specifically includes: pre-culturing explants using Artemisia annua seeds to obtain sterile seedling leaf explants; co-culturing the leaf explants with Agrobacterium tumefaciens carrying a transformation vector; transferring the co-cultured Artemisia annua explants onto a germination screening medium; and after 2-3 subculturing cycles, performing screening culture to obtain screened Artemisia annua plants.

[0029] In another preferred embodiment of the present invention, step seven specifically includes:

[0030] Based on the promoter of the expression cassette containing the target gene and the GUS gene, design the forward primer proLTP1:CTTACACGTTCTTACTTTAATTTTATA and the reverse primer GUSR, respectively:

[0031] ATCCAGACTGAATGCCCACA is used to detect the GUS gene.

[0032] A vector used in the above-mentioned method of regulating the expression of a target gene in plant secretory glandular trichomes using a lipid transporter gene promoter is a pCAMBIA1391z-proLTP1 vector containing a promoter of the AaLTP1 gene specifically expressed in plant glandular trichomes and a GUS reporter gene.

[0033] The above-mentioned method of regulating the expression of target genes in plant secretory glandular trichomes using lipid transporter gene promoters is applied in genetic engineering breeding for the expression of metabolites in plant glandular trichome tissues.

[0034] Technical effect

[0035] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention utilizes an effective Artemisia annua secretory trichome tissue-specific promoter to replace the constitutive promoter, which can be used to construct a fusion gene that specifically expresses the target gene in Artemisia annua secretory trichome tissue in molecular biology. This gene can be transferred into the genome of other plants using genetic transformation technology, thereby achieving targeted manipulation of the target gene to obtain transgenic plants without harming the growth and development of the plants. It can be widely used in genetic engineering breeding that utilizes plant trichome tissue to express and produce metabolites.

[0036] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0037] Figure 1 This is an electrophoresis image of a transgenic Artemisia annua plant according to a preferred embodiment of the present invention, showing a positive PCR detection result.

[0038] Figure 2 This is a GUS tissue staining image of Artemisia annua after stable transformation using the AaLTP1 gene promoter, which is a preferred embodiment of the present invention. Detailed Implementation

[0039] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0040] Experimental methods not specifically described in the following examples are generally performed under standard conditions, such as those described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0041] The *Agrobacterium tumefaciens* EHA105 involved in this embodiment has been disclosed in the literature "Huang Yali, Jiang Xiliang, Tian Yunlong, Guo Ping, Zhu Changxiong; Study on genetic transformation of *Trichoderma harzianum* mediated by *Agrobacterium tumefaciens*, China Biotechnology Journal, 2008, 28(3): 38-43". *Agrobacterium tumefaciens* EHA105, plasmid pCAMBIA1391z, can be obtained through commercially available channels, such as from CAMBIA Company in Australia, strain number Gambar1.

[0042] Example

[0043] This embodiment relates to obtaining the AaLTP1 gene promoter, specifically including the following steps:

[0044] Step 1: Cultivating Artemisia annua aseptic seedlings

[0045] Artemisia annua seeds were soaked in 75% ethanol for 1 minute, then soaked in 20% (w / v) NaClO for 20 minutes, rinsed 3 to 4 times with sterile water, dried with sterile absorbent paper, and inoculated onto MS solid medium without any hormones. They were cultured at 25°C under 16h / 8h (light / dark) light conditions. Sterile seedlings of Artemisia annua could be obtained after 14 days.

[0046] Step 2: Cloning of promoter sequences in genomic DNA

[0047] Extraction of genomic DNA

[0048] Add two small steel balls to a 1.5 mL centrifuge tube, and place a 1 cm artemisia leaf inside. 2 (Approximately sized, use an ice pack). Add 300 μL of TPS buffer (operate in a fume hood; TPS contains 2% mercaptoethanol), shake at 55-60 Hz for 90 seconds. Add another 300 μL of TPS buffer (in a fume hood). Incubate at 65°C for 1 hour (shaking every 20 minutes), the time can be extended as needed, up to a maximum of 1.5 hours. Cool to room temperature, centrifuge at 12000 rpm for 15 minutes at 4°C. Take 300-400 μL of the supernatant. Add an equal volume of 300-400 μL of isopropanol (pre-cooled at -20°C). After mixing, place in a -20°C freezer for 10-15 minutes (can be extended to 1 hour). Remove and centrifuge at 12000 rpm for 10 minutes at 4°C, aspirate the supernatant, and invert in a fume hood for 10-15 minutes. Add 500-600 μL of 75% ethanol, agitate the precipitate by blowing or flicking it with your finger, and shake on a shaker for 15-20 minutes. Repeat once. Blot off the liquid and dry at 37°C until the precipitate becomes clear. Redissolve in 50 μL of ddH₂O and store at 4°C.

[0049] PCR amplification

[0050] Using genomic DNA as a template, the specific promoter sequence of secretory glandular trichomes was amplified by PCR. To improve product specificity, two rounds of nested PCR were employed. Nested PCR primers were designed based on the promoter sequence of the AaLTP1 gene obtained from our laboratory's genome sequencing, as shown in Table 1. The first-round PCR reaction system is shown in Table 2. The PCR conditions were: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 50℃ annealing for 30 s; 72℃ extension for 2 min, 35 cycles; and 72℃ extension for 10 min. The PCR products were detected by electrophoresis on a 1% agarose gel.

[0051] Table 1. Primer Design for Nested PCR

[0052]

[0053] Table 2 First-round PCR reaction system

[0054]

[0055] The product from the first round of PCR was diluted 100-fold and used as a template for the second round of PCR. The reaction system for the second round of PCR is shown in Table 3. The PCR conditions were: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 2 min, 35 cycles; 72℃ extension for 10 min. The PCR product was detected by electrophoresis on a 1% agarose gel, the target fragment was excised and recovered, and the DNA was purified. Then, it was ligated into the pLB vector (purchased from TianGen) for sequencing. The sequence of this fragment was spliced ​​with the gene sequence to obtain a fragment approximately 2000 bp upstream of the AaLTP1 gene.

[0056] Table 3 Second round PCR reaction system

[0057]

[0058] Step 3: Analyze the cis-regulatory elements of the obtained AaLTP1 gene promoter to determine the type of AaLTP1 gene promoter.

[0059] In this embodiment, the AaLTP1 gene promoter sequence was 1967 bp in length. To identify cis-regulatory elements on the promoter, the AaLTP1 gene promoter was analyzed using Plantcare (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ). Analysis revealed that the multiple cloned promoter possessed numerous cis-regulatory elements in addition to the TATAbox and CAATbox: ABRE, ARE, G-box, AuxRR-core, CGTCA-motif, GT1-motif, P-box, TCA-element, TCT-motif, TGA-element, and TGACG-motif. The G-box, found in many plant promoters, is an essential element for the function of many stress-responsive promoters, playing a crucial role in plant responses to light, anaerobic environments, and plant hormones. Furthermore, GT1-motif and TCT-motif are both photoregulated, CGTCA-motif and TGACG-motif respond to methyl jasmonate in plants, and the P-box responds to gibberellin. The cis-regulatory elements of the AaLTP1 gene promoter are shown in Table 4. These results indicate that the AaLTP1 gene promoter is an inducible promoter.

[0060] Table 4 Cis-regulatory elements and their functions in the AaLTP1 gene promoter

[0061]

[0062] Step 4: The obtained promoter is ligated into the pCAMBIA1391z vector and fused with the GUS reporter gene.

[0063] To investigate the expression of gene promoters in different plant tissues, the AaLTP1 gene promoter proLTP1 was linked to the pCAMBIA1391z vector and fused with the GUS reporter gene. To construct the expression vector, a BamHI restriction site was introduced into the forward primer and an NcoI restriction site was introduced into the reverse primer. The primer sequences are shown in Table 5.

[0064] Table 5. Primers for constructing the pCAMBIA1391z-proLTP1 vector PCR

[0065]

[0066] Step 5: Transform the constructed pCAMBIA1391z-proLTP1 vector into Agrobacterium tumefaciens and detect its activity.

[0067] The constructed plant binary expression vector was transformed into Agrobacterium tumefaciens (EHA105), and PCR verification was performed. The results showed that the plant binary expression vector containing the gene promoter fragment was successfully constructed into the Agrobacterium tumefaciens strain, thus obtaining the Agrobacterium tumefaciens strain containing the gene promoter and GUS gene fusion plant expression vector pCAMBIA1391z-proLTP1.

[0068] Step 6: Transform Artemisia annua with Agrobacterium tumefaciens carrying the pCAMBIA1391z-proLTP1 vector.

[0069] 1) Pre-culture of explants

[0070] Artemisia annua seeds were soaked in 75% ethanol for 1 minute, then in 20% (w / v) NaClO for 20 minutes; rinsed 3-4 times with sterile water; and dried with sterile absorbent paper. They were then inoculated onto hormone-free MS medium, which was a commercially available solid medium invented by Murashige and Skoog in 1962. Sterile seedlings were obtained by incubation at 25°C for 16 hours of sunlight and 8 hours of darkness. Once the seedlings reached approximately 5 cm in length, explants from the leaves of the sterile seedlings were harvested for transformation.

[0071] 2) Co-culture of Agrobacterium and explants

[0072] The leaf explants were transferred to a co-culture medium consisting of 1 / 2 MS and 100 μmol / L AS. A 1 / 2 MS suspension of Agrobacterium tumefaciens engineered bacteria containing the activated plant binary expression vector with the AaLTP1 promoter was added dropwise to ensure full contact between the explants and the bacterial suspension. The cultures were then incubated in the dark at 28°C for 3 days. Leaf explants added to a 1 / 2 MS liquid culture medium suspension of Agrobacterium tumefaciens without the target gene served as a control.

[0073] 3) Screening of resistant regenerated plants

[0074] The Artemisia annua explants co-cultured for 3 days were transferred to a germination selection medium composed of MS, 0.5 mg / L 6-BA, 0.05 mg / L NAA, 50 mg / L Kan, and 500 mg / L Cb. The medium was cultured at 25°C for 16 hours in light and 8 hours in darkness. Subculture was performed every two weeks. After 2-3 subcultures, Kan-resistant shoot clusters were obtained. The well-grown resistant shoot clusters were cut off and transferred to a rooting medium composed of 1 / 2 MSO and 125 mg / L Cb until rooting, thus obtaining Kan-resistant regenerated Artemisia annua plants.

[0075] Step 7: PCR detection of transgenic plants

[0076] Based on the promoter and GUS sequences of the expression cassette containing the target gene, forward primers (proLTP1: CTTACACGTTCTTACTTTAATTTTATA) and reverse primers (GUSR: ATCCAGACTGAATGCCCACA) were designed to detect the GUS gene. The results showed that the designed PCR-specific primers amplified the specific DNA fragment, while no fragment was amplified when using untransformed Artemisia annua genomic DNA as a template. Figure 1 As shown;

[0077] Step 8: Determining the expression site of the promoter-guided GUS reporter gene in the plant.

[0078] For Artemisia annua plants that tested positive by PCR, leaves were taken for GUS tissue staining, and the results were as follows: Figure 2 As shown, the results indicate that the stained sites are specifically distributed in the secretory glandular trichomes of Artemisia annua, suggesting that the AaLTP1 gene promoter can guide the specific expression of the exogenous gene in the glandular trichomes in transgenic Artemisia annua. Therefore, the AaLTP1 gene promoter cloned in this invention can be used in genetic engineering breeding and industrialization for the expression and production of metabolites using plant glandular trichome tissue.

[0079] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A method for regulating specific expression of a target gene in the secretory glandular hair tissue of Artemisia annua by using the promoter of the lipid transfer protein gene AaLTP1, characterized in that, The nucleotide sequence of the promoter AaLTP1 is shown in SEQ ID NO.1; The method includes the following steps: Step 1: Cultivate sterile Artemisia annua seedlings; Step 2: Using the sterile Artemisia annua seedlings cultured in Step 1, the AaLTP1 promoter was obtained by PCR cloning. Genomic DNA was extracted from the leaves of the sterile Artemisia annua seedlings obtained in Step 1, and amplified using a two-round nested PCR method with the genomic DNA as a template. The product of the first round of PCR was diluted and used as a template for the second round of PCR. The primer sequences used in the two rounds of nested PCR included: PF1: ACGTTAGCTCTTTTGCTAAGGACCAT PR1: TACTGGTTAGGTAGGTCACACACG PF2:CTTACACGTTTCTTACTTTAATTTTATA PR2: ACCATTTCTCCACTTGCTATTACT; Step 3: Analyze the cis-acting elements on the AaLTP1 promoter to determine the AaLTP1 gene promoter type; Step 4: The promoter cloned in Step 2 is ligated into the pCAMBIA1391z vector and fused with the reporter gene to construct a transformation vector; Step 5: Transform the transformation vector constructed in Step 4 into Agrobacterium tumefaciens and then detect its activity. Step six: Stable transformation of Artemisia annua with Agrobacterium tumefaciens carrying the transformation vector obtained in step five; Step 7: PCR detection of the transgenic Artemisia annua plants obtained in Step 6; Step 8: Determining the expression site of the GUS reporter gene guided by the promoter in the plant.

2. The method as described in claim 1, characterized in that, In step four, the transformation vector is the pCAMBIA1391z-proLTP1 vector. To construct the transformation vector, a BamHI restriction site is introduced into the forward primer and an NcoI restriction site is introduced into the reverse primer.

3. The method as described in claim 2, characterized in that, In step four, the primer sequences are as follows: 1391z-proLTP1-F: CAGGTCGACGGATCCCTTACACGTTCTTACTTTAATTTTATA; 1391z-proLTP1-R:TCAGATCTACCATGGTTCTCCACTTGCTATTACTTTAATT.

4. The method as described in claim 1, characterized in that, The Agrobacterium tumefaciens used in step five is EHA105.

5. The method as described in claim 1, characterized in that, Step six specifically includes: using Artemisia annua seeds to pre-culture explants to obtain sterile seedling leaf explants; co-culturing the leaf explants with Agrobacterium tumefaciens carrying a transformation vector; transferring the co-cultured Artemisia annua explants to a germination screening medium; and after 2-3 subcultures, performing screening culture to obtain screened Artemisia annua plants.

6. The method as described in claim 1, characterized in that, Step seven specifically includes: Based on the promoter of the expression cassette containing the target gene and the GUS gene sequence, design the forward primer proLTP1:CTTACACGTTCTTACTTTAATTTTATA and the reverse primer GUSR, respectively: ATCCAGACTGAATGCCCACA is used to detect the GUS gene.

7. The method described in any one of claims 1-6, which utilizes the lipid transporter gene promoter AaLTP1 to regulate the specific expression of the target gene in the secretory glandular trichome tissue of Artemisia annua, is applied to the expression and production of metabolites in the glandular trichome tissue of Artemisia annua.