Recombinant adeno-associated viral vectors for treating mucopolysaccharidosis type ii and uses thereof

By using a recombinant AAV vector carrying an IDS gene expression construct, AAV9 can be used to cross the blood-brain barrier and regulate the immune response to IDS by combining with promoters and immune-related microRNAs, achieving highly efficient treatment of MPSII and significantly reducing the therapeutic effect of acetylsulfamethoxazole.

CN115820740BActive Publication Date: 2026-05-12BEIJING GENECRADLE PHARM CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
BEIJING GENECRADLE PHARM CO LTD
Filing Date
2021-09-16
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing MPSII treatments, such as enzyme replacement therapy and hematopoietic stem cell transplantation, suffer from low bioavailability, high immune response, high cost, and unstable success rate. They are difficult to effectively reduce systemic GAG accumulation, especially in the brain and peripheral tissues, and gene therapy carries the risk of immune response.

Method used

Using a recombinant AAV vector carrying an IDS gene expression construct, efficient expression of IDS protein was achieved through intraventricular injection. AAV9 was used to cross the blood-brain barrier, and by combining the CAR-Mut promoter and the MicroRNA 142-3p sequence, the immune response was reduced, achieving widespread and long-term stable expression throughout the body.

Benefits of technology

It can efficiently and persistently express functional IDS proteins in vivo, significantly reduce the accumulation of heparan sulfate and dermatan sulfate, improve lesions in the brain and peripheral tissues, reduce immune response, and achieve a lasting therapeutic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a recombinant adeno-associated virus vector carrying an IDS gene expression frame and application thereof in treating mucopolysaccharidosis type II.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a recombinant adeno-associated virus vector carrying the IDS gene expression cassette and its application in the treatment of mucopolysaccharidosis type II. Background Technology

[0002] Mucopolysaccharidosis (MPS) is a group of single-gene inherited metabolic diseases caused by the deficiency or reduced activity of acidic hydrolases related to lysosomes, which prevents the degradation or incomplete degradation of acidic mucopolysaccharides (also known as glycosaminoglycans, GAGs), leading to the accumulation of GAGs and their intermediate metabolites in the body and causing severe disability or death.

[0003] Based on the deficiencies of lysosomal enzymes and the different types of stored mucopolysaccharides, MPS can currently be divided into seven major types, including: MPS type I (containing three subtypes: IH, IS, and IH / S), MPS type II (containing two subtypes: IIA and IIB), MPS type III (containing four subtypes: IIIA, IIIB, IIIC, and IIID), MPS type IV (containing two subtypes: IVA and IVB), MPS type VI (containing two subtypes: VIA and VIB), MPS type VII, and MPS type IX. In China, MPS types I, II, IV, and VI are the most common.

[0004] Mucopolysaccharidosis type II (MPSII), also known as Hunter syndrome, is the only X-linked recessive genetic disorder among mucopolysaccharidosis disorders. It is a rare genetic disease with an incidence rate of approximately 0.38–1.09 per 100,000. The incidence rate is generally lower in European countries than in East Asian countries. In East Asian countries, MPSII accounts for about 50% of all mucopolysaccharidosis (MPS) cases. Patients lack iduronate 2-sulfatase (I2S) in their lysosomes, leading to the pathological accumulation of two glycosaminoglycans (GAGs), dermatan sulfate (DS) and heparan sulfate (HS), and dysfunction of most organ systems, including the brain.

[0005] MPS II patients are affected to varying degrees in most organ systems, exhibiting significant heterogeneity. Based on clinical presentation, MPS II is classified into mild and severe forms, with the severe form accounting for approximately two-thirds. Common clinical signs and symptoms include changes in urinary glycosaminoglycans (uGAGs), facial roughness, skeletal deformities and joint stiffness, short stature due to growth retardation, respiratory and cardiac damage including diffuse valvular heart disease, inguinal and umbilical hernias, and hepatosplenomegaly. Patients may also present with otolaryngological manifestations including hearing loss, adenoid tonsillar hypertrophy, frequent ear and upper respiratory tract infections, sleep disturbances, obstructive sleep apnea, and retinal deterioration. Severe cases involve neurological disorders, primarily cognitive impairment and severe behavioral problems. Patients are typically normal at birth, with signs usually appearing between 2 and 4 years of age. Signs in severe cases usually appear earlier, while mild cases progress slowly, have little or no cognitive problems, and do not exhibit behavioral disturbances. Of the major clinical changes, cardiopulmonary failure is often the cause of death, with severe forms occurring before adulthood, while mild forms can result in survival into late adulthood.

[0006] Etiologically, MPSII is caused by mutations in the IDS gene. These mutations lead to decreased or absent lysosomal I2S enzyme activity, resulting in the accumulation of HS and DS within the lysosome, causing cell and organ damage and leading to progressive cellular and multiple organ dysfunction. The IDS gene, located at Xq28, has a full-length CDS of 1653 bp. This gene encodes a 550-amino acid polypeptide, which is processed to form iduronate 2-sulphatase (I2S) protein. The mature form is a monomer, 76 kDa in size, composed of two subdomains (a 42 kDa heavy chain and a 14 kDa light chain). In lysosomes, it catalyzes the hydrolysis of the C2-sulfate bond of the 2-O-sulfo-α-L-iduronate residue in dermatan sulfate (DS) and heparan sulfate (HS). IDS is a housekeeping gene, widely expressed in all organs of the body, with a relatively high overall expression level in the central nervous system.

[0007] Treatment of MPS II has historically been palliative, focusing on addressing signs and symptoms. Since the discovery of the biochemical and genetic basis of the disease in the 1970s and 1990s, respectively, numerous studies have been conducted using various strategies to develop specific therapies for the disease. These efforts led to hematopoietic stem cell transplantation (HSCT) in the 1980s and enzyme replacement therapy (ERT) in 2006 entering clinical practice. Although these treatment strategies (primarily ERT) are now used as options for MPS treatment, many questions remain regarding their efficacy and safety.

[0008] ERT therapy for MPS II currently uses two different recombinant enzymes: Elaprase, approved by the US Food and Drug Administration in 2006; and idurosulfatase beta, approved by the Korean Food and Drug Administration in 2012. Both enzymes exhibit similar biochemical and physicochemical properties, and preclinical studies have shown similar distribution and efficacy in reducing organ GAG levels. However, idurosulfatase beta exhibits higher specificity, allowing for faster cellular uptake and reducing the formation of anti-drug antibodies. The limited efficacy of ERT in certain tissues can be attributed to low bioavailability of the therapeutic enzymes due to low vascularization in tissues such as bone, cartilage, and heart valves, and biological barriers (e.g., the blood-brain barrier) present for treatment of the central nervous system. Immune responses can reduce treatment effectiveness. More than 50% of patients develop anti-IDS IgG antibodies, with 21% to 35% developing neutralizing IgG antibodies. ERT treatment is expensive. For example, Elaprase requires weekly dosing and costs over $300,000 annually.

[0009] HSCT can improve the physical and skeletal symptoms of the disease, with similar effects on height and weight as ERT. One study evaluating the long-term effects of HSCT showed improvements in urinary GAG levels, valvular regurgitation, brain atrophy on MRI, Class I and II brain injury, and activities of daily living (ADL). However, these improvements were only observed in patients treated before the onset of brain atrophy and valvular regurgitation. With a single-dose administration, HSCT will significantly help reduce the cost of weekly ERT treatment. HSCT costs between $70,000 and $205,000, but the time and cost of finding a donor are high. Furthermore, the success rate of the procedure is affected by donor cell type, and complications including infection, organ failure, transplant rejection, and GVHD result in a relatively high mortality rate for HSCT.

[0010] Due to its stability, long-term expression, and low immunogenicity, AAV has become the most commonly used viral tool in MPS gene therapy. Monica Cardone (Correction of Hunter syndrome in the MPSII mouse model by AAV2 / 8-mediated gene delivery. Human Molecular Genetics, 2006, Vol. 15, No. 71225–1236) first used AAV-based gene therapy in MPSII, intravenously injecting the AAV2 / 8 vector into adult MPSII mice. After treatment, the mice's enzyme activity was completely restored, GAG stores in plasma, spleen, lungs, heart, kidneys, brain, and muscles were completely cleared, and skeletal deformities were normalized. However, the mice performed poorly in field tests, exhibiting severely impaired gait and neuropathological defects. Sandra Motas et al. (CNS-directed gene therapy for the treatment of neurologic and somatic mucopolysaccharidosis type II (Hunter syndrome), JCI Insight. 2016; 1(9):e86696. doi:10.1172 / jci.insight.86696.) used an AAV9 viral vector carrying the IDS gene to inject into the cerebrospinal fluid of MPSII mice, resulting in a significant increase in IDS activity throughout the cerebrospinal fluid and reversal of the pathology of the central nervous system after 4 months of treatment. A subsequent study by Laoharawee et al. (Prevention of Neurocognitive Deficiency in Mucopolysaccharidosis Type II Mice By CNS-Directed, AAV9-Mediated IduronateSulfatase Gene Transfer, Human Gene Therapy, DOI:10.1089 / hum.2016.184) obtained similar results, using intraventricular injection and comparing intrathecal and intravenous administration methods. High levels of IDS (160 times higher than wild-type) were observed in most peripheral organs 28 weeks after injection and up to 270 times higher than wild-type at 10 months after injection, but only low levels (7% to 40% of wild-type) of IDS were observed in all areas of the brain.

[0011] Given the limitations and high costs of current treatments for MPSII, there is still a need in the field for alternative therapies for the prevention and / or treatment of MPSII, especially alternative gene therapies. These gene therapies preferably express functional IDS proteins efficiently and preferably for a long period of time in vivo, and the expressed functional IDS can effectively spread throughout the patient's body, effectively improving lesions in the brain and peripheral tissues, while exhibiting low drug resistance and immune reactivity in the patient. Summary of the Invention

[0012] This invention provides a novel gene therapy drug for MPSII based on an AAV vector. The drug comprises an AAV vector carrying an expression construct of the human iduronate-2-sulfatase (IDS) gene. In the gene expression construct, a promoter designed by the applicant is used to regulate the efficient expression of the IDS gene. After intraventricular injection (ICV), the drug of this invention can efficiently express the IDS protein in vivo, significantly increasing the intracellular IDS protein content, participating in the hydrolysis of excess mucopolysaccharides in lysosomes, and substantially reducing the content of heparan sulfate in cells to reach and maintain normal levels, thereby achieving the therapeutic effect on MPSII.

[0013] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0014] On one hand, the present invention provides a gene therapy method and pharmaceutical composition for treating MPS II disease, characterized in that the method and pharmaceutical composition are based on a recombinant AAV vector, which can efficiently deliver drug effector elements into the body to achieve efficient expression of the therapeutic product protein IDS. In one embodiment, in order to achieve efficient expression of IDS protein, the serotype of recombinant AAV is selected according to the transduction characteristics of different serotypes of AAV. Preferably, in one embodiment, AAV9, which can cross the blood-brain barrier, is selected as the vector.

[0015] In some embodiments, the gene therapy method and pharmaceutical composition for treating MPS II disease provided by the present invention are characterized by achieving efficient expression of IDS protein in various tissues of the subject (including, but not limited to, brain and peripheral tissues, such as heart, liver, spleen, lung, kidney, muscle, and intestine) based on a designed IDS gene expression construct.

[0016] In some further embodiments, the gene therapy method and pharmaceutical composition for treating MPS II disease of the present invention are characterized in that the IDS gene expression construct carried by the recombinant AAV viral vector comprises the CAR-Mut promoter of SEQ ID NO:1 or a promoter having at least 90% identity with it. The CAR-Mut promoter is used to regulate IDS gene transcription, enabling the IDS gene to be efficiently transcribed in a variety of cells and to achieve widespread systemic expression in the subject.

[0017] In some further preferred embodiments, the expression construct comprises a natural human IDS gene sequence, and preferably also comprises a Kozak sequence 5'-GCCACC-3' added before the translation start codon of the IDS gene sequence.

[0018] In some other preferred embodiments, the MPSⅡ disease gene therapy method and pharmaceutical composition provided by the present invention are characterized in that, in the expression construct, a microRNA 142-3p sequence is added to the 3' end of the IDS gene to reduce its expression in antigen-presenting cells, thereby reducing the immune response caused by in vivo drug injection.

[0019] In some preferred embodiments, the MPSⅡ disease gene therapy method and pharmaceutical composition provided by the present invention are characterized by intraventricular injection (ICV) of the pharmaceutical composition. As shown in the embodiments of this application, after injecting the pharmaceutical composition containing the recombinant AAV viral vector of the present invention into IDS gene-deficient model mice via ICV, IDS protein can be expressed efficiently, continuously, and stably in the mice. The expressed IDS protein participates in the hydrolysis of heparan sulfate and dermatan sulfate in cells, reducing their accumulation in cells and maintaining them at normal levels. This eliminates various disease symptoms caused by excessive accumulation of heparan sulfate and dermatan sulfate in cells, achieving the therapeutic purpose.

[0020] In some further preferred embodiments, the MPSⅡ disease gene therapy method and pharmaceutical composition provided by the present invention are characterized in that a single administration can enable subject cells to efficiently express IDS protein for a long period of time, participate in the hydrolysis of excessive heparan sulfate and dermatan sulfate, and maintain GAG at a normal level in cells, thereby achieving a long-term therapeutic effect. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0022] Figure 1Schematic diagram of the pRDAAV-CMV-EGFP vector structure. Constructed by our institute based on the AAV vector pAAV2neo (Zhou Q, et al. 2017, “Deletion of the B-B' and C-C' regions of inverted terminal repeats reduces rAAV productivity but increases transgene expression.” Scientific reports vol.7, 15432.14 Jul. 2017). ITR, inverted terminal repeat, flanking inverted terminal repeat sequences. CMV promoter, early promoter of human cytomegalovirus. EGFP, enhanced green fluorescent reporter gene. bGH polyA, polynucleotide tailing signal of bovine growth hormone. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame. This vector contains multiple restriction enzyme sites.

[0023] Figure 2 Schematic diagram of the pRDAAV-CAR-Mut-EGFP vector structure. ITR, inverted terminal repeat, flanking inverted terminal repeat sequences. CAR-Mut promoter, artificially designed promoter. EGFP, enhanced green fluorescent reporter gene. bGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

[0024] Figure 3 Schematic diagram of the pRDAAV-CAR-Mut-IDS vector structure. ITR, inverted terminal repeat, flanking inverted terminal repeat sequences. CAR-Mut promoter, artificially designed promoter. IDS, human iduronate 2-sulfatase gene. bGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

[0025] Figure 4Schematic diagram of the pRDAAV-CAR-Mut-IDS-142-3P vector structure. ITR, inverted terminal repeat. CAR-Mut promoter, artificially designed promoter. IDS, human iduronate 2-sulfatase gene. 142-3P, microRNA 142-3P sequence. bGH polyA, bovine growth hormone polynucleotide tailing signal. Amp, ampicillin resistance gene reading frame. Neo, neomycin resistance gene reading frame.

[0026] Figure 5 Results of IDS protease activity assay after transfection of HEK-293 cells with pRDAAV-CAR-Mut-IDS and pRDAAV-CAR-Mut-IDS-142-3P plasmids. Blank cells, untransfected HEK-293 cells. HEK-293 cells transfected with pRDAAV-CAR-Mut-IDS or pRDAAV-CAR-Mut-IDS-142-3P plasmids, respectively.

[0027] Figure 6 Results of tissue IDS enzyme activity assay after tail vein injection of rAAV9-CAR-Mut-IDS and rAAV9-CAR-Mut-IDS-142-3P into adult wild-type mice. High, rAAV9 high dose 5×10 13 Wild-type mice administered GC / kg; low, rAAV9 low dose 1×10 13 Wild-type mice treated with GC / kg; wild-type mice injected with PBS (wt).

[0028] Figure 7 Results of IDS enzyme activity assay in tissues of newborn mice after intraventricular injection of rAAV9-CAR-Mut-IDS and rAAV9-CAR-Mut-IDS-142-3P. Mouse models injected with rAAV9-CAR-Mut-IDS or rAAV9-CAR-Mut-IDS-142-3P, respectively; MPS model mice; PBS-injected model mice; wt; wild-type mice injected with PBS.

[0029] Figure 8Pathological examination results of the quadriceps femoris muscle after intraventricular injection of rAAV9-CAR-Mut-IDS and rAAV9-CAR-Mut-IDS-142-3P into newborn mice. A is a wild-type mouse injected with PBS, B is an IDS homozygous model mouse injected with PBS, C is an IDS model mouse injected with rAAV9-CAR-Mut-IDS, and D is a model mouse injected with rAAV9-CAR-Mut-IDS-142-3P.

[0030] Figure 9 Results of tissue GAG ​​content detection in newborn mice after intraventricular injection of rAAV9-CAR-Mut-IDS and rAAV9-CAR-Mut-IDS-142-3P. Wt: Wild-type mice injected with PBS. MPS model mice: IDS homozygous model mice injected with PBS. rAAV9-CAR-Mut-IDS: IDS model mice injected with rAAV9-CAR-Mut-IDS. rAAV9-CAR-Mut-IDS-142-3P: Model mice injected with rAAV9-CAR-Mut-IDS-142-3P.

[0031] Figure 10 The results of tissue IDS enzyme activity detection in newborn mice after intraventricular injection of rAAV9-CAR-Mut-IDS-142-3P, rAAV9-CB7-hIDS, and rAAV9-CAG-hIDS. Wt: Wild-type mice injected with PBS. MPS model mice: IDS homozygous model mice injected with PBS. rAAV9-CAR-Mut-IDS-142-3P: Model mice injected with rAAV9-CAR-Mut-IDS-142-3P. rAAV9-CB7-IDS: Model mice injected with rAAV9-CB7-hIDS. rAAV9-CAG-IDS: Model mice injected with rAAV9-CAG-hIDS.

[0032] Figure 11 Anti-IDS antibody titers were measured in serum samples collected from newborn mice after intraventricular injection of rAAV9-CAR-Mut-IDS-142-3P, rAAV9-CB7-hIDS, and rAAV9-CAG-hIDS. Wt: Wild-type mice injected with PBS. MPS model mice: IDS homozygous model mice injected with PBS. rAAV9-CAR-Mut-IDS-142-3P: Model mice injected with rAAV9-CAR-Mut-IDS-142-3P. rAAV9-CB7-IDS: Model mice injected with rAAV9-CB7-hIDS. rAAV9-CAG-IDS: Model mice injected with rAAV9-CAG-hIDS. Invention Details

[0033] This invention discloses gene therapy constructs, pharmaceutical compositions, and methods for the prevention and / or treatment of subjects with mucopolysaccharidosis type II (MPSII), particularly the construction, preparation, and application of recombinant AAV vectors for delivering IDS.

[0034] Unless otherwise defined below, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. Furthermore, the materials, methods, and examples described herein are illustrative only and are not intended to be limiting. Other features, objects, and advantages of the invention will become apparent from this specification and the accompanying drawings, and from the appended claims.

[0035] definition

[0036] The term "about" when used in conjunction with a numeric value means to cover a range of numeric values ​​having a lower limit of 5% less than the specified numeric value and an upper limit of 5% greater than the specified numeric value. The term is also intended to cover values ​​within ±1%, ±0.5%, or ±0.1% of the specified numeric value.

[0037] In this document, the terms “comprising” or “including” mean that the stated elements, integers or steps are included, but do not exclude any other elements, integers or steps.

[0038] In this document, the terms “first,” “second,” or “third,” etc., are used to distinguish between the elements mentioned herein, and unless otherwise stated, these terms do not indicate a requirement that the elements have a specific quantity or be present in any particular order or position.

[0039] In this document, the expression “and / or” is used to refer to any one of the listed related items, or any and all possible combinations of multiple listed related items.

[0040] The terms “iduronate 2-sulphatase” or “I2S” or “IDS” are used interchangeably in this document to refer to a lysosomal enzyme that causes the degradation of glycosaminoglycans (GAGs), dermatan sulfate (DS), and heparan sulfate (HS) in lysosomes.

[0041] Examples of IDS include, but are not limited to, enzyme proteins having the amino acid sequence of a full-length wild-type (natural) human IDS (as shown in UniProtKB-P22304 in the Unipro database), their mature forms, their variants (e.g., variants with conserved amino acid substitutions), and fragments thereof. In the full-length amino acid sequence of the human IDS under accession number P22304, amino acid residues aa1-25 are the signal peptide sequence, amino acid residues 26-33 are the propeptide sequence, and amino acid residues 34-550 are the mature peptide (including a 42 kDa heavy chain and a 14 kDa light chain). In this document, the full-length amino acid sequence of IDS can be used, as well as its variants and fragments, provided that the variants or fragments retain the activity of hydrolyzing GAG, especially dermatan sulfate (DS) and / or heparan sulfate (HS), and, for example, provide at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, or approximately the same, or greater than 100% of the enzyme activity level of full-length wild-type (natural) human IDS. The function (activity) of hIDS can be measured in a suitable in vitro assay, for example, using the 4MU-iduronase assay, to measure the ability of the target hIDS enzyme protein to cleave the fluorescent substrate 4-methylumbelliferone aL-iduronate-2-sulfate. See, for example... www.RnDSysems.com The activity assay protocol described above; or the activity assay protocol described in Laoharawee et al. (Prevention of Neurocognitive Deficiency in Mucopolysaccharidosis Type II Mice By CNS-Directed, AAV9-Mediated Iduronate Sulfatase Gene Transfer, Human Gene Therapy, DOI:10.1089 / hum.2016.184).

[0042] In one embodiment of the invention, the IDS polypeptide comprises the amino acid sequence of SEQ ID NO:10, or the amino acid sequence of residues 1-550 of SEQ ID NO:10; the amino acid sequence of residues 26-550 of SEQ ID NO:10, the amino acid sequence of residues 34-550 of SEQ ID NO:10, or an amino acid sequence having at least 90%, or at least 95%, 96%, 97%, 98%, 99%, or higher identity with any of the aforementioned sequences. The first 25 amino acids of the human IDS polypeptide are typical signal peptides of lysosomal and secretory proteins. IDS can target lysosomes through this signal peptide. Therefore, in one embodiment, the IDS polypeptide of the present invention comprises a signal peptide that targets lysosomes, such as a natural signal peptide sequence derived from a human IDS polypeptide. In another embodiment, the IDS polypeptide of the present invention comprises a signal peptide derived from a heterologous lysosomal targeting protein.

[0043] In some embodiments of the invention, the polynucleotide sequence encoding the IDS polypeptide comprises the wild-type IDS nucleic acid sequence. In yet another embodiment of the invention, the polynucleotide sequence encoding the IDS polypeptide may be codon-optimized as needed to, for example, enhance the expression and / or stability of the polynucleotide in vivo. Preferably, the polynucleotide sequence encoding IDS comprises the polynucleotide sequence of SEQ ID NO:2.

[0044] The term "ETR" or "enzyme replacement therapy" herein refers to a treatment procedure for MPSII, wherein a recombinant iduronate-2-sulfatase active protein is administered to a subject in need. In one embodiment, the recombinant iduronate-2-sulfatase active protein is Elaprase or iduronate sulfatase beta.

[0045] As used herein, the term "conservative" amino acid or nucleotide change refers to a neutral or near-neutral amino acid or nucleotide change that results in the protein or nucleic acid molecule containing the said amino acid or nucleotide change substantially retaining its original function. For example, a conserved amino acid substitution is the replacement or substitution of an amino acid with a different amino acid whose side chain has similar biochemical properties (e.g., charge, hydrophobicity, and size). Variations of such conserved modifications are additional to, and not exclusive to, polymorphic variants, interspecies homologs, and alleles. The following eight groups contain conserved amino acids: 1) alanine (A), glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) cysteine ​​(C), methionine (M) (see, for example, Creighton, Proteins (1984)). Those skilled in the art can readily detect the conservation of amino acid or nucleotide changes in a specific polypeptide or nucleotide sequence using conventional techniques, such as functional assays.

[0046] The term "functional connectivity," also known as "effective connectivity," refers to a relationship in which the specified components are in a way that allows them to function in the intended manner.

[0047] The term "sequence identity" is used to describe the sequence structural similarity between two amino acid sequences or polynucleotide sequences. To determine the percentage of identity between two amino acid sequences or two nucleic acid sequences, the sequences can be aligned for optimal comparison purposes (e.g., vacancies can be introduced in one or both of the first and second amino acid sequences or nucleic acid sequences for optimal alignment, or non-homologous sequences can be discarded for comparison purposes). In a preferred embodiment, for comparison purposes, the length of the reference sequence being aligned is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, 100% of the reference sequence length. The amino acid residues or nucleotides at the corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, the molecules are identical at that position.

[0048] Mathematical algorithms can be used to compare sequences and calculate the percentage of identity between two sequences. In a preferred embodiment, the Needlema and Wunsch ((1970) J. Mol. Biol. 48: 444-453) algorithm (available at http: / / www.gcg.com) is used in the GAP program integrated into the GCG software package, employing a Blossum 62 matrix or a PAM250 matrix and vacancy weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6, to determine the percentage of identity between two amino acid sequences. In yet another preferred embodiment, the GAP program in the GCG software package (available at http: / / www.gcg.com) is used, employing an NWSgapdna.CMP matrix and vacancy weights of 40, 50, 60, 70, or 80, and length weights of 1, 2, 3, 4, 5, or 6, to determine the percentage of identity between two nucleotide sequences. The particularly preferred set of parameters (and unless otherwise specified, a set of parameters to be used) is a Blossum 62 scoring matrix with a vacancy penalty of 12, a vacancy extension penalty of 4, and a shift vacancy penalty of 5.

[0049] Alternatively, the PAM120 weighted remainder table, gap length penalty of 12, and gap penalty of 4 can be used to determine the percentage of identity between two amino acid sequences or nucleotide sequences using the E. Meyers and W. Miller algorithm ((1989) CABIOS, 4:11-17) which has been incorporated into the ALIGN program (version 2.0).

[0050] The term "host cell" refers to a cell into which exogenous polynucleotides have been introduced, including progeny cells of this type. In some embodiments, the host cell can be any type of cell system that can be used to produce the recombinant AAV vector of the present invention, such as mammalian cells (e.g., HEK 293 cells suitable for producing recombinant AAV via a three-plasmid packaging system) and insect cells (e.g., sf9 cells suitable for producing recombinant AAV via a baculovirus packaging system).

[0051] The term "regulatory sequence" or "expression control sequence" refers to a nucleic acid sequence that induces, inhibits, or otherwise controls the transcription of a protein encoding a nucleic acid sequence that is effectively linked to it. Regulatory sequences can be, for example, initiation sequences, enhancer sequences, intron sequences, and promoter sequences.

[0052] The terms “exogenous” and “heterogeneous” used to describe nucleic acids or proteins are used interchangeably and refer to nucleic acids or proteins that are not naturally present at the location of their presence on the chromosome or in the host cell. Exogenous nucleic acid sequences also refer to sequences derived from and inserted into the same host cell or subject but existing in a non-natural state; for example, the sequences may exist at different copy numbers or be under the control of different regulatory elements.

[0053] In this document, "isolated" polynucleotides (e.g., isolated DNA or isolated RNA) refer to polynucleotides that are at least partially isolated from at least some other components of the natural organism or virus containing them. In some embodiments, the "isolated" nucleic acids are enriched at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more relative to the starting material.

[0054] In this document, "isolated" polypeptide means a polypeptide that is at least partially isolated from at least some other components of the natural organism or virus containing it. In some embodiments, the "isolated" polypeptide is enriched at least about 10, 100, 1000, 10,000 or more relative to the starting material.

[0055] In this document, “isolation” or “purification” of a viral vector means that the viral vector is partially separated from at least some components of the starting material containing it. In some embodiments, the “isolated” viral vector is enriched at least about 10, 100, 1000, 10,000 or more relative to the starting material.

[0056] In this document, the term "viral vector" refers to a viral particle (e.g., an AAV viral particle) capable of serving as a delivery vehicle for a target nucleic acid. Typically, a viral vector comprises a capsid and a viral genome (e.g., viral DNA) packaged therein, with the target nucleic acid to be delivered inserted into the viral genome. In the case of recombinant AAV viral vectors, to generate recombinant viral particles capable of delivering the target nucleic acid to tissues or cells, typically only the inverted terminal repeat (ITR) cis-form element needs to be retained in the genome, while the remaining sequences required for viral packaging can be provided in trans form. Therefore, in some embodiments, the recombinant AAV viral vector of the present invention comprises a capsid and a recombinant viral genome packaged therein, wherein the recombinant viral genome comprises or consists of one or more exogenous nucleotide sequences located between two AAV ITR sequences. The two ITR sequences located at the 5' and 3' ends of the recombinant viral genome (i.e., the 5' ITR and the 3' ITR) may be identical or different.

[0057] The term "inverted terminal repeat" (ITR) in this paper refers to cis-acting elements from the AAV viral genome that play a crucial role in AAV integration, rescue, replication, and genome packaging. The ITR sequence of natural AAV viruses contains a Rep protein binding site (RBS) and a terminal resolution site (trs), which can be recognized by Rep protein binding and create a cleavage at the trs. This ITR sequence can also form a unique "T"-shaped secondary structure, playing an important role in the AAV virus life cycle. The earliest isolated AAV virus, AAV2, has a 145 bp palindromic hairpin-structured inverted terminal repeat (ITR) located at both ends of the genome. Subsequently, different ITR sequences have been found in various serotypes of AAV viruses, but all can form hairpin structures and contain Rep binding sites. Traditional recombinant AAV viral vectors based on these wild-type ITR sequences are generally single-stranded AAV vectors (ssAAV), with the viral genome packaged in a single-stranded form within the AAV capsid. Unlike ssAAV, it has been found that by modifying the ITR and deleting the trs sequence and optionally the D sequence from one side of the ITR sequence of the AAV virus, the genome carried by the packaged recombinant AAV viral vector can become self-complementary, forming a double strand (Wang Z et al., Gene Ther. 2003; 10(26):2105-2111; McCarty DM et al., Gene Ther. 2003; 10(26):2112-2118). The resulting virus is a double-stranded AAV virus, namely scAAV (self-complementary AAV) virus. The packaging capacity of scAAV viral vector is smaller, only half that of ssAAV viral vector, about 2.2kb-2.5kb, but its transduction efficiency after infecting cells is higher.

[0058] In this document, the term ITR in relation to AAV encompasses both wild-type ITRs and variant ITRs. Wild-type ITRs can originate from any natural AAV virus, such as AAV2. Wild-type ITRs contain a Rep protein binding site (RBS) and a terminal resolution site (trs), which are recognized by Rep protein binding and create a cleavage at the trs. Wild-type ITR sequences form a distinctive "T"-shaped secondary structure and play a crucial role in the life cycle of AAV viruses. Variant ITRs, in this document, are non-natural ITR sequences that can, for example, originate from any wild-type AAV ITR sequence and contain one or more nucleotide deletions, substitutions, and / or additions, and / or truncations relative to the wild-type ITR, but remain functional, i.e., capable of generating ssAAV or scAAV viral vectors. In some preferred embodiments, two wild-type ITRs are combined to generate a single-stranded recombinant AAV viral vector (ssAAV).

[0059] AAV proteins VP1, VP2, and VP3 are capsid proteins that interact to form the AAV capsid. Different serotypes of AAV viruses exhibit different tissue tropisms, and exogenous genes can be transported to specific organs and tissues by selecting the serotype from which the recombinant AAV viral vector capsid originates (Wu Z et al., Mol Ther. 2006; 14(3):316-327). In this invention, the recombinant AAV viral vector can have different targeting properties by selecting the serotype from which the capsid originates. In some embodiments, the recombinant AAV virus has capsid proteins capable of guiding viral transport across the blood-brain barrier. In one embodiment, the recombinant AAV viral vector comprises a capsid from AAV9. In yet another embodiment, the recombinant AAV viral vector comprises a capsid from AAV9 and an ITR from AAV2.

[0060] The term "immune-associated miRNA" refers to miRNAs that are preferentially expressed in immune system cells, such as antigen-presenting cells. In some implementations, the immune-associated miRNA is miR-142-3p. Without being bound by any theory, gene expression carrying the miR-142-3p target sequence is significantly suppressed in immune cells, thereby reducing the probability of the body producing an immune response to the introduced gene therapy drug.

[0061] The term "treatment" refers to a clinical intervention intended to alter the natural course of a disease in an individual receiving treatment. Desired therapeutic effects include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or mitigating the disease state, and alleviating or improving prognosis. In some embodiments, the recombinant AAV virus of the present invention, after administration to MPSII subjects, preferably after administration to the lateral ventricle, reduces lysosomal GAG accumulation in multiple affected tissues of the subject (e.g., peripheral tissues such as the heart, liver, spleen, lungs, kidneys, muscles, and small intestine, and the brain). In some embodiments, the recombinant AAV virus of the present invention, after administration to MPSII subjects, preferably after administration to the lateral ventricle, improves central nervous system damage in the subject's brain.

[0062] In this document, "prevention" includes the suppression of the occurrence or development of a disease or symptoms of a specific disease. In some embodiments, subjects with a predisposition to MPSII disease are candidates for preventative programs. Generally, the term "prevention" refers to a hospital intervention implemented before the onset of at least one symptom of a disease. Thus, in one embodiment, prevention includes the administration of the gene therapy drug of the present invention to subjects with an IDS gene defect before the onset of symptoms of MPSII disease, in order to delay disease progression or prevent the onset of the disease.

[0063] The various aspects of the present invention will now be described.

[0064] I. Constructs for gene therapy

[0065] Expression builder

[0066] In one aspect, the present invention provides constructs for recombinant expression of human IDS. Although constitutive promoters have been proposed for use in gene therapy for MPSII, it has been found in the art that some constitutive promoters (e.g., CMV) do not drive the desired level of IDS expression (WO2017181113). The expression construct of the present invention uses the artificially synthesized constitutive promoter CAR-Mut, designed through in-depth research by the inventors. By utilizing this highly efficient promoter, via lateral ventricle injection, the construct of the present invention can advantageously achieve expression of the IDS-encoding nucleic acid sequence in a wide range of affected tissues or cells of MPSII patients, reducing GAG levels in various affected tissues of MPSII patients.

[0067] Therefore, in one embodiment, the present invention provides an expression construct comprising the following elements functionally linked to each other in a transcriptional direction:

[0068] -CAR-Mut promoter,

[0069] - The multinucleotide sequence encoding human IDS, and

[0070] -Optionally, transcription terminator.

[0071] In one embodiment of the expression construct of the present invention, the CAR-Mut promoter comprises or consists of the polynucleotide of SEQ ID NO: 1, or a variant thereof. Preferably, the variant has at least 95%, 96%, 97%, 98%, 99%, or 99.5% identity with the polynucleotide of SEQ ID NO: 1, and has a nucleotide C at position 568 of the nucleotide in SEQ ID NO: 1; and the variant has equivalent promoter activity to SEQ ID NO: 1. Those skilled in the art can use any promoter functional assay known in the art (e.g., luciferase reporter gene expression assay) to determine whether any two promoters have equivalent promoter activity. In one embodiment, under the same test conditions, if the test promoter has the same or substantially the same activity as the reference promoter SEQ ID NO: 1, for example, ±10%, preferably ±5%, or more preferably ±1% of the reference promoter activity, the test promoter can be considered to have equivalent promoter activity.

[0072] In some further embodiments, the expression constructs of the present invention are functionally linked to each other in a transcriptional direction, including the following elements:

[0073] -CAR-Mut promoter,

[0074] -Optional, Kozak sequence

[0075] - A polynucleotide sequence encoding human IDS, preferably the sequence of SEQ ID NO:2.

[0076] - At least one (e.g., 2-4) immune-related miRNA binding sites, especially miR-142 binding sites, such as miR-142 binding sites containing at least one (e.g., one or two) SEQ ID NO:7 sequence.

[0077] - Optionally, the transcription terminator, such as a polyA signal sequence, preferably selected from the SV40 late polyA sequence, the rabbit β-globin polyA sequence, the bovine growth hormone polyA sequence, or any variant thereof, more preferably comprising SEQ ID NO:5 or the bovine growth hormone polyA sequence having at least 95% identity with it.

[0078] In some embodiments, the expression construct further includes two ITR sequences. For example, from the 5' end to the 3' end, the expression construct may contain elements arranged as follows: 5'ITR-CAR-mut promoter-IDS coding sequence-miRNA binding site-polyA-3'ITR. In some embodiments, the 5'ITR and 3'ITR are identical. In another embodiment, the 5'ITR and 3'ITR are different, and one of them (preferably the 3'ITR) is a ΔITR lacking a functional trs site. In one embodiment, the 5'ITR and 3'ITR in the expression construct are identical, both containing or consisting of the sequence SEQ ID NO:5.

[0079] In one embodiment, the expression construct of the present invention may include a Kozak sequence located upstream of the start codon of the IDS-encoding nucleic acid sequence to facilitate IDS translation. The Kozak sequence used in the present invention may be a common sequence defined as GCCRCC, where R is a purine (i.e., A or G), and wherein said sequence is located immediately upstream of the start codon. In a preferred embodiment, the Kozak sequence in the nucleic acid sequence of the expression construct of the present invention has a 5'-GCCACC-3' sequence. Other different Kozak sequences may also be used. Kozak sequences can be screened using sequence libraries, and the enhancement effect on translation efficiency can be evaluated using conventional methods known in the art. For example, recombinant nucleic acids containing reporter genes or recombinant IDS genes with different Kozak sequences can be constructed, introduced into host cells, such as BHK cells, and after a period of time, the reporter gene expression level or IDS enzyme activity level in the cells or culture supernatant can be detected and compared with the recombinant nucleic acid having a reference Kozak sequence to determine the translation enhancement efficiency of the tested Kozak sequence.

[0080] In some embodiments, the expression construct of the present invention further comprises one or more immune-related miRNA binding sites, i.e., miRNA target sequences located in the 3'UTR of the nucleotide sequence encoding the target IDS. Without being bound by any specific theory, the miRNA binding sites in the expression construct allow for the regulation (e.g., inhibition) of the expression of the target gene in cells and tissues that produce the corresponding miRNA. Thus, in one embodiment, the expression construct of the present invention comprises one or more miRNA binding sites, thereby allowing downregulation of IDS expression in a cell-type-specific manner. In one embodiment, the expression construct of the present invention comprises one or more miRNA binding sites where the miRNA is expressed in antigen-presenting cells, thereby reducing the efficiency of IDS expression by the expression construct of the present invention in said antigen-presenting cells. In some embodiments, the one or more miRNA binding sites are located in the 3' untranslated region (3'UTR) of the IDS-encoding gene, for example, between the last codon and the polyA sequence of the nucleotide sequence encoding the IDS.

[0081] In some implementations, the expression construct includes one or more (e.g., 1, 2, 3, 4, 5 or more) miRNA binding sites that downregulate the expression of IDS genes from immune cells (e.g., antigen-presenting cells (APCs), such as macrophages and dendritic cells). Without being bound by any specific theory, the incorporation of such immune-related miRNA binding sites into the expression construct can reduce or inhibit the development of drug-resistant immune responses in subjects.

[0082] In some preferred embodiments, the expression construct includes one or more miR-142 binding sites (also referred to herein as miR-142 target sequences), such as the miR-142-3P target sequence of SEQ ID NO:7, or tandem repeat sequences thereof, such as 2, 3, 4, 5, or 6 tandem repeats, preferably 2 tandem recombinations, such as the miR-142-3P target sequence of SEQ ID NO:3. In some embodiments, the miRNA binding site can reduce the expression of the recombinant AAV vector in antigen-presenting cells. In some embodiments, the miRNA binding site can reduce the immunogenicity of the recombinant AAV vector. In some embodiments, the recombinant AAV vector containing the miRNA binding site elicits a low immune response in subjects. In other embodiments, the recombinant AAV vector containing the miRNA binding site elicits a low anti-drug antibody titer in subjects after administration, relative to a recombinant AAV vector control without the miRNA binding site. Preferably, the administration is ventricular administration. In one embodiment, the serum titer of the anti-IDS antibody is determined by measurement 1 to 6 weeks after administration, such as 4 weeks. Preferably, the serum titer is reduced by about 1 to 30 times, such as about 2, 3, 4, 5, 6, 7, 8, 10, 15, or 20 times, relative to the control.

[0083] In some embodiments, the expression construct of the present invention comprises at least one polyA tail downstream of a polynucleotide encoding IDS and miRNA binding sites. Any suitable polyA sequence may be used, including but not limited to hGHpolyA, bGHpolyA, SV40 late polyA sequence, rabbit β-globin polyA sequence, or any variant thereof. In a preferred embodiment, the polyA is bGHpolyA, such as the polyA shown in SEQ ID NO:5, or a polyA polynucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity with SEQ ID NO:5.

[0084] The IDS-encoding nucleic acid contained in the expression construct of the present invention can be any polynucleotide encoding functional IDS enzyme activity. In one embodiment, the nucleic acid encodes a full-length human IDS sequence, such as the sequence of SEQ ID NO: 10, or a fragment thereof, such as an IDS enzyme fragment starting between residues 1-33 of SEQ ID NO: 10 and terminating at residue 550, or at the corresponding position. Preferably, the IDS comprises a natural signal peptide targeting lysosomes (i.e., in the case of SEQ ID NO: 10, the signal peptide of amino acids 1-25). Alternatively, the IDS may comprise a heterologous signal peptide, such as a signal peptide from a human lysosomal targeting protein or secreted protein.

[0085] In some embodiments, the expression construct of the present invention comprises an IDS-encoding nucleic acid sequence, wherein the nucleic acid sequence encodes a polypeptide having IDS enzyme activity, wherein the polypeptide comprises an amino acid sequence having at least 95%, at least 97%, at least 98%, or at least 99% or higher sequence identity with the sequence of SEQ ID NO: 10, or the sequence of amino acids 26-550 of SEQ ID NO: 10, or the sequence of amino acids 34-550 of SEQ ID NO: 10. Preferably, the polypeptide has approximately the same GAG ​​(especially dermatan sulfate (DS) and heparan sulfate (HS)) hydrolytic activity compared to the reference IDS protein of SEQ ID NO: 10, for example, the IDS enzyme activity of the polypeptide is at least about 95%, about 96%, about 97%, 98%, 99% or higher of the reference IDS protease activity. Assays for determining IDS enzyme activity are known in the art. Those skilled in the art can use any such assay to determine suitable IDS polypeptides that can be used in the expression constructs, recombinant AAV viral vectors, and methods and uses of the present invention.

[0086] In one embodiment, the IDS-encoding nucleic acid used in the expression construct of the present invention comprises a nucleotide sequence selected from the following:

[0087] (i) The nucleotide sequence shown in SEQ ID NO:2;

[0088] (ii) A nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO:2;

[0089] (iii) A nucleotide sequence that encodes the same iduronate-2-sulfatase as (i) or (ii), but is different from the nucleotide sequence of (i) or (ii) due to the degeneracy of the genetic code; or

[0090] (iv) A sequence having at least 80% identity with the nucleotide sequence described in (i), (ii), or (iii); and

[0091] In one embodiment, the IDS-encoded nucleic acid used in the expression construct of the present invention comprises, or is composed of, the polynucleotide sequence of SEQ ID NO:2.

[0092] Recombinant AAV vector

[0093] In one aspect, the present invention provides a recombinant AAV vector. The recombinant AAV vector of the present invention is particularly useful for the treatment of MPSII disease. In one embodiment, the recombinant AAV vector comprises a capsid and nucleic acids located within the capsid, also referred to herein as the "genome of the recombinant AAV vector". The genome of the recombinant AAV vector comprises multiple elements, including but not limited to two inverted terminal repeats (ITRs, i.e., 5'-ITR and 3'-ITR), and other elements located between the two ITRs, including a promoter, a heterologous gene, and a polyA tail. Preferably, at least one immune-associated miRNA binding site may also be included between the two ITRs.

[0094] In this paper, adeno-associated virus (AAV) includes, but is not limited to, any serotype of AAV, such as AAV types 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11, and AAVs with artificially modified capsid proteins. The genomic sequences of various serotypes and artificially modified AAVs, along with their natural inverted terminal repeat (ITR) sequences, Rep proteins, and capsid cap proteins, are known in the art. These sequences can be found in publicly available databases such as GenBank or in the literature.

[0095] In some embodiments, the present invention provides a recombinant AAV viral vector comprising a capsid, wherein the capsid is composed of a capsid protein capable of crossing the blood-brain barrier, such as the AAV9 capsid protein. In some embodiments, the recombinant AAV viral vector of the present invention has neurological targeting. In another embodiment, the recombinant AAV vector, after systemic administration, can target and transduce peripheral and brain tissues of a subject. In yet another embodiment, compared to control subjects who have not received recombinant AAV vector administration, or compared to subjects before receiving recombinant AAV vector administration, the recombinant AAV vector results in higher expression of the target exogenous IDS gene and / or enzyme activity in the targeted and transduced tissues.

[0096] In some preferred embodiments, the recombinant AAV vector of the present invention has a capsid derived from the AAV9 serotype.

[0097] In some embodiments, both ITR sequences of the recombinant AAV vector of the present invention are full-length ITRs (e.g., approximately 125-145 bp in length, containing a functional Rep binding site (RBS) and a terminal unwinding site (trs)). In some embodiments, the full-length functional ITR is used to produce a single-stranded recombinant AAV vector (ssAAV).

[0098] In some embodiments, the recombinant AAV vector of the present invention comprises a wild-type AAV ITR, such as a wild-type AAV2ITR, for example, the ITR sequence shown in SEQ ID NO:5. In other embodiments, the recombinant AAV vector of the present invention comprises a variant ITR having one or more modifications relative to the wild-type AAV ITR, such as nucleotide addition, deletion, and / or substitution, but still enabling ssAAV virus packaging and production.

[0099] Therefore, in one aspect, the present invention provides a recombinant adeno-associated virus (AAV) vector, wherein the recombinant AAV vector comprises in its genome:

[0100] a.5' and 3' AAV inverted terminal repeat (ITR) sequences, and

[0101] b. An expression construct located between the 5' and 3' ITRs, wherein the expression construct contains the following elements functionally linked to each other in the transcriptional direction:

[0102] -Any CAR-Mut promoter according to the present invention, especially the promoter of SEQ ID NO: 1,

[0103] -Kozak sequence,

[0104] - A polynucleotide encoding human alpha-acid glucosidase (IDS), particularly the promoter of SEQ ID NO:2,

[0105] - At least one (e.g., 2-8) immune-associated miR-142 binding site, such as a miR-142 target sequence containing at least one (e.g., 1 or 2) sequence of SEQ ID NO:7, especially the miR-142-3P target sequence of SEQ ID NO:3.

[0106] - A transcription terminator, such as a polyA signal sequence, preferably selected from the SV40 late polyA sequence, the rabbit β-globin polyA sequence, the bovine growth hormone polyA sequence, or any variant thereof.

[0107] In some embodiments, the recombinant AAV vector is an ssAAV vector. In some embodiments, the recombinant AAV vector contains a capsid protein from the AAV9 serotype; preferably, the recombinant AAV vector is an AAV2 / 9 vector.

[0108] II. Preparation of Recombinant AAV Vectors

[0109] Existing technologies have relatively mature packaging systems for AAV carriers, which facilitates the large-scale production of AAV carriers.

[0110] Currently, commonly used AAV vector packaging systems mainly include three-plasmid co-transfection systems, systems using adenovirus as a helper virus, packaging systems using herpes simplex virus type 1 (HSV1) as a helper virus, and baculovirus-based packaging systems. Each packaging system has its own characteristics, and those skilled in the art can make an appropriate selection according to their needs.

[0111] The three-plasmid transfection packaging system is the most widely used AAV vector packaging system due to its high safety profile and the lack of auxiliary viruses required, and it is also the mainstream production system internationally. A slight drawback is that the lack of efficient, large-scale transfection methods limits the application of the three-plasmid transfection system in the large-scale preparation of AAV vectors.

[0112] Yuan et al. established a large-scale AAV packaging system using adenovirus as an auxiliary virus (Yuan Z et al., Hum Gene Ther. 2011; 22(5):613-624). The system has high production efficiency, but trace amounts of adenovirus are present in the final AAV product in the packaging system, which affects the safety of the AAV product.

[0113] HSV1, as a helper virus packaging system, is another widely used AAV vector packaging system. Wu Zhijian and Conway et al. proposed an AAV2 vector packaging strategy using HSV1 as a helper virus almost simultaneously (Wu Zhijian, Wu Xiaobing et al., Science Bulletin, 1999, 44(5): 506-509; Conway JE et al., Gene Ther. 1999, 6: 986-993). Subsequently, Wustner et al. proposed an AAV5 vector packaging strategy using HSV1 as a helper virus (Wustner JT et al., Mol Ther. 2002, 6(4): 510-518). Building on this, Booth et al. used two HSV1 viruses, one carrying the rep / cap gene of AAV and the other carrying the inverted terminal repeat (ITR) / exogenous gene expression cassette of AAV. These two recombinant HSV1 viruses were then used to co-infect production cells, packaging and generating AAV virus (Booth MJ, et al. Gene Ther. 2004; 11:829-837). Thomas et al. further established a suspension cell system for AAV production using dual HSV1 viruses (Thomas DL et al., Gene Ther. 2009; 20:861-870), enabling large-scale AAV virus production.

[0114] Urabe et al. constructed a baculovirus packaging system for AAV vectors by using three baculoviruses carrying the structural genes, non-structural genes, and ITR / exogenous gene expression cassettes of AAV, respectively. Considering the instability of baculoviruses carrying exogenous genes, the number of baculoviruses required in the production system was subsequently reduced, gradually decreasing from the initial requirement of three baculoviruses to the requirement of two or one baculovirus (Chen H., Mol Ther. 2008, 16(5): 924-930; Galibert L. et al., J Invertebr Pathol. 2011; 107Suppl: S80-93) and a strategy of combining one baculovirus with one induced cell line (Mietzsch M et al., Hum Gene Ther. 2014; 25: 212-222, Mietzsch M et al., Hum Gene Ther. 2015; 26(10): 688-697).

[0115] The recombinant AAV viral vector of the present invention can be produced using any suitable method known in the art. In one embodiment, the recombinant AAV virus of the present invention is produced using a three-plasmid packaging system. In another embodiment, the recombinant AAV virus of the present invention is produced using a baculovirus packaging system.

[0116] III. Pharmaceutical Composition

[0117] In another aspect, the present invention provides pharmaceutical compositions comprising the recombinant AAV viral vector of the present invention. The pharmaceutical compositions of the present invention preferably comprise pharmaceutically acceptable excipients, diluents, or carriers. The pharmaceutical compositions of the present invention can be formulated into any suitable dosage form.

[0118] Examples of suitable pharmaceutically acceptable excipients, diluents, or carriers for formulation are well known in the art, including, for example, phosphate-buffered saline solutions, water, emulsions, such as oil / water emulsions, various types of wetting agents, sterile solutions, etc. The formulation can be prepared by conventional methods and administered to the subject at an appropriate dose. Administration of a suitably formulated composition can be achieved in various ways, for example, intravenously, intraperitoneally, subcutaneously, intramuscularly, locally, or intradermally. The specific route of administration depends particularly on the type of carrier contained in the pharmaceutical composition. The dosage regimen will be determined by the attending physician and other clinical factors. As is well known in the medical field, the dose for any patient depends on many factors, including the patient's body size, body surface area, age, sex, the specific active agent to be administered, the time and route of administration, the type and stage of the drug, infection or disease, general health condition, and concomitant use of other drugs.

[0119] In some embodiments, the pharmaceutical composition of the present invention may comprise a second active agent. In some embodiments, the second active agent is a recombinant IDS protein for ERT, such as a recombinant IDS protein derived from transgenic animal milk or productive mammalian cell lines.

[0120] In other embodiments, the pharmaceutical compositions of the present invention may contain components capable of reducing side effects (e.g., drug-resistant immune responses) during drug administration. In some cases, said component may be an immunosuppressant.

[0121] The pharmaceutical compositions of the present invention can be administered via any suitable route, including systemic and local administration. In a preferred embodiment, the pharmaceutical compositions of the present invention are administered via lateral ventricle administration. Thus, in one embodiment, the present invention provides a pharmaceutical composition comprising the recombinant AAV carrier of the present invention, wherein the pharmaceutical composition is a lateral ventricle injection formulation or a lyophilized stable formulation suitable for formulation into such injection formulation.

[0122] IV. Treatment Methods

[0123] In another aspect, the present invention relates to a method of treating MPS II disease using the recombinant AAV carrier of the present invention or a pharmaceutical composition comprising thereof. In one embodiment, the method comprises administering any recombinant AAV carrier or pharmaceutical composition of the present invention to a subject in need. The recombinant AAV carrier or pharmaceutical composition may be administered via any suitable route, including but not limited to intramuscular, subcutaneous, intraspinal, intraventricular, intrathecal, intravenous, intradiaphragmatic, intrathoracic, and intraperitoneal administration. Preferably, the recombinant AAV carrier or pharmaceutical composition of the present invention is delivered to the subject via lateral ventricle administration. In some embodiments, the treatment is therapeutic. In other embodiments, the treatment is prophylactic. In some embodiments, the subject is a mammal, particularly humans, primates, dogs, horses, cattle, and especially human subjects. In some embodiments, the subject has been previously diagnosed with MPS II. In one embodiment, MPSII is severe MPSII or severe Hunter syndrome.

[0124] In methods relating to treating subjects with MPS II, in some embodiments, the treatment includes one or more of the following: (1) preventing or delaying the onset of MPS II; (2) reducing the severity of MPS II; (3) reducing or preventing the onset and / or exacerbation of at least one symptom of MPS II; (4) improving MPS II-related neurodegeneration and / or subject behavior; and (5) prolonging the subject's survival. Subjects with MPS II who may receive treatment include neonates, children, adolescents, and adult MPSII patients. In some embodiments, the subject is a neonatal MPS II patient, for example, 3–9 months of age or older. In still other embodiments, the subject is an MPSII patient under 3 years of age or 12 years of age; or is administered to an MPSII patient under 18 years of age.

[0125] Therefore, in one aspect, the present invention provides the use of the recombinant AAV viral vector of the present invention for driving the expression of polynucleotides encoding IDS in mammalian cells (especially human cells), or for use in the preparation of medicaments for driving the expression of polynucleotides encoding IDS in mammalian cells or one or more tissues or organs in a mammal (especially a human).

[0126] In another aspect, the present invention provides a method for treating a subject with MPSII, and the use of the recombinant AAV vector of the present invention in the preparation of a medicament for treating a subject with MPSII. The treatment comprises administering any one or more recombinant AAV vectors of the present invention to the subject, preferably by intraventricular injection.

[0127] In some embodiments of the treatment methods and uses of the present invention, administration of the recombinant AAV vector of the present invention increases the expression and / or activity of IDS peptides in the peripheral tissues (e.g., heart, liver, spleen, lung, kidney, muscle, and / or small intestine) and / or brain of the subject. In still other embodiments, administration of the recombinant AAV vector results in a reduction in lysosomal GAG accumulation in the peripheral tissues (e.g., heart, liver, spleen, lung, kidney, muscle, and / or small intestine) and / or brain of the subject, preferably reaching and maintaining levels comparable to those of unaffected individuals, for example, 50-120%, preferably about 80-120%, for example, about 90%-110%. GAG levels and / or enzyme (IDS) activity levels can be detected in samples from the subject (e.g., bodily fluid samples such as blood, serum, and urine, and / or biopsy tissues such as liver and spleen) to determine the therapeutic effect. In some embodiments, administration via the lateral ventricle results in IDS expression levels detected in the peripheral tissues of the subject that are approximately 5% or approximately 150% of the IDS levels in normal individuals (those without MPS II and without MPSII-related symptoms), preferably approximately 50% to approximately 100%, more preferably 80% to 100%. In yet another embodiment, administration via the lateral ventricle results in IDS expression levels detected in the brain tissue of the subject that are higher than normal IDS levels, for example, 110-400%, for example, more than 150%, more than 200%, or more than 300%.

[0128] In a preferred embodiment, after administration of the recombinant AAV vector of the present invention, no or low anti-IDS immune response is induced in the patient, for example, one month after administration, the patient's serum anti-IDS antibody titer is less than 1:10000, or less than 1:5000, or less than 1:3200, or even lower, as measured by, for example, ELISA.

[0129] Therefore, the present invention also provides the following methods and the use of the recombinant AAV vector of the present invention in the preparation of medicaments for the following methods:

[0130] (1) A method for preventing or reducing pathological lysosomal glycogen excess in subjects with or at risk of having MPSII;

[0131] (2) Methods for preventing or improving peripheral tissue and / or brain injury caused by excessive lysosomal glycogen storage in subjects who have or are at risk of having MPS II.

[0132] In some embodiments of the treatment methods and uses of the present invention, the recombinant AAV viral vector of the present invention is administered in combination with another therapeutic agent or treatment procedure. The therapeutic agent or treatment procedure that can be administered in combination with the recombinant AAV vector of the present invention may be selected from enzyme replacement therapy (ERT) and / or hematopoietic stem cell transplantation (HSCT). Example

[0133] This invention discloses a gene therapy drug for type II mucopolysaccharidosis, including drug design, small-scale preparation, and functional verification. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention. Unless otherwise specified, all reaction reagents involved in the embodiments can be purchased commercially.

[0134] The present invention will be further illustrated below with reference to the embodiments:

[0135] Materials and methods

[0136] Material

[0137] The pHelper plasmid, derived from the AAV Helper Free System (Agilent Technologies, USA), contains adenovirus-derived helper genes E2A, E4, and VA RNA, required for the preparation of recombinant AAV virus via co-transfection of HEK293 cells with three plasmids.

[0138] The pAAV-R2C9 plasmid was constructed as follows: Using the pAAV-RC plasmid from the AAV Helper Free System (Agilent Technologies, USA) as the basic backbone, positions 2013 to 4220 of the pAAV-RC plasmid were replaced with the AAV9 capsid protein coding sequence (GenBank ID: AY530579) to obtain the pAAV-R2C9 plasmid. The pAAV-R2C9 plasmid contains the complete AAV9 cap gene and AAV2 rep gene, providing the four Rep proteins (Rep78, Rep68, Rep52, and Rep40) and the AAV9 capsid protein necessary for packaging in the preparation of recombinant AAV1 virus through three-plasmid co-transfection and packaging.

[0139] IDS gene defective model mice: purchased from The Jackson Laboratory (JAX), USA, No. 024744.

[0140] C57BL / 6N mice: purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0141] General methods

[0142] IDS Analysis

[0143] IDS activity was determined primarily according to the literature (Prevention of Neurocognitive Deficiency in Mucopolysaccharidosis Type II Mice By CNS-Directed, AAV9-Mediated Iduronate Sulfatase Gene Transfer, Human Gene Therapy, DOI:10.1089 / hum.2016.184). In short, 4-methylumbelliferyl-aL-iduronide-2-sulfate disodium (4-MU-αIdoA-2S: Toronto Research Chemical Incorporation, Cat.#M334715) was used as a substrate to measure IDS enzyme activity in samples (e.g., tissue lysates) in a two-step assay. Enzyme activity is expressed as nmol / hr / ml plasma and nmol / hr / mg protein.

[0144] GAG (glycosaminoglycan) analysis

[0145] GAG was extracted from tissues of equal mass. The GAG ​​content in the tissues was determined using the DMMB spectrophotometric method. The GAG ​​content in the tissues was recorded as μg GAG / mg tissue.

[0146] Example 1: Construction of plasmid vector

[0147] To obtain the pRDAAV-CAR-Mut-IDS plasmid required for packaging recombinant AAV virus, pRDAAV-CMV-EGFP was first used. Figure 1 Based on this, the CMV promoter in the pRDAV vector was replaced with the self-designed CAR-Mut promoter (SEQ ID No. 1) to obtain the pRDAAV-CAR-Mut-EGFP vector. Next, the artificially synthesized human IDS (SEQ ID No. 2) sequence was cloned into the pRDAV-CAR-Mut-EGFP vector between the KpnI and EcoRI restriction sites to obtain the pRDAAV-CAR-Mut-IDS vector.

[0148] (1) Construction of pRDAAV-CAR-Mut-EGFP vector

[0149] The CAR-Mut promoter (SEQ ID No. 1) and pRDAAV-CMV-EGFP plasmid vector were used for construction. The pRDAAV-CMV-EGFP plasmid vector contains:

[0150] i) An ITR from the AAV2 genome, the sequence of which is shown in SEQ ID NO:4;

[0151] ii) Constitutive CMV promoters;

[0152] iii) The nucleotide sequence expressing enhanced green fluorescent protein EGFP;

[0153] iv) Bovine growth hormone polynucleotide tailing signal BGH polyA, sequence shown in SEQ ID NO:5;

[0154] v) ITR from the AAV2 genome, sequence as shown in SEQ ID NO:4.

[0155] XhoI and KpnI restriction sites were added to both ends of the CAR-Mut promoter sequence. The sequence after adding the restriction sites was synthesized by GenScript Biotech Co., Ltd., and the synthesized sequence was cloned into the pUC57 simple vector (GenScript Biotech, Nanjing) to obtain pUC57-CAR-Mut.

[0156] The pUC57-CAR-Mut and pRDAAV-CMV-EGFP vectors were digested with XhoI and KpnI, respectively. The CAR-Mut promoter fragment and the pRDAAV-CMV-EGFP vector fragment (approximately 6.9 kb) with the CMV promoter removed were recovered. The two fragments were ligated and transformed into E. coli DH5α competent cells (Qingke Xinye, Beijing). After screening and identification, the AAV plasmid vector pRDAAV-CAR-Mut-EGFP containing the CAR-Mut promoter was obtained. Figure 2 ).

[0157] (2) Construction of pRDAAV-CAR-Mut-IDS vector

[0158] The cDNA sequence of the human IDS gene (GenBank: CCDS14685.1) was synthesized by GenScript Biotech Co., Ltd. (sequence information is shown in SEQ ID No. 2). A KpnI restriction site and a Kozak sequence 5'-GCCACC-3' (SEQ ID NO: 6) were added upstream of the synthesized IDS gene cDNA sequence, and a taa stop codon and an EcoRI restriction site were added downstream of the 3' end. The synthesized sequence was cloned into the pUC57 simple vector (GenScript Biotech, Nanjing) to obtain the pUC57-IDS vector. The pUC57-IDS vector and the pRDAAV-CAR-Mut-EGFP vector were digested with KpnI and EcoRI, respectively. The IDS fragment and the pRDAAV-CAR-Mut-EGFP vector fragment (with the EGFP reporter gene removed) were recovered. The two fragments were ligated and transformed into E. coli DH5α competent cells (Qingke Xinyue, Beijing). After screening and identification, the pRDAAV-CAR-Mut-IDS vector was obtained. Figure 3 (3) Construction of pRDAAV-CAR-Mut-IDS-142-3P vector

[0159] Oligo primers containing two tandem miRNA-142-3p binding sites (SEQ ID NO:3, MicroRNA 142-3P) were synthesized by Beijing Qingke Xinyue Biotechnology Co., Ltd. After annealing, a 142-3P fragment with an EcoRI restriction site upstream and a SalI restriction site downstream was obtained. The pRDAAV-CAR-Mut-IDS vector was linearized by digestion with EcoRI and SalI. The vector backbone was recovered and ligated with the 142-3P fragment, then transformed into E. coli DH5α competent cells (Qingke Xinyue, Beijing). After screening and identification, the pRDAAV-CAR-Mut-IDS-142-3P vector was obtained. Figure 4 ).

[0160] Example 2: In vitro expression validation of pRDAAV-CAR-Mut-IDS and pRDAAV-CAR-Mut-IDS-142-3P vector

[0161] Healthy HEK-293 cells were evenly seeded into nine wells of a six-well cell culture plate. When the cell density in each well reached 80%, three wells each of pRDAAV-CAR-Mut-IDS and pRDAAV-CAR-Mut-IDS-142-3P were transfected using Lipofectamine 2000 (Invitrogen, USA). The remaining three wells served as a blank control (see product instructions for detailed transfection procedures). Twenty-four hours after transfection, cells were digested and collected. Total cellular protein was extracted using a freeze-thaw cycle followed by centrifugation. The total protein concentration of HEK cells transfected with pRDAAV-CAR-Mut-IDS and pRDAAV-CAR-Mut-IDS-142-3P, as well as the blank cells, was determined using the Pierce BCA Protein Aaasy Kit (ThermoFisher, USA). Detailed procedures were performed according to the kit instructions.

[0162] After extracting total cellular protein, 15 μg of each extracted protein was used to determine IDS protease activity. The results showed that the IDS protease activity of blank HEK-293 cells was extremely low, at 1.26 ± 0.02 nmol / h / mg protein. In contrast, the IDS protease activity of HEK-293 cells transfected with the pRDAAV-CAR-MUT-IDS plasmid was 23.87 ± 0.34 nmol / h / mg protein, which was 18.9 times that of blank cells. The IDS protease activity of HEK-293 cells transfected with the pRDAAV-CAR-Mut-IDS-142-3P plasmid was 23.56 ± 0.69 nmol / h / mg protein, showing no significant difference compared to cells transfected with the pRDAAV-CAR-Mut-IDS plasmid. Figure 5 ).

[0163] The above results demonstrate that the constructed pRDAAV-CAR-Mut-IDS plasmid can efficiently express IDS protein in cells, and the expressed protein is active and can play a role in substrate degradation. The addition of 142-3P does not affect IDS expression in HEK293 cells in vitro.

[0164] Example 3: Preparation and assay of rssAAV-CAR-Mut-IDS and rssAAV-CAR-Mut-IDS-142-3P

[0165] (1) Packaging of recombinant AAV virus

[0166] Recombinant AAV virus was packaged and purified using a three-plasmid packaging system. The procedure was largely performed according to the method described in Chiorini, JA et al., “Biologically active Rep proteins of adeno-associated virus type 2 produced as fusion proteins in Escherichia coli.” Journal of Virology vol. 68, 2(1994): 797-804. Briefly, the AAV vector plasmid (pRDAAV-CAR-Mut-IDS or pRDAAV-CAR-Mut-IDS-142-3P), helper plasmid (pHelper), and AAV Rep and Cap protein expression plasmid (pAAV-R2C9) were mixed in a 1:1:1 molar ratio and transfected into HEK293 cells using the calcium phosphate method. After 48 h of transfection, cells and culture supernatant were harvested, and the recombinant AAV virus was isolated and purified using cesium chloride density gradient centrifugation. Packaging and purification yielded rAAV9-CAR-Mut-IDS and rAAV9-CAR-Mut-IDS-142-3P.

[0167] (2) Detection of titer of recombinant AAV virus

[0168] The genomic titer of the prepared recombinant AAV virus (rAAV) was determined using dot hybridization. The specific procedure is as follows:

[0169] Two primers, IDS-F and IDS-R, were designed for the IDS gene:

[0170] IDS-F: 5'-CGCGTTTCTTTCCTCACTGG-3' (SEQ ID NO: 8)

[0171] IDS-R: 5'-ACGGAIDSTCATCGGTATGG-3'(SEQ ID NO:9)

[0172] Using IDS-F and IDS-R as primers, the IDS gene was specifically amplified by PCR to obtain a 190 bp DNA probe fragment. The pRDAAV-CAR-Mut-IDS plasmid and its serially diluted 2-fold buffers were used as standards to serially dilute the rAAV samples 2-fold to prepare the detection samples. The standards and detection samples were spotted onto a hybridization membrane, and the probe was used to hybridize with the membrane. The procedure is detailed in Molecular Cloning: A Laboratory Manual (4th Edition). The hybridization signals of the sample spots and the series of standard spots were compared using ImigeJ software to analyze and calculate the rAAV sample titer.

[0173] Example 4: Exploration of the efficacy of MPSⅡ therapeutic drug in normal mice

[0174] Fifteen 6-week-old C57BL / 6N wild-type mice were randomly divided into 5 groups. Each mouse in group 1 received a single tail vein injection of rAAV9-CAR-Mut-IDS at a dose of 1×10⁻⁶. 13 GC / kg. Each mouse in group 2 received a single intravenous injection of rAAV9-CAR-Mut-IDS via the tail vein at a dose of 5 × 10⁻⁶. 13 GC / kg. Each mouse in group 3 received a single intravenous injection of rAAV9-CAR-Mut-IDS-142-3P via the tail vein at a dose of 1×10⁻⁶. 13 GC / kg. Each mouse in group 4 was injected via tail vein with rAAV9-CAR-Mut-IDS-142-3P at a dose of 5 × 10⁻⁶. 13 GC / kg. Group 5 mice were injected intravenously with 200 μL PBS each as a control. One month after injection, all mice were sacrificed, and brain, heart, liver, spleen, lung, kidney, small intestine, and muscle tissues were dissected from each mouse. Equal masses of different tissues were collected, and total protein was extracted. The total protein concentration of each group was determined using the Pierce BCA Protein Aaasy Kit (ThermoFisher, USA). Detailed procedures were performed according to the kit instructions. 15 μg of total protein was collected from different tissues of all mice for IDS enzyme activity determination.

[0175] The results are as follows Figure 6 As shown, in C57 BL / 6N wild-type mice injected with the virus, the activity of IDS protein in various tissues was higher than that in uninjected wild-type mice, especially with a significant increase in IDS protein activity in the liver. This indicates that our designed recombinant AAV, as a therapeutic agent for MPS II (mucopolysaccharidosis type II), can effectively express and produce active IDS protein (i.e., iduronate 2-sulfatase, I2S) after being injected into mice via the tail vein. The addition of 142-3P did not affect the normal expression of IDS in mouse tissues.

[0176] Example 5: Evaluation of the efficacy of MPSⅡ therapeutic drug in model mice.

[0177] Twenty-four newborn mice with homozygous mutations in the IDS gene were randomly divided into three groups. One group served as the negative control, with each mouse receiving a single injection of 5 μL PBS into the lateral ventricle. The other two groups served as experimental groups, receiving single injections of rAAV9-CAR-Mut-IDS and rAAV9-CAR-Mut-IDS-142-3P into the lateral ventricle, respectively, at a dose of 5 × 10⁻⁶ mg / mL. 13GC / kg. An additional group of 8 newborn C57BL / 6J wild-type mice was added as a control.

[0178] IDS enzyme activity assay

[0179] Three months after injection, all mice were sacrificed. Brain, heart, liver, spleen, lung, kidney, small intestine, and muscle tissue were dissected from each mouse. Equal masses of different tissues were collected, and total protein was extracted. The total protein concentration of each group was determined using the Pierce BCA Protein Aaasy Kit (ThermoFisher, USA). Detailed procedures were performed according to the kit instructions. 15 μg of total protein was collected from different tissues of all mice for the determination of IDS enzyme activity.

[0180] like Figure 7 As shown, the activity of IDS in various tissues and organs of uninjected recombinant virus model mice was extremely low, almost undetectable. In model mice injected with ICV, the IDS enzyme activity in the heart, liver, spleen, lung, kidney, small intestine, muscle, and brain tissues all increased significantly. The activity in each tissue was significantly or extremely significantly higher than that in uninjected model mice. The IDS enzyme activity in multiple tissues was essentially comparable to that in wild-type mice, and in the brain and heart, it even exceeded that of uninjected wild-type mice. This indicates that our designed virus, injected into model mice via the lateral ventricle, can widely and effectively infect cells in multiple tissues and express active IDS protein. There was no significant difference in expression levels between the two constructs carrying and not carrying the miR-142-3p binding site.

[0181] Immunohistochemistry

[0182] The quadriceps femoris muscles of four groups of mice were taken, cut to appropriate sizes, fixed by soaking in 4% paraformaldehyde, labeled, and sent to Longmedas Co., Ltd. for pathological analysis.

[0183] The results are as follows Figure 8 As shown. Figure 8 A represents wild-type mice injected with PBS, B represents homozygous IDS model mice injected with PBS, C represents IDS model mice injected with rAAV9-CAR-Mut-IDS, and D represents model mice injected with rAAV9-CAR-Mut-IDS-142-3P. Model mice ( Figure 8 B) showed extensive inflammatory cell infiltration and degenerative changes in the tissue. After treatment with two recombinant AAV virus drugs, the model mice ( Figure 8 Both C and 8D showed varying degrees of improvement in muscle pathology, including reduced inflammation and lessened tissue degeneration. After adding 142-3P to the recombinant AAV virus (C), Figure 8D) Fewer inflammatory cell infiltrations were observed, suggesting that Micro 142-3P helps reduce the inflammatory response.

[0184] GAG storage volume determination

[0185] GAG was extracted from tissues of equal mass. The GAG ​​content in the tissues was determined using the DMMB spectrophotometric method. Results are shown below. Figure 9 The GAG ​​content in multiple tissues of virus-injected model mice was significantly lower than that of uninjected model mice, but slightly higher than that of normal mice. There was no significant difference in GAG content in multiple tissues between model mice injected with rAAV9-CAR-Mut-IDS and those injected with rAAV9-CAR-Mut-IDS-142-3P.

[0186] The results showed that after viral injection, the IDS protein produced in the model mice could effectively break down GAG stored in the tissues, thereby reducing the GAG ​​content in the tissues and achieving the therapeutic purpose.

[0187] Example 6: Evaluation of the efficacy of MPSII therapeutic agent and other investigational drugs in model mice.

[0188] Existing reported gene therapy drugs for MPS II include intravenous injection of AAV2 / 8 vectors in MPS II mice by Monica Cardone et al., intraventricular injection of rAAV9-CB7-hIDS in mouse models by Laoharawee et al., and intraventricular injection of rAAV9-CAG-hIDS in mouse models by Sandra Motas et al. Monica Cardone et al.'s approach differs significantly from that of this invention. Therefore, this study primarily compares rAAV9-CB7-hIDS and rAAV9-CAG-hIDS, which use the same serotype and are administered via intraventricular injection as those used in this invention.

[0189] Recombinant AAV virus was packaged and purified using a three-plasmid packaging system. Briefly, the AAV vector plasmid (pRDAAV-CB7-IDS or pRDAAV-CAG-IDS), helper plasmid (pHelper), and AAV Rep and Cap protein expression plasmid (pAAV-R2C9) were mixed in a 1:1:1 molar ratio and transfected into HEK293 cells using the calcium phosphate method. After 48 hours of transfection, cells and culture supernatant were harvested, and the recombinant AAV virus was isolated and purified using cesium chloride density gradient centrifugation. rAAV9-CB7-hIDS and rAAV9-CAG-hIDS were obtained after packaging and purification. The method was the same as in Example 3.

[0190] Thirty-two newborn mice with homozygous mutations in the IDS gene were randomly divided into four groups. One group served as the negative control, with each mouse receiving an injection of 5 μL PBS into the lateral ventricle. The other three groups served as the experimental groups, receiving intraventricular injections of rAAV9-CAR-Mut-IDS-142-3P, rAAV9-CB7-hIDS, and rAAV9-CAG-hIDS, respectively, at a dose of 5 × 10⁻⁶ per mouse. 13 GC / kg. An additional group of 8 newborn C57BL / 6J wild-type mice was added as a control.

[0191] One month after injection, all mice were sacrificed, blood was collected, serum was separated, and the brain, heart, liver, spleen, lungs, kidneys, small intestine, and muscle tissue of each mouse were dissected and separated.

[0192] The isolated serum was analyzed using an ELISA method to detect IDS antibody titers. ELISA results are shown below. Figure 11 .

[0193] Brain, heart, liver, spleen, lung, kidney, small intestine, and muscle tissue were collected from each dissected mouse. Equal masses of different tissues were taken, and total protein was extracted. The total protein concentration of each group was determined using the Pierce BCA Protein Aaasy Kit (ThermoFisher, USA). Detailed procedures were performed according to the kit instructions. 15 μg of total protein was taken from different tissues of all mice for the determination of IDS enzyme activity. Results are shown below. Figure 10 .

[0194] like Figure 10 As shown, the activity of IDS in various tissues and organs of uninjected mouse models was extremely low, almost undetectable. In mouse models injected with ICV, the IDS enzyme activity in the heart, liver, spleen, lungs, kidneys, small intestine, muscle, and brain tissues all increased significantly. The activity in these tissues was significantly or extremely significantly higher than that in uninjected mouse models. The increase was in the order: AAV9-CAG-hIDS > rAAV9-CAR-Mut-IDS-142-3P > rAAV9-CB7-hIDS.

[0195] like Figure 11As shown, one month after drug injection, the serum IDS antibody levels in uninjected model mice and wild-type mice were extremely low, with a titer of approximately 1:10; mice injected with rAAV9-CAR-Mut-IDS-142-3P produced low levels of IDS antibodies, with a titer of 1:3200; while mice injected with AAV9-CAG-hIDS and rAAV9-CB7-hIDS both produced high levels of IDS antibodies, with a titer of 1:51200. These results demonstrate that the design of this invention can effectively reduce the immunogenicity of the drug and effectively reduce the IDS antibodies produced by the body's immune response after injection, making the treatment process safer.

[0196] sequence list

[0197] SEQ ID No. 1: CAR-Mut promoter, underlined and bolded to show nucleotide C at position 568.

[0198]

[0199] SEQ ID No. 2: IDS gene sequence

[0200]

[0201] SEQ ID No. 3: Tandem MicroRNA 142-3P target sequence

[0202] 5'-TCCATAAAGTAGGAAACACTACATCCATAAAGTAGGAAACACTACA-3'

[0203] SEQ ID NO:4: 145bp ITR sequence from the AAV2 genome

[0204] 5'-TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT-3'

[0205] SEQ ID NO:5: Bovine growth hormone polynucleotide tailed signal BGH polyA

[0206] 5'-GCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTAT-3'

[0207] SEQ ID NO:6: Kozak sequence

[0208] 5'-GCCACC-3'

[0209] SEQ ID NO:7: Single miR-142-3p target site

[0210] TCCATAAAGTAGGAAACACTACA

[0211] SEQ ID NO:8: Primers for detecting the genomic titer of recombinant AAV virus

[0212] IDS-F: 5'-CGCGTTTCTTTCCTCACTGG-3' (SEQ ID NO: 8)

[0213] SEQ ID NO:9: Primers for detecting the genomic titer of recombinant AAV virus

[0214] IDS-R: 5'-ACGGAGAATCATCGGTATGG-3'(SEQ ID NO:9)

[0215] SEQ ID NO:10 Human IDS enzyme amino acid sequence (UniProtKB-P22304), where aa1-aa25 are signal peptides; aa26-33 are propeptides;

[0216]

Claims

1. A recombinant AAV9 viral vector, characterized in that, An expression construct containing the iduronic acid-2-sulfatase (IDS) gene, the expression construct comprising the following elements functionally linked to each other in the transcriptional direction: (1) The promoter sequence shown in SEQ ID NO:1; (2) The nucleic acid encoding human iduronate-2-sulfatase (3) Human miR-142-3p target sequence, which consists of two tandem nucleotide sequences shown in SEQ ID NO:

7.

2. The recombinant AAV9 viral vector of claim 1, wherein the genome of the viral vector comprises: a.5' and 3' AAV inverted terminal repeat ITR sequences, and b. The expression construct of claim 1 located between the 5' and 3' ITRs.

3. The recombinant AAV9 viral vector according to claim 2, wherein the expression construct comprises the following elements functionally linked to each other in the transcriptional direction: -The promoter sequence shown in SEQ ID NO:1, -Kozak sequence, - A polynucleotide encoding human iduronate-2-sulfatase hIDS -The human miR-142-3p target sequence shown in SEQ ID NO:3, - Transcription terminator.

4. The recombinant AAV9 viral vector according to claim 3, wherein the transcription terminator is a bovine growth hormone polyA sequence.

5. The recombinant AAV9 viral vector according to claim 2, wherein the 5' and 3' ITRs are wild-type AAV2 ITR sequences.

6. The recombinant AAV9 viral vector according to claim 1, wherein the nucleic acid encoding human iduronate-2-sulfatase encodes human iduronate-2-sulfatase selected from the following amino acid sequence: (a) Amino acids 1 to 550 of SEQ ID NO: 10; (b) Amino acids 26 to 550 of SEQ ID NO: 10; or (c) Amino acids 34 to 550 of SEQ ID NO:

10.

7. The recombinant AAV9 viral vector according to claim 1, wherein the nucleic acid encoding human iduronate-2-sulfatase is a nucleotide sequence selected from the following: (i) a nucleotide sequence as shown in SEQ ID NO:2; or (ii) The nucleotide sequence of (i) encodes the same iduronate-2-sulfatase, but is different from the nucleotide sequence of (i) due to the degeneracy of the genetic code.

8. A pharmaceutical composition comprising the recombinant AAV9 viral vector of any one of claims 1-7 and a pharmaceutically acceptable vector.

9. The pharmaceutical composition according to claim 8, wherein the pharmaceutical composition is for intravenous administration or intraventricular injection.

10. The pharmaceutical composition according to claim 9, wherein the pharmaceutical composition is for intraventricular injection.

11. The pharmaceutical composition according to any one of claims 8-10, wherein the titer of the recombinant AAV9 viral vector is at least 1.0E13 GC / ml.

12. Use of the recombinant AAV9 viral vector according to any one of claims 1-7 or the pharmaceutical composition according to any one of claims 8-11 in the preparation of a medicament for treating mucopolysaccharidosis type II (MPSII) in a subject.

13. The use according to claim 12, wherein the subject is a neonatal MPSII patient; or an MPSII patient under 5 years of age or 12 years of age; or an MPSII patient under 16 years of age; or an adult MPSII patient.

14. The use according to claim 13, wherein the patient is an MPSII patient with CNS involvement.

15. The use according to any one of claims 12-14, wherein the pharmaceutical composition is used to increase the level of functional hIDS in the cells or one or more tissues or organs of a subject.

16. The use according to any one of claims 12-14, wherein the pharmaceutical composition is used to express hIDS in the heart, liver, spleen, lung, kidney, muscle, intestine and brain of a subject.

17. The use according to any one of claims 12-14, wherein the pharmaceutical composition is formulated for systemic or local administration.

18. The use according to claim 17, wherein the pharmaceutical composition is formulated for intravenous administration or intraventricular injection.

19. The use according to claim 17, wherein the pharmaceutical composition is formulated for administration by lateral ventricle injection.

20. The use according to any one of claims 12-14, wherein the pharmaceutical composition is used to increase the level of functional hIDS in the peripheral tissues and / or brain of a subject.

21. The use according to any one of claims 12-14, wherein the pharmaceutical composition is used to reduce the level of glycosaminoglycans in the peripheral tissues and / or brain of a subject.

22. The use according to any one of claims 12-14, wherein the pharmaceutical composition is used to reduce the level of heparan sulfate in the peripheral tissues and / or brain of a subject.

23. The use according to any one of claims 12-14, wherein the pharmaceutical composition is formulated such that, after administration of the recombinant AAV9 vector, the anti-IDS antibody titer in a serum sample from the subject, as determined by ELISA, is less than 1:6000, 1:3200, or 1:2000.