Preparation method of class A soybean saponin acetyltransferase GmSSAcT1 and microorganism used therein

Abstract

The invention discloses a method for preparing a class A soybean saponin acetyltransferase GmSSAcT1 and a microorganism used therein. The invention belongs to the field of biotechnology, and relates to a method for preparing a class A soybean saponin acetyltransferase GmSSAcT1 and a microorganism used therein. The method for preparing an acetyltransferase provided by the invention comprises introducing an acetyltransferase gene expression vector into a microorganism to obtain a recombinant microorganism producing an acetyltransferase; the acetyltransferase gene expression vector is a recombinant vector expressing an acetyltransferase obtained by inserting an acetyltransferase gene into a starting expression vector. The acetyltransferase obtained by the invention has the function of soybean saponin A acetyltransferase, and has broad application prospects in the fields of soybean molecular assisted breeding, human health care, and the like.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a preparation method of class A soybean saponin acetyltransferase GmSSAcT1 and a microorganism used therein. Background Art

[0002] Soybean (Glycine max (L.) Merr.) is native to China. There are abundant soybean germplasm resources, and there are many varieties that are widely planted in tropical, temperate, high and low latitude areas. Soybean belongs to the Leguminosae family, Papilionozdeae subfamily, Glycine genus, and is divided into two subgenera, Glycine and Soja. In addition to the well-known proteins and oils, soybean seeds are also rich in specific metabolites (Plantspecialized metabolites) that are beneficial to human health, such as isoflavones, soyasaponins and other compounds. Among them, soyasaponins are oleanane-type triterpenoid saponins, which are accumulated in large quantities in various tissues of leguminous plants. According to the different modification groups, there are currently 54 main types of saponins reported in soybeans. According to the different hydroxyl modification groups, they can be mainly divided into type A saponins, type B saponins (thermally unstable DDMP (2,3-dihydro-2,5-dihydroxy-6-methyl-4H-pyran-4-one; DDMP group linked at position 22) and type E (carbonyl at position 22) saponins), which are produced by Soyasapogenol A and Soyasapogenol B after different glycosylation modifications, respectively.

[0003] Soysaponin A has liver protection and antiviral effects, saponin Ab has anti-inflammatory effects; DDMP saponins have anti-cardiovascular and cerebrovascular disease effects, and DDMP soysaponin βg has antioxidant effects. In addition, soysaponins have many important commercial application values, such as food additives, cosmetics manufacturing raw materials, pesticides, etc.

[0004] Glycosylation of class A saponins occurs at two sites, C-3 and C-22, where the sugar chain at C-3 consists of three sugars, while the sugar chain at C-22 usually consists of two sugars. The first sugar at C-22 is arabinose, and the terminal sugar is xylose or glucose, and the C-22 terminal sugar of the final product class A saponin needs further acetylation modification. Studies have shown that the main source of bitterness in soybeans is class A saponins, and the acetylation modification of the second sugar at C-22 of class A saponins is the direct cause of bitterness. Therefore, soybean breeders are committed to screening strains lacking class A saponins and soybean strains containing unacetylated class A saponins. However, research on class A soybean saponin acetyltransferase (Soyasaponin acetyltransferase; GmSSAcT1) has been slow, and its encoding cDNA sequence has not been cloned in any species so far. Summary of the invention

[0005] The problem to be solved by the present invention is how to obtain Class A soybean acetyltransferase to screen Class A saponin-deficient strains and soybean strains containing unacetylated modified Class A saponins.

[0006] In order to solve the above problems, the present invention provides a method for preparing acetyltransferase.

[0007] The method for preparing acetyltransferase provided by the present invention comprises: introducing an acetyltransferase gene expression vector into a microorganism to obtain a recombinant microorganism producing acetyltransferase; the acetyltransferase gene expression vector is a recombinant vector expressing acetyltransferase obtained by inserting an acetyltransferase gene into a starting expression vector.

[0008] The acetyltransferase is a protein of any of the following:

[0009] A1) a protein with an amino acid sequence as shown in SEQ ID No. 1;

[0010] A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having more than 80% identity with the protein of A1) and having the function of catalyzing soybean saponin Aa or Ab;

[0011] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0012] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0013] In the above protein, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0014] The gene encodes the protein, and the gene is selected from any one of the following:

[0015] B1) the coding sequence of the coding strand is a cDNA molecule or a DNA molecule of SEQ ID No. 2;

[0016] B2) A DNA molecule that has more than 80% identity with the DNA molecule defined in B1) and encodes the soybean saponin A acetyltransferase.

[0017] In the above method, the acetyltransferase protein is derived from soybean (Glycine max (L.) Merr.).

[0018] The present invention provides an application, which may be any of the following:

[0019] U1) Use of the above protein as soybean saponin A acetyltransferase;

[0020] U2) Use of the above protein, or a substance that regulates the gene expression of the protein, or a substance that regulates the activity or content of the protein in the preparation of soybean saponin A acetyltransferase.

[0021] Herein, the substance that regulates the activity and / or content of the protein may be a substance that regulates the expression of a gene encoding the protein GmSSAcT1.

[0022] Herein, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0023] In the above application, the substance regulating the protein gene expression and the substance regulating the protein activity or content may be a biological material related to the protein, and the biological material may be any one of the following B1) to B7):

[0024] B1) a nucleic acid molecule encoding the above protein;

[0025] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0026] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0027] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0028] B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2);

[0029] B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0030] B7) A transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2).

[0031] In the above application, the nucleic acid molecule B1) is a cDNA molecule or a DNA molecule whose coding sequence of the coding chain is SEQ ID No. 2.

[0032] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0033] Those skilled in the art can easily mutate the nucleotide sequence encoding the protein GmSSAcT1 of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the protein GmSSAcT1 isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein GmSSAcT1 and have the function of the protein GmSSAcT1.

[0034] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0035] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching to calculate the identity of an amino acid sequence, the value (%) of identity can then be obtained.

[0036] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0037] Microorganisms described herein can be yeast, bacteria, algae or fungi. Wherein, bacteria can be from Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, etc.

[0038] The present invention also provides a recombinant Escherichia coli, which contains the coding gene of the protein.

[0039] The recombinant Escherichia coli expresses the soybean saponin A acetyltransferase.

[0040] In the above-mentioned recombinant Escherichia coli, the soybean saponin A acetyltransferase can be selected from any one of the following proteins:

[0041] 1) A protein having an amino acid sequence as shown in SEQ ID No. 1;

[0042] 2) A protein having 80% or more identity with the protein shown in 1) and having soybean saponin A acetyltransferase obtained by substitution and / or deletion and / or addition of amino acid residues of the protein shown in 1);

[0043] 3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of 1) or 2).

[0044] The method for constructing the recombinant Escherichia coli comprises introducing the soybean saponin A acetyltransferase gene into a recipient bacterium to obtain the recombinant Escherichia coli.

[0045] The present invention discloses a preparation method of soybean saponin A acetyltransferase GmSSAcT1 and a microorganism used therein. The protein provided by the present invention is derived from soybean (Glycine max (L.) Merr.), named as GmSSAcT1 protein, and is as follows (a) or (b): (a) a protein composed of an amino acid sequence shown in sequence 1 in a sequence table; (b) a protein derived from (a) having the function of soybean saponin A acetyltransferase by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid residue sequence of sequence 1 in the sequence table. The GmSSAcT1 protein provided by the present invention has the function of soybean saponin A acetyltransferase. The present invention provides a transformation idea for cultivating soybeans with low bitterness and astringency. In practical applications, soybeans with low bitterness and astringency can be cultivated by knocking out the coding gene of soybean saponin A acetyltransferase GmSSAcT1. The present invention has broad application prospects in the fields of soybean molecular assisted breeding, human health care, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Tissue specificity of GmSSAcT1 expression in soybean plants.

[0047] Figure 2 SDS-PAGE analysis for GmSSAcT1-His purification.

[0048] Figure 3 Preparation of deacetylated soybean saponin Ab (null-acetyl Ab, Figure 3 a) and Aa(null-acetyl Aa; Figure 3 (b)

[0049] Figure 4It is the enzymatic reaction of GmSSAcT1. a. LC-MS analysis of the formation of the final product soybean saponin Aa in the enzymatic reaction (deacetylated soybean saponin Aa as substrate). High-resolution mass spectrometry extracted ions, mass-to-charge ratio m / z 1239.6004 corresponds to deacetylated soybean saponin Aa, and mass-to-charge ratio m / z 1365.6297 corresponds to soybean saponin Aa; b. LC-MS analysis of the formation of intermediate products in the enzymatic reaction (deacetylated soybean saponin Aa as substrate). High-resolution mass spectrometry extracted ions, mass-to-charge ratio m / z1281.6110 corresponds to monoacetylated soybean saponin Aa, and mass-to-charge ratio m / z 1323.6216 corresponds to diacetylated soybean saponin Aa; c. LC-MS analysis of the formation of the final product soybean saponin Aa in the enzymatic reaction (deacetylated soybean saponin Ab as substrate). High-resolution mass spectrometry extracted ions, mass-to-charge ratio m / z 1269.6110 corresponds to deacetylated soybean saponin Aa, mass-to-charge ratio m / z 1437.6533 corresponds to soybean saponin Aa; d. LC-MS analysis of the intermediate product formation in the enzymatic reaction (deacetylated soybean saponin Aa as substrate). High-resolution mass spectrometry extracted ions, mass-to-charge ratio m / z 1311.6216 corresponds to monoacetylated soybean saponin Ab, mass-to-charge ratio m / z 1353.6321 corresponds to diacetylated soybean saponin Ab, mass-to-charge ratio m / z 1395.6427 corresponds to triacetylated soybean saponin Ab. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0051] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0052] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0053] Example 1. Obtaining GmSSAcT1 protein and its encoding gene

[0054] Using the cDNA of the seeds of soybean variety Williams 82 40 days after flowering as a template, PCR amplification was performed with primers GmSSAcT1F: 5'-ATGGCAGTGGAAAATATCAAAGTCCACGAAG-3'); GmSSAcT1R: 5'-TCACTCATCTTTCAGTCCTCCATGAAAAATAGT-3') to obtain a PCR product of about 1.5Kb (i.e., the coding region of the GmSSAcT1 gene). After sequencing, the PCR product was 1536bp, the coding sequence of the GmSSAcT1 gene was shown in the nucleotide sequence of SEQ ID No.2, the protein encoded by the gene was named GmSSAcT1, and the amino acid sequence of the encoded protein was shown in SEQ ID NO.1, and the protein contained 511 amino acids.

[0055] Study on the expression of GmSSAcT1 gene in different developmental stages and different tissues and organs of soybean: Materials of soybean at different developmental stages and different tissues and organs were taken from soybeans grown in a glass greenhouse. After the materials of the corresponding periods were collected, they were quickly frozen with liquid nitrogen and then stored at -80°C. RNA extraction process: First, use liquid nitrogen to pre-cool the mortar and pestle, pour the different materials into the pre-cooled mortar for grinding, take an appropriate amount of the ground material powder for RNA extraction, and refer to the Tiangen Plant RNA Extraction Kit (DP432) operating instructions for extraction. After the extraction, agarose gel electrophoresis was used to detect the integrity of the extracted RNA. The brightness ratio of the 28S rRNA and 18S rRNA bands was approximately 2:1, indicating that the extracted RNA was not degraded. NanoDrop 1000 was then used to detect the concentration and purity of the extracted RNA, OD 260 / OD 280 A ratio close to 2 indicates that the extracted RNA has good purity and is free of protein contamination. In this experiment, RNA that meets the above conditions is selected for the next step of reverse transcription. The reverse transcription step is performed according to the instructions of the Toyobo (FSQ-301) reverse transcription kit. The cDNA obtained by reverse transcription is used for the next step of fluorescent real-time quantitative PCR experiment.

[0056] The primers and internal reference gene primer information used in the experiment were (GmSSAcT1 RT-F: ATCATCAACACAATCACT; GmSSAcT1 RT-R: AATCACATTGGCATAGAA; TUB RT-F: TGGCCGTTACCTGACAGCAT; TUB RT-R: CTCGGAGGGATGTCACACAC).

[0057] Results Figure 1The GmSSAcT1 gene was highly expressed in seeds and roots at different developmental stages. Compared with the expression of the internal reference gene, the average expression levels in the roots at different developmental stages were 0.09, 0.05 and 0.12, and the average expression levels in the seeds at different developmental stages were 0.08, 0.15 and 0.24, respectively. With the continuous maturity of the seeds, the expression level of the GmSSAcT1 gene also increased. The expression levels in other tissues were relatively low.

[0058] Example 2: Obtaining GmSSAcT1-transfected recombinant strain

[0059] 1. Obtaining the recombinant plasmid pEASY-GmSSAcT1-His

[0060] (1) Total RNA was extracted from seeds of soybean cultivar Williams 82 40 days after flowering, and reverse transcribed to obtain cDNA. The cDNA was used as a template and PCR amplified using a primer pair consisting of GmSSAcT1 F and GmSSAcT1 R to obtain an amplified product (sequence SEQ ID NO. 2, containing the coding sequence (CDS) of GmSSAcT1), which was then excised and recovered.

[0061] GmSSAcT1 F:ATGGCAGTGGAAAATATCAAAGTCCACGAAG;

[0062] GmSSAcT1 R:CTCATCTTTCAGTCCTCCATGAAAAATAGT.

[0063] (2) The blunt-end product recovered in step (1) was connected to the backbone of the pEASY Blunt E2 vector (purchased from Quanshijin, item number CE211) to obtain a recombinant plasmid. According to the sequencing results, the structure of the correctly sequenced recombinant plasmid was described as follows: the DNA molecule shown in sequence 2 from the 1st to 1536th nucleotides at the 5' end was inserted into the open-circular cloning region of the pEASY Blunt E2 vector (according to the position mark in the vector manual, the insertion segment position is 5196-5238 bp), and this recombinant vector was named the recombinant vector pEASY-GmSSAcT1-His. pEASY-GmSSAcT1-His can express the GmSSAcT1-His fusion protein with a His tag, and the expected molecular weight is about 57.5KD).

[0064] 2. Obtaining the recombinant strain BL21-pEASY-GmSSAcT1-His

[0065] The recombinant plasmid pEASY-GmSSAcT1-His obtained in the above step 1 was introduced into Escherichia coli BL21 (DE3) to obtain the recombinant strain BL21-pEASY-GmSSAcT1-His.

[0066] The construction steps are as follows: first, extract the recombinant plasmid obtained in step 1, draw 100 ng of the recombinant plasmid and add it to 100 μl of BL21 (DE3) competent cells, gently pipette to mix, and place on ice for 20 minutes, then heat shock in a 42°C water bath for 90 seconds, quickly ice bath for 2 minutes, add 900 μl of LB culture medium to the clean bench and place it in a 37°C shaker for 1 hour, then centrifuge the bacterial solution at 6000g to discard the supernatant, re-add 100 μl of LB culture medium to resuspend the bacteria, evenly spread the resuspended bacteria on an LB plate with ampicillin resistance and culture at 37°C for 12 hours, pick the grown colonies for PCR identification, and if the electrophoresis results show a band of appropriate size, it proves that the recombinant strain has been successfully constructed.

[0067] 3. Preparation of soybean saponin A acetyltransferase GmSSAcT1 recombinant protein

[0068] 1) Inoculate the recombinant bacteria into LB liquid medium (containing 100 μg / mL ampicillin) and culture at 37°C with shaking (200 rpm) until the OD 600 =0.8, then IPTG was added (to make its final concentration in the culture system 0.2 g / L) and the culture conditions were changed to 16°C, 200 rpm shaking culture for 16 hours.

[0069] 2) Collect the culture system in step 1 and collect the bacteria by centrifugation.

[0070] 3) Ultrasonic disruption of the bacterial cells obtained in step 2) above, and affinity chromatography purification of the protein using Nickle-Argrose gel to obtain a GmSSAcT1-His protein solution (protein concentration of 1 μg / μL). The SDS-PAGE electrophoresis results of the GmSSAcT1-His protein solution are shown in Figure 2 A band with a size of approximately 57 KD was obtained between protein markers 55 and 70, which was consistent with the expected molecular weight of the GmSSAcT1-His fusion protein (57.5 kD).

[0071] 4. Determination of soybean saponin A acetyltransferase GmSSAcT1 protein activity

[0072] 1) Preparation of assay substrate

[0073] Soysaponin Aa (purchased from Shanghai Jizhi Biochemical Technology Co., Ltd., product number S60970-10 mg) and soybean saponin Ab (purchased from Shanghai Tongtian Biotechnology Co., Ltd., product number E-2399) were treated with alkaline hydrolysis in 500 mM NaOH solution (70% methanol / water) for 2 hours, and then formic acid solution (70% methanol / water) was added for neutralization. The neutralized solution contained deacetylated soybean saponin Aa or Ab.

[0074] The conversion rate was detected by LC-MS, and the detection conditions were as follows: the liquid chromatography model was Agilent 1290, and the mass spectrometry model was Agilent 6550QTOF. The chromatographic column was a C18 column (pore size 1.8 μm, length 2.1×100 mm); the mobile phase: phase A was water (containing 0.1% formic acid), and phase B was acetonitrile (containing 0.1% formic acid); the elution program was: 1:99 v / v (0 min), 1:99 v / v (0.1 min), 99.5:0.5 (15.5 min), 99.5:0.5 (17.0 min); the flow rate was 0.4 ml / min; the mobile phase temperature was 35°C. The capillary voltage was 4000 V; the carrier gas temperature was 225°C; the drying gas flow rate was 13 L / min; the sheath gas temperature was 350°C; and the sheath gas flow rate was 12 L / min. The injection volume was 1 μL, and data were acquired in positive ion mode (m / z 50–1700).

[0075] Depend on Figure 3 It can be seen that soybean saponins Aa and Ab can generate deacetylated soybean saponins Aa and Ab. After treatment with NaOH solution, acetylated soybean saponins Aa and Ab cannot be detected at all, while deacetylated soybean saponins can be detected. In this process, partially acetylated soybean saponins (including monoacetylated soybean saponin Aa, diacetylated soybean saponin Aa, monoacetylated soybean saponin Ab, diacetylated soybean saponin Ab, and triacetylated soybean saponin Ab) cannot be detected at all, indicating that the conversion rate of deacetylation of soybean saponins reaches 100%.

[0076] 2) Analysis of soybean saponin A acetyltransferase GmSSAcT1 protein activity

[0077] Soysaponin A acetyltransferase GmSSAcT1 enzymatic reaction system: The total reaction volume is 50 μL, including: 0.05 mol / L potassium phosphate (pH 7.5), 160 μM Acetyl-CoA, 20 μM deacetylated soybean saponin Aa or Ab and 1 μg of GmSSAcT1-His purified protein prepared in step 3, and water is added to make up to 50 μL.

[0078] After the enzymatic reaction was carried out at 28°C for 60 minutes, 50 μL of methanol was added to terminate the reaction. The product was detected by LC-qTOF-MS / MS. The LC-qTOF-MS / MS detection conditions were as follows: the liquid chromatography model was Agilent 1290, and the mass spectrometry model was Agilent 6550QTOF. The chromatographic column was a C18 column (pore size 1.8 μm, length 2.1×100 mm); the mobile phase was water (containing 0.1% formic acid) in phase A and acetonitrile (containing 0.1% formic acid) in phase B; the elution program was: 1:99 v / v (0 min), 1:99 v / v (0.1 min), 99.5:0.5 (15.5 min), 99.5:0.5 (17.0 min); the flow rate was 0.4 mL / min; and the mobile phase temperature was 35°C. Capillary voltage 4000V; carrier gas temperature, 225℃; drying gas flow rate, 13L / min; sheath gas temperature 350℃; sheath gas flow rate 12L / min. The injection volume was 1 μL, and data acquisition was performed in positive ion mode (m / z 50–1700).

[0079] The results were expressed as the mean ± standard deviation of three independent experiments.

[0080] The results are as follows Figure 4 As shown, GmSSAcT1-His protein can not only catalyze the deacetylated soybean saponin Aa or Ab to generate Aa or Ab, but also generate the intermediate monoacetylated, diacetylated or triacetylated Aa or Ab.

[0081] In the LC-MS analysis of the enzymatic reaction, deacetylated soybean saponin Aa was used as the substrate, and the formation of the final product soybean saponin Aa was as follows: high-resolution mass spectrometry extracted ions, mass-to-charge ratio m / z 1239.6004 corresponding to deacetylated soybean saponin Aa, mass-to-charge ratio m / z 1365.6297 corresponding to soybean saponin Aa ( Figure 4 (a)

[0082] In the LC-MS analysis of the enzymatic reaction, deacetylated soybean saponin Aa was used as the substrate, and the intermediate product generation was as follows: high-resolution mass spectrometry extracted ions, the mass-to-charge ratio m / z 1281.6110 corresponds to monoacetylated soybean saponin Aa, and the mass-to-charge ratio m / z 1323.6216 corresponds to diacetylated soybean saponin Aa ( Figure 4 (b)

[0083] In the LC-MS analysis of the enzymatic reaction, deacetylated soybean saponin Ab was used as the substrate, and the formation of the final product soybean saponin Aa was as follows: high-resolution mass spectrometry extracted ions, mass-to-charge ratio m / z 1269.6110 corresponds to deacetylated soybean saponin Ab, mass-to-charge ratio m / z 1437.6533 corresponds to soybean saponin Ab ( Figure 4 (c).

[0084] In the LC-MS analysis of the enzymatic reaction, deacetylated soybean saponin Ab was used as the substrate, and the intermediate products were generated as follows: high-resolution mass spectrometry extracted ions, the mass-to-charge ratio m / z 1311.6216 corresponds to monoacetylated soybean saponin Ab, the mass-to-charge ratio m / z 1353.6321 corresponds to diacetylated soybean saponin Ab, and the mass-to-charge ratio m / z 1395.6427 corresponds to triacetylated soybean saponin Ab ( Figure 4 (d)

[0085] The in vitro biochemical parameters of GmSSAcT1 protein were analyzed. GmSSAcT1 protein had a higher substrate affinity for deacetylated soybean saponin. Meanwhile, Kcat results also showed that GmSSAcT1 protein had a higher catalytic rate (Table 1).

[0086] Table 1 In vitro biochemical parameters of GmSSAcT1 protein

[0087] Substrate <![CDATA[Km(μM) 3 ]]> <![CDATA[Kcat(s -1 )]]> <![CDATA[Kcat / Km(s -1 μM -1 )]]> <![CDATA[Desacetylsoyasaponin Aa 1 > 24.87±3.14 107.47±9.73 4.34±0.19 Deacetylated soybean saponin Ab 48.4±5.98 371.05±32.21 7.7±0.32 <![CDATA[Acetyl coenzyme A 2 > 29.3±7.69 86.52±1.59 3.12±0.65

[0088] Note: 1: The reaction system contains 120 μM acetyl-CoA; 2: The reaction system contains 100 μM deacetylated soybean saponin Ab.

[0089] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of protein as soybean saponin A acetyltransferase; The soybean saponin A acetyltransferase catalyzes the deacetylated soybean saponin Aa of the substrate to generate soybean saponin Aa, monoacetylated soybean saponin Aa and / or diacetylated soybean saponin Aa; Or, the soybean saponin A acetyltransferase catalyzes the deacetylation of the substrate soybean saponin Ab to generate soybean saponin Ab, monoacetylated soybean saponin Ab, diacetylated soybean saponin Ab and / or triacetylated soybean saponin Ab; The protein is a protein whose amino acid sequence is SEQ ID No.1.

Images