Application of Wsb1 gene in the preparation of drugs for the prevention and treatment of adriamycin-induced cardiomyopathy

Abstract

The present invention provides the use of the Wsb1 gene in the preparation of a drug for preventing and treating adriamycin-induced cardiomyopathy, belonging to the field of biomedicine. This invention, for the first time, provides the use of the Wsb1 gene in the preparation of a drug for preventing and treating adriamycin-induced cardiomyopathy. The invention constructs a mouse model for adriamycin-induced cardiomyopathy and uses overexpression of the Wsb1 gene for functional verification, confirming that Wsb1 expression levels are decreased in the heart tissue of the adriamycin-induced cardiomyopathy model mice. Overexpression of Wsb1 improves cardiac function in the adriamycin-induced cardiomyopathy model mice and reduces myocardial cell apoptosis, cardiac tissue fibrosis, reactive oxygen species, and lipid peroxidation levels.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to the application of Wsb1 gene in the preparation of a drug for preventing and treating adriamycin cardiomyopathy. Background Art

[0002] Doxorubicin (DOX) is a highly effective, broad-spectrum anthracycline antitumor drug, but its cardiotoxicity limits its clinical application. Accumulation of doxorubicin can induce chemo-induced cardiomyopathy, characterized by activation of the myocardial oxidative system, myocardial cell apoptosis and necrosis, cardiac tissue fibrosis, and, in severe cases, heart failure. Currently, new, less toxic doxorubicin analogs have been synthesized, but their antitumor effects are inferior to those of doxorubicin. In addition, cardioprotectants and controlled-release doxorubicin agents that can be used in combination with doxorubicin are also under development, but their clinical efficacy still needs further verification. Therefore, exploring effective new methods for preventing and treating doxorubicin-induced cardiomyopathy is of great significance.

[0003] Wsb1 is a member of the SOCS box family of proteins. Its primary biological function is to degrade substrate proteins through the ubiquitin-proteasome pathway. Studies have shown that Wsb1 can promote the ubiquitination and degradation of DIO2 (thyroid-hormone-activating type 2 iodothyronine deiodinase) and HIPK2 (homeodomain-interaction protein kinase 2). Currently, research on the role of Wsb1 in cancer and other diseases is still in its infancy, and there are no reports on its role in the prevention and treatment of cardiovascular disease. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide a use of the Wsb1 gene in the preparation of a drug for preventing and treating adriamycin-induced cardiomyopathy.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides application of Wsb1 gene in preparing medicine for treating adriamycin-induced cardiomyopathy.

[0007] The present invention also provides the use of the Wsb1 gene in preparing a drug for preventing adriamycin-induced cardiomyopathy.

[0008] Preferably, the Wsb1 gene is overexpressed in the body.

[0009] Preferably, the overexpression includes introducing the Wsb1 gene into an organism using an overexpression system.

[0010] Preferably, the overexpression system comprises the AAV9 adeno-associated virus system.

[0011] Preferably, the AAV9 adeno-associated virus system includes the overexpression plasmid pHBAAV-cTNT-m-Wsb1-mCherry, the pAAV-RC plasmid and the pHelper plasmid.

[0012] Preferably, the Wsb1 gene exerts its effect by inhibiting adriamycin-induced cardiomyocyte apoptosis, cardiac tissue fibrosis or oxidative stress levels.

[0013] Preferably, the oxidative stress level includes reactive oxygen species or lipid peroxidation level.

[0014] The present invention also provides a drug for preventing and treating adriamycin-induced cardiomyopathy, wherein the active ingredient of the drug comprises AAV9-Wsb1 adeno-associated virus.

[0015] Preferably, the titer of the AAV9-Wsb1 adeno-associated virus is 1×10 13 μg / mL.

[0016] Beneficial effects of the present invention:

[0017] The present invention constructed an adriamycin cardiomyopathy mouse model and used overexpression of the Wsb1 gene for functional verification, confirming that the expression level of Wsb1 in the heart tissue of the adriamycin cardiomyopathy model mouse was decreased; Wsb1 overexpression can improve the cardiac function of the adriamycin cardiomyopathy model mouse model and reduce the level of myocardial cell apoptosis, cardiac tissue fibrosis, reactive oxygen species and lipid peroxidation in the adriamycin cardiomyopathy model mouse model. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In the following figures, * indicates p<0.05; ** indicates p<0.01; *** indicates p<0.001:

[0019] Figure 1 The molecular cloning information of the AAV9-Wsb1 adeno-associated virus packaging is shown in Figure 1. A is the map of the constructed Wsb1 overexpression plasmid pHBAAV-cTNT-m-Wsb1-mCherry. B is the sequencing alignment result of the target fragment of the constructed Wsb1 overexpression plasmid.

[0020] Figure 2 The results of real-time fluorescence quantitative PCR are shown; A shows the statistical results of changes in Wsb1 gene expression in the heart tissue of mice with adriamycin-induced cardiomyopathy; B shows the statistical results of changes in Wsb1 gene expression in the heart tissue of mice injected with AAV9-Wsb1 adeno-associated virus through the tail vein and then treated with adriamycin;

[0021] Figure 3Figure 1 is the cardiac ultrasound test result of mice; A is a representative cardiac ultrasound image of mice injected with AAV9-Wsb1 adeno-associated virus via the tail vein and then treated with doxorubicin; B is the statistical result of ejection fraction (EF) of mouse cardiac ultrasound; C is the statistical result of fractional shortening (FS) of mouse cardiac ultrasound;

[0022] Figure 4 Figure 3 is the result of TUNEL staining of cardiac tissue; A is a representative image of the apoptosis level of myocardial cells in mice injected with AAV9-Wsb1 overexpressing adeno-associated virus through the tail vein and then treated with doxorubicin; B is the statistical result of the apoptosis level of myocardial cells in mice;

[0023] Figure 5 The results of Masson staining of heart tissue; A is a representative image of the cardiac fibrosis level in mice injected with AAV9-Wsb1 adeno-associated virus through the tail vein and then treated with doxorubicin; B is the statistical results of the cardiac fibrosis level in mice;

[0024] Figure 6 Figure 3 is the result of DHE staining of heart tissue; A is a representative graph of the reactive oxygen species level in myocardial cells of mice injected with AAV9-Wsb1 adeno-associated virus through the tail vein and then treated with doxorubicin; B is the statistical result of the reactive oxygen species level in myocardial cells of mice;

[0025] Figure 7 The results of 4-HNE staining of heart tissue; A is a representative graph of lipid peroxidation levels in myocardial cells of mice injected with AAV9-Wsb1 adeno-associated virus through the tail vein and then treated with doxorubicin; B is the statistical result of lipid peroxidation levels in mouse myocardial cells. DETAILED DESCRIPTION

[0026] The present invention provides the use of Wsb1 gene in preparing a drug for treating or preventing adriamycin-induced cardiomyopathy.

[0027] In the present invention, the specific sequence of the Wsb1 gene can be found in NCBI Reference Sequence: NM_019653.3. The present invention has no special restrictions on the specific source of the Wsb1 gene, and it can be obtained by chemical synthesis or microbial metabolism. In the present invention, the Wsb1 gene is overexpressed in the body, so as to play a role in preventing and treating doxorubicin cardiomyopathy. The overexpression preferably includes introducing the Wsb1 gene into the body using an overexpression system. The overexpression system preferably includes the AAV9 adeno-associated virus system. The AAV9 adeno-associated virus system preferably includes the overexpression plasmid pHBAAV-cTNT-m-Wsb1-mCherry, the pAAV-RC plasmid and the pHelper plasmid, and the above three plasmids constitute a three-plasmid adeno-associated virus vector. The present invention has no special restrictions on the specific sources of the above-mentioned plasmids.

[0028] In the present invention, the Wsb1 gene can improve cardiac function in patients with adriamycin-induced cardiomyopathy, preferably by inhibiting adriamycin-induced myocardial cell apoptosis, cardiac tissue fibrosis or oxidative stress levels, wherein the oxidative stress levels preferably include reactive oxygen species or lipid peroxidation levels.

[0029] The present invention also provides a drug for preventing and treating adriamycin-induced cardiomyopathy, wherein the active ingredient of the drug comprises AAV9-Wsb1 adeno-associated virus.

[0030] In the present invention, the AAV9-Wsb1 is preferably constructed by the following steps: first constructing a Wsb1 overexpression plasmid, and then using an adeno-associated virus system for virus packaging to obtain an AAV9-Wsb1 adeno-associated virus. In the present invention, the Wsb1 overexpression plasmid is preferably pHBAAV-cTNT-mCherry, and the titer of the AAV9-Wsb1 adeno-associated virus is preferably 1×10 13 μg / mL.

[0031] In the present invention, the drug preferably further comprises a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient is preferably selected from one or more of a diluent, a buffer, a suspension, an emulsion, a granule, an encapsulation agent, an excipient, a filler, an adhesive, a spray, a transdermal absorbent, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, a colorant, a flavoring agent, and an adsorption carrier. The dosage form of the drug of the present invention preferably includes tablets, powders, granules, capsules, decoctions, oral solutions, injections, or suppositories.

[0032] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0033] In the following examples, unless otherwise specified, all methods are conventional.

[0034] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0035] Example 1

[0036] 1. Construction of mouse Wsb1 overexpression plasmid pHBAAV-cTNT-m-Wsb1-mCherry

[0037] The target fragment sequence of the Wsb1 overexpression plasmid of the present invention is derived from Mus musculus WD repeat and SOCS box-containing 1 (Wsb1), transcript variant 1, mRNA (NCBI Reference Sequence: NM_019653.3); the primers designed are: AAV-m-Wsb1-KF: ctccgtgggacgatccccgaggtaccgccaccatggccagct (SEQ ID NO. 1) and AAV-m-Wsb1-KR: ctcgcccttgctcaccatggtggcagggccgggattctcctccac (SEQ ID NO. 2). The pHBAAV-cTNT-mCherry vector was digested with the restriction endonuclease KpnI and ligated with the fragment of the protein coding region (CDS) of the Wsb1 gene. Competent transformation was then performed, and single clones were selected for sequencing. Plasmids were extracted from clones with correct sequencing to obtain the pHBAAV-cTNT-m-Wsb1-mCherry plasmid. Figure 1 As shown in A. The sequencing results of the target fragment of the Wsb1 overexpression plasmid are shown in Figure 1 As shown in B, the Query is the target fragment sequence of this project, the Subject is the CDS sequence of Mus musculus WD repeat and SOCS box-containing 1 (Wsb1), transcript variant 1, mRNA (NCBI Reference Sequence: NM_019653.3), and the sequencing result is consistent with the target sequence.

[0038] 2. Packaging and detection of AAV9-Wsb1 mouse adeno-associated virus

[0039] The overexpression plasmid pHBAAV-cTNT-m-Wsb1-mCherry constructed above was combined with the pAAV-RC plasmid and the pHelper plasmid to form a three-plasmid adeno-associated virus system. The three plasmids were co-transfected into 293T cells for virus packaging. 72 hours after co-transfection, the cell pellet was collected and purified to obtain a high-titer adeno-associated virus stock solution, which was then titered. The virus titer was 1.4×10 13 μg / mL, HBAAV2 / 9-cTNT-mcherry overexpression control 1.3×10 13 μg / mL.

[0040] Example 2

[0041] 1. Tail vein injection of virus

[0042] The mice were divided into 4 groups, namely AAV9-Empty+Control, AAV9-Wsb1+Control, AAV9-Empty+DOX, and AAV9-Wsb1+DOX. The AAV9-Wsb1 adeno-associated virus obtained in Example 1 and the control virus were administered to each mouse at a dose of 5×10 11 The four groups of mice were treated in accordance with the single factor control principle.

[0043] 2. Construction of Adriamycin-induced Cardiomyopathy Model in Mice

[0044] Following the groupings defined in Step 1, mice were intraperitoneally injected with doxorubicin or a control solvent (PBS) once weekly for four weeks at a concentration of 5 mg / kg / week, for a cumulative dose of 20 mg / kg. Following successful establishment of the doxorubicin-induced cardiomyopathy model in mice, cardiac tissue was sampled and preserved.

[0045] Example 3

[0046] Real-time fluorescence quantitative PCR

[0047] The first step is to extract total RNA from mouse heart tissue. A small amount of mouse heart tissue was cut and placed in an enzyme-free centrifuge tube containing 1ml Trizol lysis solution and steel balls, and the tissue was fully lysed with a tissue disruptor. Remove the steel balls, add 200μl of chloroform to each centrifuge tube, mix thoroughly and let it stand at room temperature until obvious stratification appears. Then centrifuge at 12000rpm for 20 minutes at 4°C, transfer the upper liquid to a new enzyme-free centrifuge tube, add an equal volume of isopropanol, mix well and let it stand for 10 minutes. Then centrifuge at 12000rpm at 4°C for 20 minutes, and a white RNA precipitate will appear at the bottom of the tube. Aspirate the supernatant, add 1ml of 75% ethanol, and centrifuge at 12000rpm at 4°C for 5 minutes. Finally, aspirate the supernatant again and dry at room temperature. Add 25μl of DEPC water to each tube to fully dissolve the RNA precipitate, and use Nano Drop to determine the RNA concentration. The second step is to use a two-step reverse transcription kit (TaKaRa, PrimeScript TM First Strand cDNA Synthesis Kit) was used to reverse transcribe RNA into cDNA according to the instructions. Third, SYBR Green kit (BIO-RAD, iTaq TM Universal Real-time fluorescence quantitative PCR reaction was performed using PCR amplification with 5% paraformaldehyde and 1% paraformaldehyde Green Supermix. The primer sequences used were mmu-Wsb1-F: ACGAGAAAGAGATCGTGAGATCA (SEQ ID NO. 3) and mmu-Wsb1-R: AGCAAAAGCAACCGTCCAGTT (SEQ ID NO. 4). The gene expression changes of the target molecule were calculated based on the Ct values of the samples to be tested.

[0048] The results are as follows Figure 2 As shown by Figure 2 A shows that the expression level of Wsb1 is reduced in the heart tissue of mice in the adriamycin model. Figure 2 B shows that the expression level of Wsb1 increased after tail vein injection of Wsb1-overexpressing adeno-associated virus.

[0049] Example 4

[0050] Example 2: Cardiac ultrasound of mouse model constructed

[0051] The four groups of mice constructed in Example 2 were subjected to the following procedures: First, the hair on the chest and abdomen of the mice was removed with a depilatory cream, exposing the skin of the chest and abdomen. The mice were then anesthetized with 3% isoflurane gas. The anesthetized mice were placed on an echocardiogram table with their abdomens facing upwards. The limbs were secured with medical tape, and 1.0-1.5% isoflurane was continuously introduced. A coupling agent was applied to the chest cavity of the mice, and a probe was placed. When the heart rate of the mice gradually stabilized and reached 450-500 beats / minute, the heart rate was recorded. A small animal ultrasound imaging system (Visual Sonics Vevo 2100) with a frequency of 30 MHz was used to test the cardiac function of the mice.

[0052] B-mode echocardiograms were obtained at the long and short axes of the left ventricle, and M-mode echocardiograms were obtained at the maximum left ventricular diameter. Left ventricular ejection fraction (EF) and left ventricular shortening (FS) were measured using LV wall trace. Three measurements were performed per mouse, and the mean value was calculated.

[0053] The results are shown in Figure 3 ,Depend on Figure 3 It can be seen that Wsb1 overexpression adeno-associated virus can improve the cardiac function of mice with adriamycin cardiomyopathy.

[0054] Example 5

[0055] Histopathological examination of the mouse model constructed in Example 2

[0056] The four groups of mice constructed in Example 2 were subjected to the following operations:

[0057] TUNEL staining of mouse heart tissue, indicating apoptosis level:

[0058] First, the frozen sections were rewarmed at room temperature for 15 minutes and washed three times with 1× PBS for 5 minutes each time. The 1× PBS on the slide was wiped dry, and a circle was drawn around the tissue with a tissue pen to surround the tissue. The slide was placed in a humidified chamber, and an appropriate amount of 4% PFA was added to the tissue for fixation for 1 minute. After fixation, it was washed with 1× PBS. Next, after the slide was wiped dry, proteinase K was added to the tissue, and the membrane was broken in a humidified chamber for 20 minutes. After washing with 1× PBS, it was fixed with 4% PFA, and then washed with PBS, and then equilibrated with equilibration solution at room temperature for 10 minutes. Next, TUNEL staining was performed using a cell apoptosis detection kit (Vazyme, TUNEL BrightGreen Apoptosis Detection Kit). The sections were then washed with 1× PBS and blocked with 5% BSA in the dark for 1 hour. The primary antibody, α-actinin, was added at a 1:200 dilution and incubated overnight at 4°C. After washing with 1× PBS, the sections were incubated with the secondary antibody, CY3 antimouse, at a 1:200 dilution at room temperature in the dark for 2 hours. After washing with 1× PBS, the sections were stained with Hoechst stain at a 1:2000 dilution for 20 minutes at room temperature in the dark. The sections were then washed with 1× PBS, dried, and mounted with mounting solution. The sections were observed and images were collected under a microscope and analyzed using ImageJ software.

[0059] Test results see Figure 4 ,Depend on Figure 4 It can be seen that Wsb1 can reduce the level of cardiomyocyte apoptosis in the myocardial tissue of doxorubicin-induced cardiomyopathy model mice.

[0060] Masson staining of mouse heart tissue to indicate the degree of fibrosis:

[0061] The mouse heart samples were made into paraffin sections with a thickness of 5 μm. The paraffin sections were dewaxed and hydrated. The heart paraffin sections were stained using the Masson Tricolor Staining Solution (Servicebio, G1006 MassonTricolor Staining SolutionTrichrome Lab Stain Reagent). The process is as follows: soak in potassium dichromate for 12 hours and then rinse with running water for 20 minutes, stain with hematoxylin for 5 minutes and then rinse with running water for 3 seconds, stain with Ponceau red solution for 5 minutes and then rinse with running water for 3 seconds, stain with phosphomolybdic acid solution for 2 minutes, and stain with aniline blue solution for 30 seconds and then rinse with running water for 3 seconds. After the sections are dried, they are sealed with neutral gum. Observe and collect pictures under a microscope and analyze them with ImageJ software. For test results, see Figure 5 ,Depend on Figure 5 It can be seen that Wsb1 can reduce cardiac fibrosis in doxorubicin cardiomyopathy model mice.

[0062] DHE staining of mouse heart tissue, indicating the content of reactive oxygen species:

[0063] Mouse heart samples were made into frozen sections with a thickness of 5 μm. The frozen sections of the heart were rewarmed at room temperature for 20 minutes and washed three times with PBS buffer. DHE staining kit (Abcam, Dihydroethidium Assay Kit-Reactive Oxygen Species) was used for staining. DHE dye solution (30 μM) was added to the heart tissue under light-proof conditions, incubated at room temperature for 30 minutes, and then washed three times with 1× PBS buffer. Finally, the sections were sealed with 50% glycerol under light-proof conditions. The images were observed and collected under a microscope, and the reactive oxygen species in the heart tissue were quantified using ImageJ software. The test results can be found in Figure 6 ,Depend on Figure 6 It can be seen that Wsb1 can reduce the level of reactive oxygen species in the heart tissue of doxorubicin cardiomyopathy model mice.

[0064] 4-HNE staining of mouse heart tissue, indicating the level of lipid peroxidation product 4-HNE:

[0065] Mouse heart samples were prepared into paraffin sections with a thickness of 5 μm. The paraffin sections were dewaxed and hydrated. The sections were soaked in 0.3% H2O2 solution for 30 minutes to block endogenous peroxidase activity and washed three times with 0.05% PBST for 5 minutes each. The slides were then placed in sodium citrate dihydrate solution (pH = 6.0) and heated in a microwave for approximately 40 minutes for antigen retrieval. After cooling to room temperature, the sections were blocked with 2% BSA for 90 minutes. The primary antibody 4-HNE (abcam, catalog number ab48506) was diluted 1:100 with 1% BSA and applied dropwise to the tissues for incubation overnight at 4°C. The next day, the sections were washed three times with 0.05% PBST and then incubated with enhancement solution (one drop per 100 μl) at room temperature in the dark for 20 minutes. Then wash three times with 0.05% PBST, add secondary antibody (one drop per 100 μl) and incubate in the dark at room temperature for 15 minutes. After washing three times with 0.05% PBST, use DAB colorimetric solution for 70 seconds and terminate the color development with grade 3 pure water. Finally, use hematoxylin staining solution to stain the nucleus for 15 seconds, 0.2% glacial acetic acid staining for 10 seconds, and perform reverse gradient dehydration. After the slices are dried, use neutral gum to seal the slices. Observe and collect pictures under a microscope, and use ImageJ software to quantify lipid peroxides in heart tissue. For test results, see Figure 7 ,Depend on Figure 7 It can be seen that Wsb1 can reduce the level of lipid peroxidation in the heart tissue of doxorubicin cardiomyopathy model mice.

[0066] As demonstrated in the above examples, the Wsb1 gene of the present invention has an ameliorative effect on the doxorubicin-induced cardiomyopathy model in mice. Cardiac ultrasound testing and histological staining to examine levels of cardiomyocyte apoptosis, cardiac fibrosis, and levels of reactive oxygen species and lipid peroxidation in cardiac tissue in mice revealed that Wsb1 can improve doxorubicin-induced cardiomyopathy. Therefore, Wsb1 can be used as a preventive and therapeutic agent for doxorubicin-induced cardiomyopathy and its complications.

[0067] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of the Wsb1 gene in the preparation of a drug for treating adriamycin-induced cardiomyopathy, characterized in that: The Wsb1 gene is overexpressed in the body.

2. Use of the Wsb1 gene in the preparation of a drug for preventing adriamycin-induced cardiomyopathy, characterized in that: The Wsb1 gene is overexpressed in the body.

3. The use according to claim 1 or 2, characterized in that The overexpression includes introducing the Wsb1 gene into an organism using an overexpression system.

4. The use according to claim 3, characterized in that The overexpression system includes the AAV9 adeno-associated virus system.

5. The use according to claim 4, characterized in that The AAV9 adeno-associated virus system includes an overexpression plasmid pHBAAV-cTNT-m-Wsb1-mCherry, a pAAV-RC plasmid and a pHelper plasmid.

6. The use according to claim 1, 2, 4 or 5, characterized in that The Wsb1 gene exerts its effect by inhibiting adriamycin-induced myocardial cell apoptosis, cardiac tissue fibrosis or oxidative stress level.

7. The use according to claim 6, characterized in that The oxidative stress level includes reactive oxygen species or lipid peroxidation levels.

Images