An oncolytic adenovirus carrying shTRIM35 and its application in anti-tumor

Abstract

The present invention discloses an oncolytic adenovirus carrying shTRIM35 and its application in anti-tumor. The genome of the oncolytic adenovirus carrying shTRIM35 is integrated with a coding sequence of an exogenous shRNA capable of inhibiting the expression of TRIM35 in tumor cells. In vitro and in vivo experiments have shown that the oncolytic adenovirus carrying shTRIM35 has the effect of highly efficiently inhibiting and killing tumors, and has great prospect and value for being developed into an anti-tumor drug.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an oncolytic adenovirus carrying shTRIM35 and an application thereof in anti-tumor. Background Art

[0002] Cancer has become one of the major public health issues that seriously threatens human health worldwide. Surgery is the most effective treatment for early-stage cancer, but it does not significantly improve the survival of most patients with advanced tumors and metastasis. Although radiotherapy, chemotherapy and other adjuvant therapies can inhibit tumor progression to a certain extent, they do not significantly improve the overall survival rate of cancer patients. Therefore, finding new, safe and effective therapeutic drugs is a hot topic in the field of anti-tumor treatment today. In recent years, cancer immunotherapy has attracted much attention due to its significant efficacy. Cancer immunotherapy is a treatment method that activates the body's immune system to kill and monitor cancer cells by activating and / or regulating immune-related pathways. Oncolytic virus (OV) is a rising star in the field of tumor immunotherapy. With the approval of the oncolytic virus product Imlygic (T-Vec) by the FDA in 2015, oncolytic virus-mediated anti-tumor immunotherapy has received more and more attention.

[0003] Oncolytic viruses are a type of genetically engineered viruses that can replicate specifically in tumor cells without affecting the homeostasis of normal tissue survival. They are another anti-tumor biological therapy after immune checkpoint inhibitors. Oncolytic viruses constructed with viruses such as vaccinia virus, coxsackie virus, adenovirus, reovirus, herpes simplex virus and measles virus as vectors are undergoing extensive preclinical and clinical trials. Among them, adenovirus vectors are one of the most promising vaccine vectors. They have the advantages of high expression, simultaneous induction of specific humoral immunity and cellular immune response, good safety, easy preparation, and no need for adjuvants. They are widely used in the development of various preventive or therapeutic vaccines, such as Ebola vaccine, Zika vaccine, HIV vaccine, influenza vaccine, malaria vaccine, new coronavirus vaccine, etc. At the same time, in the field of tumor gene therapy, adenovirus is also commonly used in gene therapy and oncolytic vaccine construction. Oncolytic adenovirus (OAV) has become one of the most promising anti-tumor immunotherapies.

[0004] Oncolytic adenoviruses can specifically replicate and lyse tumor cells, then release progeny viruses, infect surrounding tumor cells, and ultimately eliminate the tumor through a cascade amplification effect. However, the related oncolytic adenoviruses reported in the field currently have problems such as weak tumor killing effect and low efficacy, which are difficult to meet the actual clinical needs. Therefore, there is still an urgent need to improve the anti-tumor efficacy of oncolytic adenoviruses in the field of tumor immunotherapy. Summary of the invention

[0005] In order to solve the problems existing in the above-mentioned prior art, the object of the present invention is to provide an oncolytic adenovirus carrying shTRIM35 and its application in anti-tumor.

[0006] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0007] A first aspect of the present invention provides an oncolytic adenovirus carrying shTRIM35.

[0008] Furthermore, the oncolytic adenovirus contains a coding sequence of an exogenous shRNA that inhibits the expression of TRIM35.

[0009] Furthermore, the coding sequence of the exogenous shRNA that inhibits the expression of TRIM35 is shown in SEQ ID NO:1.

[0010] Furthermore, the oncolytic adenovirus may operably comprise the following genes connected in sequence: Ki67 promoter, coding sequence of E1A gene, U6 promoter, coding sequence of exogenous shRNA that inhibits TRIM35 expression, and polyA sequence of SV40.

[0011] In the present invention, the genome of the adenovirus is a linear double-stranded DNA, with an inverted terminal repeat (ITR) of 100-600 bp at each end, and the inner side thereof contains the E1-E4 genes related to the early replication of the adenovirus, and the L1-L5 genes related to the late expression structure. Among them, the E1 region and the E3 region are related to the replication characteristics and immune escape function of the virus, and are regions that are often used for knockout and transformation. The E1 region is divided into E1A and E1B. E1A is mainly composed of 289R and 243R, which mainly regulates the metabolic function of cells and makes cells more susceptible. The E1B 55K gene product can interact with the p53 protein in the cell, causing it to lose its function, thereby preventing the host cell division cessation or cell apoptosis induced by the p53 gene expression product. In addition, the E1B 55K gene product is also related to viral replication, transcription of late viral mRNA, and transport of viral RNA. The main function of the gene expression products in the E3 region is to destroy the immune defense mechanism and has nothing to do with the replication of the viral genome. The gp19K protein can bind to the heavy chain of the major histocompatibility complex (MHC) class I molecule on the endoplasmic reticulum to prevent its transport to the cell surface and delay the expression of MHC I, thereby destroying the immune defense mechanism of the infected cells, causing the virus to replicate in large quantities and eventually lyse the cells.

[0012] In the present invention, the Ki67 promoter is used to start regulating the expression of E1A, which is an essential gene for adenovirus replication; the U6 promoter is used to start regulating the expression of exogenous shRNA (shTRIM35) that inhibits TRIM35 expression; and the polyA is SV 40 polyA derived from the virus.

[0013] In a specific embodiment of the present invention, the present invention constructs for the first time an oncolytic adenovirus carrying shTRIM35 as described above, and proves through in vitro and in vivo experiments that the oncolytic effect of the oncolytic adenovirus carrying shTRIM35 is significantly enhanced, and the replication ability in tumor tissue is also significantly enhanced, and it has a significantly better anti-tumor effect.

[0014] In some embodiments, the oncolytic adenovirus carrying shTRIM35 described in the present invention can also be used in combination with other therapeutic agents that can be used for the treatment and / or adjuvant treatment of tumors, including but not limited to: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, chromatin function inhibitors, anti-angiogenic agents, antiestrogens, antiandrogens, immunomodulators, various types of therapeutic antibody drugs, various types of CAR-T drugs, various types of anti-tumor radioactive isotopes, various types of immune checkpoint inhibitors, various types of immune activators, and various types of cytokines.

[0015] Further, the alkylating agent includes but is not limited to: bischloroethyl methylamine, chlorambucil, phenylalanine nitrogen mustard, propranolol, phenyl mustard, estramustine, cyclophosphamide, hexamethylmelamine, ifosfamide, fortepdin, triamine, carmustine, streptozotocin, improsulfan, dacarbazine, cisplatin, oxaliplatin, and carboplatin.

[0016] Furthermore, the antimetabolites include but are not limited to methotrexate, 5-fluorouracil, fluorouracil, 5-fluorodeoxyuracil, capecitabine, cytarabine, fludarabine, 6-mercaptopurine, 2-chlorodeoxyadenosine, 5-azacytidine, 2,2-difluorodeoxycytidine, cladribine, deoxycoformycin, and pentostatin.

[0017] Furthermore, the anti-tumor antibiotics include but are not limited to: daunorubicin, doxorubicin, idarubicin, mithramycin, mitomycin C, valrubicin, mitoxantrone hydrochloride, bleomycin, dactinomycin, mithramycin, and procarbazine.

[0018] Furthermore, the mitotic inhibitors include, but are not limited to, docetaxel, vinblastine, paclitaxel, vincristine, vinblastine, and vinorelbine.

[0019] Furthermore, the chromatin function inhibitor includes, but is not limited to, irinotecan, etoposide, topotecan, etoposide phosphate, and teniposide.

[0020] Further, the anti-angiogenic agents include but are not limited to: prinomastat, tanomastat, ilomastat, aprotinin, marimastat, batimastat, CGS-27023A, bromochloropiperaquinone, COL-3, neovastat, BMS-275291, and thalidomide.

[0021] Furthermore, the antiestrogens include but are not limited to toremifene, raloxifene, tamoxifen, anastrozole, letrozole, droloxifene, odoxifene, and exemestane.

[0022] Furthermore, the anti-androgen includes but is not limited to: nilutamide, bicalutamide, spironolactone, flutamide, finasteride, cyproterone acetate, and cimetidine.

[0023] Furthermore, the immunomodulators include but are not limited to interleukins, tumor necrosis factors, interferons, mushroom polysaccharides, cisozin, roquine, pidomod, methoxypolyethylene glycol succinamide adenosine deaminase, and thymosin preparations.

[0024] In addition, the present invention also provides a method for preparing the oncolytic adenovirus according to the first aspect of the present invention, the method comprising the following steps:

[0025] U6 promoter-driven TRIM35 shRNA was synthesized and cloned into adenovirus shuttle plasmid pZD55. pZD55-TRIM35 shRNA and adenovirus backbone plasmid pBHGE3 were co-transfected into HEK293 cells. The packaged viruses were collected after about 7-10 days. The packaged adenovirus Ad5-ZD55-TRIM35 shRNA was amplified in HEK293 cells and the viruses were collected.

[0026] Furthermore, the sequence of the TRIM35 shRNA is shown in SEQ ID NO:1, the sequence of the U6 promoter is shown in SEQ ID NO:2, and the sequence of the adenovirus backbone is shown in SEQ ID NO:3.

[0027] The second aspect of the present invention provides an anti-tumor pharmaceutical composition.

[0028] Furthermore, the pharmaceutical composition comprises an effective amount of the oncolytic adenovirus described in the first aspect of the present invention.

[0029] Furthermore, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0030] In the present invention, the effective amount refers to a therapeutically effective amount, and the effective amount used herein refers to the amount of the pharmaceutical composition sufficient to treat a specified disorder, condition or disease (e.g., improve, alleviate, weaken and / or delay one or more of its symptoms). With reference to cancer, the effective amount includes an amount sufficient to shrink a tumor and / or reduce the growth rate of the tumor (e.g., suppress tumor growth) or prevent or delay other undesirable cell proliferation. In some embodiments, the effective amount is an amount sufficient to delay the development of the disease. In some embodiments, the effective amount is an amount sufficient to prevent or delay the recurrence of the disease. The effective dose can be administered in one or more administrations. The effective amount of the pharmaceutical composition can: (i) reduce the number of cancer cells; (ii) reduce tumor size; (iii) inhibit, delay, slow down to a certain extent and preferably stop cancer cells from infiltrating into peripheral organs; (iv) inhibit (i.e., slow down to a certain extent and preferably stop) tumor metastasis; (v) inhibit tumor growth; (vi) prevent or delay the occurrence and / or recurrence of tumors; and / or (vii) alleviate one or more symptoms associated with cancer to a certain extent. The pharmaceutically effective therapeutic amount depends on many factors, including but not limited to: the characteristics of the subject (subject) (such as height, weight, gender, age and medication history), the severity of the disease, etc.

[0031] In the present invention, the pharmaceutically acceptable carriers and / or excipients are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995). These substances are used to help the stability of the formulation or to help improve its activity or biological effectiveness as needed. The pharmaceutically acceptable carriers and / or excipients include, but are not limited to: buffers, such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates, such as glucose, mannose, sucrose or dextran, mannitol; proteins; polypeptides or amino acids, such as glycine; antioxidants; chelating agents, such as EDTA or glutathione; adjuvants (such as aluminum hydroxide); preservatives; and any other pharmaceutically or physiologically acceptable carriers, diluents or excipients reported in any prior art that can be used in pharmaceutical compositions.

[0032] In some embodiments, the pharmaceutically acceptable carrier and / or excipient includes any suitable pharmaceutically acceptable carrier, diluent, filler, binder and other excipient known to those skilled in the art, which depends on the administration method and the designed dosage form of the pharmaceutical composition. The pharmaceutical composition is any pharmaceutically acceptable dosage form, including but not limited to: at least one of injection, suspension, solution, powder and aerosol.

[0033] In some embodiments, the suitable dosage of the pharmaceutical composition can be prescribed in a variety of ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, morbidity, diet, administration time, administration route, excretion rate and reaction sensitivity. A skilled physician can usually easily determine the prescription and the dosage that is effective for the desired treatment.

[0034] In some embodiments, the pharmaceutical composition can be administered by any of a variety of suitable methods and delivery systems known in the art, such as by bolus infusion, by injection such as intravenous or subcutaneous injection. In other embodiments, the pharmaceutical composition can be administered parenterally, intrapulmonary and intranasally, and (if necessary for local treatment) intralesional administration. Parenteral infusion includes intramuscular, intravenous, intraarterial, intraperitoneal or subcutaneous administration.

[0035] In some embodiments, the pharmaceutical composition can be administered as part of a combination therapy, such as simultaneously or sequentially in any order with another or additional therapeutic intervention (such as an antibody or engineered cell or agent, such as a cytotoxic agent or therapeutic agent). In other embodiments, the pharmaceutical composition is co-administered with one or more additional therapeutic agents or administered in combination with another therapeutic intervention (simultaneously or sequentially in any order). In other embodiments, the additional therapeutic agent is any intervention preparation or agent known to those skilled in the art that can be used for tumor intervention therapy in the prior art, and in other embodiments, the pharmaceutical composition is administered before the one or more additional therapeutic agents. In other embodiments, the pharmaceutical composition is administered after the one or more additional therapeutic agents. In other embodiments, the administration method includes the combined administration of a chemotherapeutic agent. In other embodiments, the administration method includes administering a chemotherapeutic agent (e.g., a conditioning chemotherapeutic agent) before administering the pharmaceutical composition, for example to reduce tumor burden. In other embodiments, pre-conditioning a subject with immunoremoval (e.g., lymphocyte removal) therapy can improve the therapeutic effect of a tumor.

[0036] The third aspect of the present invention provides the use of an agent that inhibits the expression of TRIM35 in the preparation of a product that enhances the anti-tumor effect of an oncolytic adenovirus.

[0037] Further, the reagent for inhibiting TRIM35 expression includes:

[0038] (1) shRNA targeting TRIM35 gene;

[0039] (2) siRNA targeting the TRIM35 gene;

[0040] (3) agents that inhibit the transcriptional activity of the TRIM35 gene;

[0041] (4) agents that inhibit TRIM35 mRNA transcription levels;

[0042] (5) agents that promote TRIM35 mRNA degradation;

[0043] (6) agents that inhibit TRIM35 mRNA translation;

[0044] (7) an agent that specifically recognizes the guide nucleic acid of the TRIM35 gene and cleaves it to reduce the expression level of TRIM35;

[0045] (8) Reagents for partial or complete knockout of the TRIM35 gene.

[0046] Furthermore, the reagent for inhibiting TRIM35 expression is shRNA targeting the TRIM35 gene.

[0047] Furthermore, the coding sequence of the shRNA is shown in SEQ ID NO:1.

[0048] In some embodiments, the reagents for inhibiting TRIM35 expression of the present invention include but are not limited to: inhibiting the expression of the gene encoding the TRIM35 protein or reducing the expression level of the gene, reducing the activity of the TRIM35 protein, for example, inhibiting the expression of the TRIM35 gene or reducing its expression level, these reagents include but are not limited to: reagents for inhibiting the transcriptional activity of the TRIM35 gene, reagents for inhibiting the transcriptional level of TRIM35 mRNA, reagents for promoting the degradation of TRIM35 mRNA, siRNA for the TRIM35 gene, shRNA for the TRIM35 gene, reagents for inhibiting the translation of TRIM35 mRNA, and reagents for specifically recognizing the guide nucleic acid of the TRIM35 gene and cutting it to reduce its expression level. In other embodiments, the TRIM35 whole gene can be knocked out by administering a targeting vector, thereby achieving the inhibition or reduction of TRIM35 gene expression. In other embodiments, the reagent for reducing the activity of the TRIM35 protein can be, for example, a specific antibody for TRIM35 or a small molecule compound having the ability to inhibit the activity of the TRIM35 protein. In a specific embodiment of the present invention, the reagent for inhibiting the expression of TRIM35 is an shRNA whose coding sequence is shown in SEQ ID NO: 1.

[0049] In some embodiments, the activity of TRIM35 protein can also be reduced by introducing mutations in the TRIM35 protein. In other embodiments, a mutation that causes the corresponding activity to be weakened or lost is introduced into the functional domain of the TRIM35 protein. The mutation can be the insertion, deletion or substitution of one or more (e.g., more than 10, more than 20, more than 30) amino acids. By administering an agent that acts on the TRIM35 gene, a mutation that causes the relevant biological activity to be weakened or lost can be present in the functional domain of the TRIM35 protein encoded by it. Such agents can change the sequence of the TRIM35 gene, resulting in the presence of corresponding mutations in the TRIM35 protein encoded by it, thereby having weakened activity or loss of activity. For example, the wild-type TRIM35 gene can be replaced by a mutant TRIM35 gene by homologous recombination technology, resulting in the expression of a weakly active or inactive TRIM35 protein.

[0050] The fourth aspect of the present invention provides the use of the oncolytic adenovirus described in the first aspect of the present invention in the preparation of a gene therapy vector.

[0051] The fifth aspect of the present invention provides use of the oncolytic adenovirus described in the first aspect of the present invention in the preparation of a medicament for treating and / or preventing tumors;

[0052] Preferably, the tumor includes prostate cancer, lung adenocarcinoma, liver cancer, colon cancer, rectal cancer, lung cancer, cervical cancer, colon cancer, bone cancer, melanoma, nasopharyngeal cancer, osteosarcoma, pancreatic cancer, esophageal cancer, gastric cancer, breast cancer, leukemia, lymphoma, oral cancer, laryngeal cancer, kidney cancer, bladder cancer, endometrial cancer, ovarian cancer, multiple myeloma, glioma.

[0053] In the present invention, the tumor refers to an abnormal mass of tissue produced by uncontrolled and progressive excessive cell division, also known as a neoplasm. Tumors may be benign (non-cancerous) or malignant. Tumors cover all forms of cancer and metastasis, and the tumors include various types of tumors currently known, including but not limited to: breast cancer, head and neck tumors, synovial cancer, kidney cancer, connective tissue cancer, melanoma, lung cancer, esophageal cancer, colon cancer, rectal cancer, brain cancer, liver cancer, bone cancer, choriocarcinoma, gastrinoma, pheochromocytoma, prolactinoma, anal cancer, bile duct cancer, bladder cancer, ureteral cancer, glioma, neuroblastoma, meningioma, spinal cord tumor, osteochondroma, chondrosarcoma, Ewing's sarcoma, cancer of unknown primary site , carcinoid, fibrosarcoma, Paget's disease, cervical cancer, gallbladder cancer, eye cancer, Kaposi's sarcoma, prostate cancer, testicular cancer, skin squamous cell carcinoma, mesothelioma, multiple myeloma, ovarian cancer, pancreatic endocrine tumors, glucagonoma, pancreatic cancer, penile cancer, pituitary cancer, soft tissue sarcoma, retinoblastoma, small intestine cancer, gastric cancer, thymic cancer, trophoblastic carcinoma, hydatidiform mole, endometrial cancer, vaginal cancer, vulvar cancer, mycosis fungoides, insulinoma, heart cancer, meningeal cancer, various types of blood cancer, peritoneal cancer and pleural cancer, etc.

[0054] In the present invention, the treatment and / or prevention refers to slowing down, interrupting, blocking, alleviating, stopping, reducing, or reversing the progression or severity of existing symptoms, symptoms, conditions, or diseases (such as cancer or tumors). The desired therapeutic effects include, but are not limited to: preventing the occurrence or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, improving or alleviating the disease state, and alleviating or improving prognosis.

[0055] The present invention also provides the use of the oncolytic adenovirus carrying shTRIM35 described in the first aspect of the present invention in conjunction with other anti-tumor immunotherapy drugs.

[0056] The present invention also provides a method for treating tumors, comprising the following steps: administering a therapeutically effective amount of the oncolytic adenovirus carrying shTRIM35 described in the first aspect of the present invention and / or the pharmaceutical composition described in the second aspect of the present invention to a subject in need thereof.

[0057] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0058] The present invention provides for the first time an enhanced oncolytic adenovirus carrying shTRIM35. The shRNA expressed by the oncolytic adenovirus can significantly reduce the expression of TRIM35 in cells, thereby significantly enhancing the oncolytic effect of the oncolytic adenovirus and the replication ability in tumor tissues. So far, there have been no reports on oncolytic adenovirus carrying shTRIM35. The present invention provides a new idea and theoretical basis for the clinical application and tumor treatment of oncolytic adenovirus, and has potential and good application prospects in the field of tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is the OAV skeleton structure map;

[0060] Figure 2 The figure shows the verification result that the recombinant oncolytic adenovirus carrying shTRIM35 (OAV-shTRIM35) has a stronger oncolytic effect, wherein, Figure A: Schematic diagram of the construction of the recombinant oncolytic adenovirus carrying shTRIM35; Figure B: After HepG2 cells were infected with OAV-shTRIM35 and OAV at an MOI of 10 for 48 h, the tumor inhibition effect was observed under a microscope and the expression of adenovirus E1A protein in the cells was detected by Western blot; Figure C: The result of analyzing the anti-tumor effect of OAV and OAV-shTRIM35 on PC-3, A549, HepG2 and Huh7 cells by RTCA;

[0061] Figure 3 The figures show the effect of ectopic shTRIM35 expression on oncolytic activity in vivo, wherein: Figure A: schematic diagram of the timeline of the in vivo experimental study; Figure B: tumor growth curve of mice; Figure C: mean tumor volume curve ± SD; Figure D: tumor inhibition rate of different groups, Figure E: tumor size of different groups; Figure F: the expression of E1A, Hexon and DBP in tumor tissues on the 7th day after three treatments with OAV or OAV-shTRIM35; Figure G: the expression of E1A protein detected by Western blot on the 7th day after three treatments with OAV or OAV-shTRIM35. DETAILED DESCRIPTION

[0062] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and cannot be understood as limiting the present invention. It can be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and purpose of the present invention, and the scope of the present invention is defined by the claims and their equivalents. The experimental methods used in the following embodiments are conventional methods unless otherwise specified; the reagents, biological materials, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial sources.

[0063] Example 1 Construction of oncolytic adenovirus carrying shTRIM35

[0064] In this example, a recombinant oncolytic adenovirus carrying shTRIM35 was constructed. The construction diagram is shown in FIG. Figure 2 A. The specific construction method of the recombinant oncolytic adenovirus is as follows:

[0065] TRIM35 shRNA driven by the U6 promoter was synthesized by Azenta Life Sciences and cloned into the adenovirus shuttle plasmid pZD55. HEK293 cells were co-transfected with pZD55-TRIM35 shRNA and adenovirus backbone plasmid pBHGE3 (Microbix Biosystems) by Lipofectamine 2000 (Invitrogen) according to the instructions. The packaged viruses were collected after about 7-10 days, and the packaged adenovirus Ad5-ZD55-TRIM35 shRNA was amplified in HEK293 cells, the viruses were collected, and the virus titer was determined by the TCID50 method.

[0066] The sequence of TRIM35 shRNA is GCAGGAGTTTGATAAGCTTTTttcaagagaAAAAGCTTATCAAACTCCTGCTTTTTT (SEQ ID NO: 1), wherein ttcaagaga is a loop, TTTTTT is a termination sequence, and the restriction site is BglII (agatct).

[0067] The sequence of the U6 promoter is GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTA GAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACG (SEQ ID NO:2).

[0068] Adenovirus backbone structure map Figure 1

[0069] Example 2 In vitro verification of the killing effect of oncolytic adenovirus carrying shTRIM35 on tumors

[0070] 1. Experimental methods

[0071] HepG2 cells were infected with OAV-shTRIM35 and OAV at an MOI of 10, respectively. 48 h after infection, the killing effects of OAV-shTRIM35 and OAV on tumor cells were observed under a microscope, and the expression of adenovirus E1A protein in cells was detected by Western blot.

[0072] PC-3 (prostate cancer cell line), A549 (lung adenocarcinoma cell line), HepG2 (liver cancer cell line) and Huh7 (liver cancer cell line) cells were infected with OAV-shTRIM35 and OAV at an MOI of 10, respectively, and the killing effects of OAV-shTRIM35 and OAV on the above tumor cells after infection were analyzed by RTCA.

[0073] 2. Experimental results

[0074] The results showed that compared with OAV, OAV-shTRIM35 constructed in the present invention caused more severe cytopathic effect after infecting cells (see Figure 2 B), indicating that OAV-shTRIM35 has a stronger oncolytic effect in vitro. The results of Western blot detection of the expression of adenovirus E1A protein in cells showed that compared with OAV, the expression level of adenovirus E1A protein in cells infected with OAV-shTRIM35 constructed by the present invention was significantly lower, that is, the residual E1A protein in cells infected with OAV-shTRIM35 was significantly less (see Figure 2 B), indicating that OAV-shTRIM35 replicates faster and releases more progeny virus particles. The results of RTCA analysis showed that compared with OAV, OAV-shTRIM35 constructed by the present invention has significantly better anti-tumor effects on prostate cancer cell lines, lung adenocarcinoma cell lines, and liver cancer cell lines (see Figure 2 C), indicating that OAV-shTRIM35 has a strong anti-tumor effect on different types of tumor cell lines.

[0075] Example 3 In vivo verification of the killing effect of oncolytic adenovirus carrying shTRIM35 on tumors

[0076] 1. Experimental methods

[0077] In order to further verify the oncolytic activity of the oncolytic adenovirus carrying shTRIM35 in vivo, this example used human prostate cancer cell line PC-3 to inoculate BALB / c nude mice to construct a human prostate cancer nude mouse subcutaneous transplant tumor model. The specific construction method is as follows: human prostate cancer cell line PC-3 was subcutaneously inoculated into the back of the neck of BALB / c nude mice, and the inoculated cell amount was 2×10 6 The skin of nude mice was disinfected before inoculation, and a total of 15 BALB / c nude mice were inoculated.

[0078] When the subcutaneous tumors grew to a diameter of about 5 mm, the mice were randomly divided into three groups: PBS group (n=5), OAV group (n=5), and OAV-shTRIM35 group (n=5). The PBS group was treated by intratumoral injection of PBS solution once every other day for 3 times; the OAV group was treated by intratumoral injection of OAV solution once every other day for 3 times, with a total injection dose of 1×10 9 PFU; the OAV-shTRIM35 group was treated by intratumoral injection of OAV-shTRIM35 once every other day for a total of 3 injections, with a total injection dose of 1×10 9 PFU, record the growth rate, volume, morphology, etc. of the tumor. The specific treatment plan for each group is as follows Figure 3 As shown in A.

[0079] On the 7th day after administration, three mice in each of the PBS group, OAV group, and OAV-shTRIM35 group were killed, and genomic DNA was extracted from the tumor tissues of the mice. Real-time PCR was used to detect the expression levels of viral genes E1A, DBP, and Hexon. The information of Real-time PCR specific primers is shown in Table 1. The expression of adenovirus E1A protein was detected by Western blot.

[0080] Table 1 Real-time PCR specific primer information

[0081]

[0082] 2. Experimental results

[0083] The results showed that compared with the PBS group or the OAV group, the tumor volume of the human prostate cancer nude mouse subcutaneous transplanted tumor model in the group with intratumoral administration of OAV-shTRIM35 was significantly smaller, and the inhibition rate of tumor growth was significantly higher. OAV-shTRIM35 showed better anti-tumor activity. The inhibition rate of OAV-shTRIM35 on tumor growth was 78.56%, and the tumor volume was significantly reduced (see Figure 3BE). The results of real-time PCR showed that the expression levels of E1A, DBP and Hexon in tumor tissues of the OAV-shTRIM35 treatment group were significantly higher than those of the OAV treatment group (see Figure 3 F), and the expression level of adenovirus E1A protein in tumor tissues of the OAV-shTRIM35 treatment group was significantly higher (see Figure 3 G), the above results indicate that the OAV-shTRIM35 constructed by the present invention has a better killing effect on tumors in vivo.

[0084] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. An oncolytic adenovirus carrying shTRIM35, characterized in that: The oncolytic adenovirus comprises a coding sequence of an exogenous shRNA that inhibits the expression of TRIM35; The coding sequence of the exogenous shRNA that inhibits the expression of TRIM35 is shown in SEQ ID NO:

1.

2. The oncolytic adenovirus according to claim 1, characterized in that The oncolytic adenovirus may operably contain the following genes connected in sequence: a coding sequence of the E1A gene, a U6 promoter, a coding sequence of an exogenous shRNA that inhibits the expression of TRIM35, and a polyA sequence of SV40.

3. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises an effective amount of the oncolytic adenovirus according to claim 1 or 2.

4. The pharmaceutical composition according to claim 3, characterized in that The pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

5. Use of an agent that inhibits TRIM35 expression in the preparation of a product that enhances the anti-tumor effect of an oncolytic adenovirus, characterized in that: The reagent for inhibiting TRIM35 expression is shRNA targeting the TRIM35 gene; The coding sequence of the shRNA is shown in SEQ ID NO: 1; The tumor is prostate cancer, lung adenocarcinoma or liver cancer.

6. Use of the oncolytic adenovirus according to claim 1 or 2 in the preparation of a gene therapy vector.

7. Use of the oncolytic adenovirus according to claim 1 or 2 in the preparation of a medicament for treating and / or preventing tumors; The tumor is prostate cancer, lung adenocarcinoma or liver cancer.

Images