Andrographolide synthesis related p450 cytochrome enzymes and application thereof
By heterologously expressing CYP71A8 and CYP71D10 enzymes in Saccharomyces cerevisiae and integrating related genes, the synthesis of key intermediate compounds of andrographolide was achieved, solving the synthesis problem in the prior art and providing a reference for biosynthetic pathway analysis and metabolic engineering.
Patent Information
- Application Number
- CN202211669385.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-24
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2042-12-24
AI Technical Summary
There is a lack of effective methods in the existing technology to synthesize the key intermediate compound 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid of andrographolide, and the realization of recombinant eukaryotic microorganisms has not been reported.
Heterologous expression of CYP71A8 and CYP71D10 enzymes derived from Andrographis paniculata was performed, and a recombinant system was constructed in Saccharomyces cerevisiae. By integrating the GGPP synthase and CPS diterpene synthase genes and using ApCPR for electron transfer, the compound was synthesized through whole-cell catalytic synthesis.
The de novo synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid was successfully achieved, providing a reference for elucidating the biosynthetic pathway of andrographolide and its metabolic engineering synthesis. The product peak response value reached 1.9*106.
Smart Images

Figure CN115851637B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a group of andrographolide synthesis related P450 cytochrome enzymes and their applications, belonging to the field of application of microorganisms and enzyme engineering. BACKGROUND
[0002] Cytochrome oxidase (cytochrome P450, P450) belongs to the heme oxidase superfamily, and is named cytochrome P450 enzyme because the reduced heme oxidase binds to CO to form a complex with a maximum absorption peak near 450 nm. According to the cell localization of P450 enzyme and the composition of the redox partner protein (NADPH-cytochrome P450 reductase, CPR), it can be divided into 5 classes Class, among which Class I needs an additional electron transfer protein to transfer electrons NAD(P)H to the P450 enzyme active center to complete the whole catalytic process.
[0003] ent-Copalol and 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid are diterpenoids containing four isoprene, which exist in the herb Andrographis paniculata, and are two important intermediate compounds for the synthesis of andrographolide in vivo. Andrographolide has the effects of clearing heat and detoxifying, reducing swelling and relieving pain, and is known as "natural antibiotic drug". However, there has been no report on the catalytic reaction of P450 enzyme related to the synthesis of andrographolide and the pathway material 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid. Therefore, the study of the activity and function of CYP450 enzyme in the synthesis process is of great significance to understand the whole pathway of andrographolide synthesis.
[0004] CYP450 enzyme is a membrane protein, and its formation requires a series of post-translational modifications. Eukaryotic expression hosts have a relatively complete post-translational modification system of endoplasmic reticulum, Golgi body and other internal membrane structures, which makes the expressed heterologous proteins closer to their natural conformation. Eukaryotic microorganisms are generally considered to be a suitable system for heterologous expression of CYP450 enzymes. In addition, the endogenous CPR of eukaryotic microorganisms can mediate the effective transfer of electrons to CYP450 enzymes, which helps CYP450 enzymes to exert their catalytic function. The application of eukaryotic microorganisms has the natural advantages of catalyzing the synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid Figure 1). According to the existing research, there is no eukaryotic microbial recombinant bacteria for synthesizing 3, 15, 19-Trihydroxy-8(17), 13-ent-labdadiene-16-oic acid from scratch SUMMARY
[0005] The CYP71A8 and CYP71D10 from Andrographis source in the application belong to the Class I CYP71 family, and need electron transfer protein catalytic activity, but the specific biological function has not been reported, so the application is the first to perform heterologous expression on CYP71A8 and CYP71D10 and publish the catalytic function thereof.
[0006] The first object of the application is to provide the application of CYP450 enzymes from Andrographis source in catalyzing the synthesis of 3, 15, 19-Trihydroxy-8(17), 13-ent-labdadiene-16-oic acid.
[0007] In an embodiment, the CYP450 enzymes from Andrographis source are CYP71A8 and CYP71D10.
[0008] In an embodiment, the amino acid sequence of CYP71A8 is shown in SEQ ID NO. 1; and the amino acid sequence of CYP71D10 is shown in SEQ ID NO. 2.
[0009] In an embodiment, the N-terminal of CYP71A8 is truncated by 32 amino acids, and the N-terminal of CYP71D10 is truncated by 28 amino acids.
[0010] In an embodiment, the amino acid sequence of CYP71A8 truncated by 32 amino acids at the N-terminal is shown in SEQ ID NO. 3, and the amino acid sequence of CYP71D10 truncated by 28 amino acids at the N-terminal is shown in SEQ ID NO. 4.
[0011] The second object of the application is to provide a recombinant Saccharomyces cerevisiae, which is knocked out of ROX1 and GAL80 genes on the genome, integrates expression of GGPP synthase coding gene and CPS diterpene synthase coding gene, and freely expresses CYP71A8t coding gene of CYP71A8 truncated by 32 amino acids at the N-terminal, CYP71D10t coding gene of CYP71D10 truncated by 28 amino acids at the N-terminal, and CPR coding gene ApCPR.
[0012] In an embodiment, after the ROX1 site is knocked out, the GGPP synthase coding gene and the CPS diterpene synthase coding gene are integrated at the ROX1 site.
[0013] In an embodiment, the amino acid sequence of the CYP71A8 truncated by 32 N-terminal amino acids is as shown in SEQ ID NO. 3 and the amino acid sequence of the CYP71D10 truncated by 28 N-terminal amino acids is as shown in SEQ ID NO. 4.
[0014] In an embodiment, the nucleotide sequence of the ApCPR is as shown in SEQ ID NO. 7.
[0015] In an embodiment, the amino acid sequence of the GGPP synthase is as shown in SEQ ID NO. 8.
[0016] In an embodiment, the amino acid sequence of the CPS diterpene synthase is as shown in SEQ ID NO. 9.
[0017] In an embodiment, the Saccharomyces cerevisiae CEN.PK2-1D is used as the starting strain.
[0018] In an embodiment, the promoter P PGK1 is used to start the expression of the CPR coding gene.
[0019] In an embodiment, the promoter P TEF1 is used to start the expression of the CYP71A8t.
[0020] In an embodiment, the promoter P GAL7 is used to start the expression of the CYP71D10t.
[0021] In an embodiment, the nucleotide sequence of the promoter P GAL7 is as shown in SEQ ID NO. 10, the nucleotide sequence of the promoter P PGK1 is as shown in SEQ ID NO. 11, and the nucleotide sequence of the promoter P TEF1 is as shown in SEQ ID NO. 12.
[0022] In an embodiment, the pY26 series vector or the pET series vector is used as the expression vector.
[0023] In an embodiment, the pET series vector includes the pET22b(+) expression vector or the pET28a(+) expression vector.
[0024] A third object of the present application is to provide a whole cell catalyst comprising the recombinant Saccharomyces cerevisiae described above.
[0025] A fourth object of the present application is to provide a method for synthesizing 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid, which is fermenting 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid by using the recombinant Saccharomyces cerevisiae or the whole-cell catalyst as the fermenting strain.
[0026] In an embodiment, the method is fermenting production in a culture medium with glucose as the carbon source.
[0027] In an embodiment, the method is inoculating the seed liquid of the recombinant Saccharomyces cerevisiae or the whole-cell catalyst into the culture medium, and fermenting for 90-160 h under the reaction conditions of 28-32℃ and 200-230 rpm.
[0028] In an embodiment, the culture medium comprises 10-30 g / L of proteose peptone, 5-15 g / L of yeast powder, and 10-30 g / L of glucose.
[0029] In an embodiment, the preparation method of the seed liquid is inoculating the recombinant Saccharomyces cerevisiae or the whole-cell catalyst into a seed culture medium, and fermenting for 12-20 h under the reaction conditions of 28-32℃ and 200-230 rpm.
[0030] The present application also provides the use of the CYP450 enzyme from Andrographis, the recombinant Saccharomyces cerevisiae, the whole-cell catalyst, or the method in the catalytic synthesis of andrographolide or products containing andrographolide.
[0031] In an embodiment, the CYP450 enzyme from Andrographis is CYP71A8 and CYP71D10.
[0032] In an embodiment, the amino acid sequence of CYP71A8 is shown in SEQ ID NO. 1, and the amino acid sequence of CYP71D10 is shown in SEQ ID NO. 2.
[0033] In an embodiment, the CYP71A8 is truncated at the N-terminus by 32 amino acids, and the CYP71D10 is truncated at the N-terminus by 28 amino acids.
[0034] In an embodiment, the amino acid sequence of CYP71A8 truncated at the N-terminus by 32 amino acids is shown in SEQ ID NO. 3, and the amino acid sequence of CYP71D10 truncated at the N-terminus by 28 amino acids is shown in SEQ ID NO. 4.
[0035] The application also provides application of the recombinant Saccharomyces cerevisiae, the whole cell catalyst or the method in catalyzing synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid or a product containing 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid.
[0036] Advantages of the application:
[0037] 1、The application uses BL21 (DE3) as a host to express recombinant plasmids pET22b (+)-CYP71A8t and pET28a (+)-CYP71D10t, and heterologous expression of CYP7A8 and CYP71D10 after truncating the signal peptide is successfully realized by using the obtained recombinant E. coli, and it is found that the protein loses expression activity after CYP71A8 is truncated to 57 amino acids, and the protein loses expression activity after CYP71D10 is truncated to 59 amino acids.
[0038] 2、The application uses Saccharomyces cerevisiae CEN.PK2-1D as a host to knock out ROX1 and GAL80 genes on the genome, and integrate expression of a GGPP synthase coding gene and a CPS diterpene synthase coding gene at the ROX1 site; CYP71A8 and CYP71D10 and ApCPR are expressed freely, and recombinant Saccharomyces cerevisiae CW1006 / pY26-P TEF1 -CYP71A8t-P GAL7 -CYP71D10t is successfully constructed, and microbial fermentation synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid is realized. 6 The application first realizes de novo synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid, and the strategy provides a necessary reference for analyzing androsin biosynthesis pathways and synthesizing androsin and related derivatives by metabolic engineering. BRIEF DESCRIPTION OF DRAWINGS
[0039] Figure 1 Reaction diagram for catalyzing synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid by eukaryotic microorganisms
[0040] Figure 2 : pET22b(+)-P T7 -CYP71A8t and pET28a(+)-P T7 -CYP71D10t plasmid map.
[0041] Figure 3 : SDS-PAGE map of BL21(DE3) expressing CYP71A8t and CYP71D10t; 1: pET22b empty; 2: pET22b-CYP71A8t; M: Marker; 3: pET28a empty; 4: pET28a-CYP71D10t.
[0042] Figure 4 : pY26-P TEF1 -CYP71A8t-P GAL7- CYP71D10t plasmid map.
[0043] Figure 5 : LCMS-IT-TOF ion flow chart of recombinant Saccharomyces cerevisiae catalyzing ent-Copalol to synthesize 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid. DETAILED DESCRIPTION
[0044] (I) Culture medium
[0045] LB medium: 10 g / L of proteose peptone, 5 g / L of yeast powder, 10 g / L of sodium chloride. 20 g / L of agar powder is added to prepare LB solid medium.
[0046] YPD medium: 20 g / L of proteose peptone, 10 g / L of yeast powder, 20 g / L of glucose. 20 g / L of agar powder is added to prepare YPD solid medium.
[0047] TB medium: 12 g / L of proteose peptone, 24 g / L of yeast powder, 12.54 g / L of potassium phosphate dibasic, 2.31 g / L of potassium phosphate monobasic, 5 g / L of glycerol.
[0048] YNB medium: 20 g / L of glucose, 20 mL / L of YNB medium (purchased from Shanghai Shenguo Biotechnology Co., Ltd.). 20 g / L of agar powder is added to prepare YNB solid medium.
[0049] (II) Strains and plasmids
[0050] pY26-GDP-TEF, pET22b(+), pET28a(+) and pMD-19 vector are commercialized plasmids, Saccharomyces cerevisiae CEN.PK2-1D is commercialized yeast cell, and the chassis cell C800 is a published strain, which is recorded in the literature: Promoter-Library-Based Pathway Optimization for Efficient (2S)-Naringenin Production From p-Coumaric Acid in Saccharomyces cerevisiae, Song Gao, Hengrui zhou, Jingwen Zhou, Jian chen. J Agric Food Chem, 2020 Jun 24.
[0051] pRS426-TEF1-Cas9-gRNA-URA3 vector, synthesized by Jiangsu Saixuoshibioscience Technology Co., Ltd.
[0052] (III) 3, 15, 19-Trihydroxy-8(17), 13-ent-labdadiene-16-oic acid detection conditions
[0053] LCMS-IT-TOF was used for determination. Conditions: column C18 (4.6 mm x 250 mm, 5 μm); mobile phase methanol (B)-water (A), gradient elution (0-24 min, 30-60% B; 24-40 min, 60% B; 40-46 min, 60%-30% B; 46-50 min, 30% B); column temperature 35°C; flow rate 0.5 mL / min; injection volume 5 μL.
[0054] Construction of recombinant plasmids pET22b(+)-CYP71A8t and pET28a(+)-CYP71D10t in Example 1
[0055] The original CYP450 enzymes CYP71A8 (nucleotide sequence as shown in SEQ ID NO. 1) and CYP71D10 (nucleotide sequence as shown in SEQ ID NO. 2) from two sources of Andrographis were used as templates, and the primer pair 71A8t-F / 71A8t-R and 71D10t-F / 71D10t-R was used to amplify the target fragments CYP71A8t (nucleotide sequence as shown in SEQ ID NO. 3) and CYP71D10t (nucleotide sequence as shown in SEQ ID NO. 4) of the truncated signal peptide. After 1.5% agarose gel electrophoresis verification of the amplified CYP71A8t and CYP71D10t, Gibson assembly was performed with pET22b(+) and pET28a(+) expression vectors, respectively. The assembled plasmids were transformed into E. coli JM109 competent cells, spread on LB solid medium with the corresponding antibiotics, and incubated at 37°C overnight. Positive clones were picked and the plasmids were extracted. After sequencing, the correct ones were reserved for recombinant E. coli BL21(DE3) protein expression, and the plasmids were named pET22b(+)-P T7 -CYP71A8t and pET28a(+)-P T7 -CYP71D10t (the plasmid map is shown in FIG. 1). Figure 2 )。
[0056] Table 1 Primers used for constructing CYP71A8t and CYP71D10t expression vectors
[0057] Primer Sequence (5'-3') 71A8t-F CTGCCCAGCCGGCGATGGCCACCAAGAACTTGCCCCCGT 71A8t-R CAGTGGTGGTGGTGGTGGTGAACGAACACACCCTCAGTATAGAACTTTG 71D10t-F TAAGAAGGAGATATACCATGAAACGTCCCCGGAGTTCCG 71D10t-R CAGTGGTGGTGGTGGTGGTGCTTTACAGGCAAAGGGTTTTTCAATTTGGG
[0058] Example 2 Heterologous expression of CYP71A8t and CYP71D10t
[0059] The plasmids pET22b(+)-P T7 -CYP71A8t and pET28a(+)-P T7 -CYP71D10t were transformed into E. coli BL21 competent cells, respectively. Single colonies were inoculated into LB culture medium containing 100 mg / L ampicillin and 50 mg / L kanamycin, and incubated at 37°C, 220 rpm for 16 h as seed liquid. The seed liquid was inoculated into TB culture medium with ampicillin or kanamycin (50 mL medium in a 250 mL capacity flask, 50 g / L antibiotic, 1 / 1000 addition amount) at a volume ratio of 1%, and incubated at 37°C, 220 rpm until the fermentation liquid OD 600The expression of CYP71A8t and CYP71D10t proteins was induced by adding 5- aminoacetylpyruvate hydrochloride with a final concentration of 80 mg / L, FeSO4 solution with a concentration of 10 mg / L and 0.5 mM IPTG when the concentration was between 0.6 and 0.8. After 20 hours of induction at 16°C, the bacteria were collected by centrifugation at 4°C and 6000 rpm for 15 minutes.
[0060] After the collected bacteria were washed twice with PBS buffer (pH = 7.4), the bacteria were resuspended in a lysis buffer (500 mM potassium phosphate, pH 7.4, 250 mM NaCl, 0.25% sodium cholate, 10% glycerol, 10 mM imidazole, 10 mM β-mercaptoethanol) and the cells were sonicated on ice for 3 minutes. The cell lysate was centrifuged at 4°C and 10000 rpm for 20 minutes to remove cell debris, and the supernatant was collected. SDS-PAGE protein verification (results shown in Figure 3) was performed. Figure 3 ).
[0061] Example 3 Expression identification of recombinant plasmids pET22b(+)-CYP71A8t57 and pET28a(+)-CYP71D10t59
[0062] Using the original sequences of CYP71A8 and CYP71D10 as templates, 57 and 59 amino acids were truncated, respectively, using primers (Table 2), named CYP71A8t57 (nucleotide sequence shown in SEQ ID NO. 5) and CYP71D10t59 (nucleotide sequence shown in SEQ ID NO. 6). The recombinant plasmid construction method was the same as in Example 1, and the corresponding plasmids were named pET22-CYP71A8t57 and pET28-CYP71D10t59. The induction method and identification method were the same as in Example 2. The supernatant of the lysate was collected, and SDS-PAGE protein electrophoresis results showed that the protein was not expressed.
[0063] Table 2 Primers used for constructing expression vectors of CYP71A8t57 and CYP71D10t59
[0064] Primer Sequence (5'-3') 71A8t57-F CACCAGCTGAGCTCATTGCCTCACCACGACCTCCGGC 71A8t57-R CAGTGGTGGTGGTGGTGGTGAACGAACACACCCTCAGTATAGAACTTTG 71D10t59-F GTCAGCTCCCGACCACCGCATCATATTTTAGCCGACTTGGCGTC 71D10t59-R CAGTGGTGGTGGTGGTGGTGCTTTACAGGCAAAGGGTTTTTCAATTTGGG
[0065] Example 4 Construction of Saccharomyces cerevisiae CW1006
[0066] Using the genome of Saccharomyces cerevisiae CEN.PK2-1D as a template, the upstream and downstream homology fragments of ROX1 were amplified using primer pairs 2UProx1-F / 2UProx1-R and 7DOWNrox1-F / 7DOWNrox1-R, respectively. The promoter P GAL7 was amplified using primer 3GAL7-F / 3GAL7-R, and the promoter P TEF1Fragment; ApGGPPs fragment was amplified from ApGGPPs template using primers 4ApGGPPS-F / 4ApGGPPS-R, ApCPS fragment was amplified from ApCPS template using primers 6ApCPS-F / 6ApCPS-R, and linearized pMD-19 vector fragment was amplified from pMD-19 template using primers 1GJ-F / 1GJ-R. The above fragments were purified and assembled using Gibson method to obtain vector pMD19T-UProx1-P GAL7 -ApGGPPs-P TEF1 -ApCPS-DOWNrox1, the obtained vector was transformed into E. coli JM109 and verified by sequencing to obtain a positive recombinant vector pMD19T-UProx1-P GAL7 -ApGGPPs-P TEF1 -ApCPS-DOWNrox1, the above vector was used as a template to amplify Donar-ROX1 fragment using primers 2UProx1-F / 7DOWNrox1-F.
[0067] The linearized vector pRS426-TEF1-Cas9-gRNA-URA3 was obtained by amplifying pRS426-TEF1-Cas9-gRNA-URA3 vector using primers Cas9-F / Cas9-R, and the obtained vector was transformed into E. coli JM109 and verified by sequencing to obtain a correct recombinant vector pRS426-20nt.
[0068] The above Donar-ROX1 fragment and pRS426-20nt were transformed into the chassis cell C800, and were plated on YNB solid plates (adding 50 mg / L Leu, His and Trp) and cultured at 30°C for 2-3 days, and positive clone strains were picked and subcultured multiple times to make the pRS426 plasmid lost (the cells could grow on YPD solid plates, but could not grow on YNB solid plates containing 50 mg / L Leu, His and Trp), and the CW1006 strain was successfully constructed.
[0069] Table 3 Primers used for constructing CW1006 strain
[0070] Primer Sequence (5'-3') 1GJ-F gaatttgacaatgttaagctttgttaaacagcttggcgtaatcatggtcatagctgtt 1GJ-R ggtagttccacgcggccgatccgagttctaattcactggccg 2UProx1-F ggccagtgaattagaactcggatcggccgcgtggaactac 2UProx1-R aaggatagtaagctggcaaatgttgattgtctaactgcgttcttttgt 3GAL7-F aagaacgcagttagacaatcaacatttgccagcttactatccttcttgaaaatatg 3GAL7-R AATTTTGGAGAAACGTCGGttttgagggaatattcaactgtttttttttatcatgttga 4ApGGPPS-F agttgaatattccctcaaaaCCGACGTTTCTCCAAAATTCATTTCAATTTTTTC 4ApGGPPS-R tagaaacattttgaagctatTCAATTCTGCCTCCGACCAATGTAC 5TEF1-F ATTGGTCGGAGGCAGAATTGA atagcttcaaaatgtttctactccttttttactcttc 5 TEF1-R AGGAGGGAAAACAAAGGCAT cttagattagattgctatgctttctttctaatgagc 6 ApCPS-F gcatagcaatctaatctaag ATGCCTTTGTTTTCCCTCCTCG 6 ApCPS-R gcataaatttttagttaaaggg TCAGAAGTAACGGCGGGTATGGTC 7 DOWNrox1-F CATACCCGCCGTTACTTCTG Accctttaactaaaaatttatgcatttggctcc 7 DOWNrox1-R tatgaccatgattacgccaagctgtttaacaaagcttaacattgtcaaattcttcagg Cas9-F TGTTAATACTTCTAACTATA gttttagagctagaaatagcaagttaaaataaggctag Cas9-R TATAGTTAGAAGTATTAAC Agatcatttatctttcactgcggagaagtttc
[0071] Example 5 Construction of a system for expressing CYP71A8t and CYP71D10t in eukaryotic microorganisms
[0072] ApCPR gene was amplified from Andrographis paniculata genome template using primers CPR-F / CPR-R, and promoter P GAL7Promoter P was amplified using primers PTEF1-F / PTEF1-R. TEF1 Using the nucleotide sequence of CYP71A8 as a template, CYP71A8t was amplified using primers CYP71A8t-F / CYP71A8t-R; using the nucleotide sequence of CYP71D10 as a template, CYP71D10t was amplified using primers CYP71D10t-F / CYP71D10t-R; using the expression vector pY26-GDP-TEF as a template, the linearized vector was amplified using primers pY26-F / pY26-R. The amplification products were recovered by ethanol precipitation, and the promoter P... GAL7 promoter P TEF1 CYP71A8t, CYP71D10t, and the linearized vector were assembled using Gibson to obtain a recombinant vector, which was then transformed into E. coli JM109 competent cells and plated on LB agar medium supplemented with 100 mg / L ampicillin. The culture was incubated overnight at 37°C. Positive clones were picked and plasmids were extracted. The successfully sequenced plasmids were transformed into the *Saccharomyces cerevisiae* CW1006 constructed in Example 4 and plated on YNB agar plates (with 50 mg / L Leu, His, and Trp added). The plates were incubated at 30°C for 2-3 days. Positive clones were picked, and the recombinant *Saccharomyces cerevisiae* CW1006 / pY26-P was constructed. TEF1 -CYP71A8t-P GAL7 -CYP71D10t (plasmid map see...) Figure 4 ).
[0073] Table 4 shows the construction of pY26-P TEF1 -CYP71A8t-P GAL7- Primers used for the CYP71D10t expression vector
[0074]
[0075]
[0076] Example 6: Synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid from recombinant Saccharomyces cerevisiae
[0077] The recombinant brewer's yeast CW1006 / pY26-P constructed in Example 5 was used. TEF1 -CYP71A8t-P GAL7-CYP71D10t was inoculated into LB medium with 50 mg / L ampicillin, and cultured at 37℃ overnight. Single colony was picked and transferred into YNB medium (adding 50 mg / L Leu, His and Trp), and cultured at 30℃, 220 rpm for 16-18h. The bacterial solution was taken and inoculated into fresh 25ml YPD medium at 1% (v / v) inoculation amount, and cultured at 30℃, 220 rpm. After 120h fermentation, the fermentation broth was collected, and the response value of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid was determined by LCMS-IT-TOF. The results are shown in Table 1, and the response value of the product peak reached 1.9*10 Figure 5 . 6 .
[0078] Although the present application has been disclosed with reference to the preferred embodiments, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application. Therefore, the scope of protection of the present application should be defined by the claims.
Claims
1. A recombinant brewing yeast, characterized in that, The recombinant Saccharomyces cerevisiae knockout genome ROX1 Genes; integrated expression of the GGPP synthase encoding gene and the CPS diterpene synthase encoding gene; free expression of the CYP71A8 encoding gene with a 32-amino acid truncated at the N-terminus. CYP71A8t The CYP71D10 coding gene with 28 amino acids truncated at the N-terminus CYP71D10t and CPR encoding gene Ap The amino acid sequence of CPR;GGPP synthase is shown in SEQ ID NO.8, the amino acid sequence of CPS diterpene synthase is shown in SEQ ID NO.9, the amino acid sequence of CYP71A8 with 32 amino acids truncated at the N-terminus is shown in SEQ ID NO.3, and the amino acid sequence of CYP71D10 with 28 amino acids truncated at the N-terminus is shown in SEQ ID NO.
4. Ap The nucleotide sequence of CPR is shown in SEQ ID NO.
7.
2. The recombinant brewing yeast according to claim 1, characterized in that, Knockout ROX1 After the site, ROX1 The site integrates the GGPP synthase encoding gene and the CPS diterpene synthase encoding gene.
3. A whole-cell catalyst, characterized in that, The whole-cell catalyst comprises the recombinant Saccharomyces cerevisiae according to claim 1 or 2.
4. A synthetic method for 3,15,19-Trihydroxy-8(17),13- ent A method for producing 3,15,19-Trihydroxy-8(17),13-oic acid using the recombinant Saccharomyces cerevisiae of claim 1 or 2 or the whole-cell catalyst of claim 3 as the fermentation strain. ent -labdadiene-16-oic acid.
5. The recombinant Saccharomyces cerevisiae of claim 1 or 2, or the whole-cell catalyst of claim 3, or the method of claim 4, for the catalytic synthesis of 3,15,19-Trihydroxy-8(17),13- ent -labdadiene-16-oic acid or containing 3,15,19-Trihydroxy-8(17),13- ent Applications of -labdadiene-16-oic acid in products.
Citation Information
Patent Citations
CYP450 zymoprotein capable of catalyzing formation of neoandrographolide aglycone, coding gene and application
CN119082056A