A flavin monooxygenase gene ScFMO and its encoded protein and application
By extracting the flavin monooxygenase gene ScFMO from marben and expressing it in E. coli, the problems of low yield and environmental pollution in the existing indigo production methods are solved, and efficient and environmentally friendly indigo production are achieved.
Patent Information
- Application Number
- CN202211506408.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-29
- Publication Date
- 2025-04-15
- Estimated Expiration
- 2042-11-29
AI Technical Summary
The existing indigo production methods mainly rely on chemical synthesis and plant extraction, both of which have problems with low yields, serious environmental pollution and inconsistent with the concept of sustainable development.
By extracting the flavin monooxygenase gene ScFMO from the medicinal plant Magnolia, the recombinant vector pET28a-ScFMO was constructed and expressed in E. coli, the efficient production of indigo was achieved.
It has achieved efficient production of indigo, with a maximum output of 57.1mg/L, avoiding the pollution of the environment by organic reagents and in line with the concept of sustainable development.
Smart Images
Figure BDA0003969190140000021 
Figure HDA0003969190150000011 
Figure HDA0003969190150000021
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and in particular to a flavin monooxygenase gene ScFMO from the medicinal plant Indigofera cyanidis and a preparation method thereof, a polypeptide, a recombinant vector and a construction method thereof, an engineered cell or an engineered bacterium, and a method for producing indigo. Background Art
[0002] Indigo is one of the earliest discovered natural dyes. The blue fuel used by ethnic minorities in western my country comes from natural indigo. Indigo is widely used in printing and dyeing, medical and food industries. The production methods of indigo are mainly chemical synthesis and plant extraction, with chemical synthesis being the main method. The method of obtaining indigo by chemical synthesis has a low yield and cannot achieve large-scale and efficient synthesis. It also causes serious environmental pollution. At the same time, the process of separating and extracting indigo from plants will encounter many uncertain factors, such as the solubility of indigo, the impact of the growth environment on the secondary metabolites of medicinal plants, the consumption of a lot of manpower and material resources, and the lack of sustainable development concepts. It also requires the use of organic reagents, which will cause a certain degree of environmental pollution. Neither of these two methods is a long-term solution.
[0003] "At sunrise, the river flowers are redder than fire; in spring, the river water is as green as blue" and "The blue comes from the blue and is better than the blue". The blue in these two ancient poems refers to the plants that can be used to make indigo. There are four major indigo plants in my country, namely Isatis indigotica, Indigofera tinctoria, Indigofera tinctoria and Indigofera tinctoria. Among them, the medicinal plant Indigofera tinctoria is one of the local medicinal materials in Fujian. The main active ingredients of Indigofera tinctoria that have been discovered are indole compounds: Indigo, Indirubin, Isatin, Indolic acid, etc. Among these compounds, indigo has a liver-protecting effect, and Indirubin has an anti-tumor effect, and is an effective ingredient for the treatment of chronic myeloid leukemia.
[0004] Indigo and indirubin, the secondary metabolites of Indigo, have been widely studied as important natural dyes and precious medicinal active ingredients, and their biosynthesis pathways have always been the focus of scientists' research. Studies have found that Indigo leaves contain a large amount of colorless indigo (Indican, indoxyl-β-D-glucoside), which only exists in the vacuoles of green leaves and does not exist in other tissues. When the leaves are damaged and the vacuoles rupture, indigo is hydrolyzed by glucosidase in the plant to form indoxyl, which is then oxidized in the air to form indigo, indirubin, etc. Therefore, indoxyl is considered to be the precursor for the synthesis of indigo, indigorubin, and isoindigorubin, and the biosynthesis pathway of indoxyl is the key to solving the problem of indigo production.
[0005]
[0006] Flavin-containing monooxygenase (FMO) is a microsomal enzyme that depends on flavin adenine dinucleotide (FAD), reduced nicotinamide adenine dinucleotide phosphate and molecular oxygen. It is an intrahepatic drug and chemical xenobiotic metabolizing enzyme in traditional Chinese medicine, and can catalyze the oxidation of heteroatom compounds containing nitrogen, sulfur, phosphorus, selenium, etc. In the indole plant, the 3rd position of indole is oxidized by flavin monooxygenase FMO to add a hydroxyl group to generate indole, which is then oxidized by air and automatically dimerizes to form indigo.
[0007] Escherichia coli is a single-celled low-level prokaryotic organism with ordinary culture conditions and rapid growth and reproduction. When the Escherichia coli expression system is used to express genetic engineering products, it can be mass-produced, effectively reducing production costs. Escherichia coli engineering bacteria has the advantages of clear genetic background, high expression level of target genes, and perfect expression system technology, making it an ideal tool for expressing exogenous genes. Summary of the invention
[0008] The first aspect of the present invention provides a flavin monooxygenase gene ScFMO from the medicinal plant Strobilanthes cusia (Nees) Kuntze, and the nucleotide sequence of the flavin monooxygenase gene ScFMO is shown in SEQ ID No.1.
[0009] The second aspect of the present invention provides a polypeptide encoded by the flavin monooxygenase gene ScFMO from the medicinal plant Indigofera tinctoria, the amino acid sequence of the polypeptide is shown in SEQ ID No.2.
[0010] The third aspect of the present invention provides a method for preparing the flavin monooxygenase gene ScFMO from the medicinal plant Indigofera tinctoria. The medicinal plant Indigofera tinctoria is used as an experimental material, and its total RNA is extracted, and cDNA is obtained by reverse transcription. Specific primers are used to amplify the gene sequence of ScFMO by PCR reaction. Specifically, the method for obtaining the flavin monooxygenase gene ScFMO is as follows: fresh Indigofera tinctoria leaves are taken and crushed in liquid nitrogen, and total RNA is extracted according to the instructions of Trizol reagent, and cDNA is obtained by reverse transcription. By designing specific primers ScFMO-For and ScFMO-Rev, the full-length gene sequence of flavin monooxygenase ScFMO (as shown in SEQ ID No. 1) is amplified. The plasmid Bluntzero-ScFMO is constructed, the plasmid is amplified in DH5a, and the plasmid is sequenced to obtain the flavin monooxygenase gene ScFMO of the present invention.
[0011] Furthermore, the specific primers used to amplify the gene sequence of the flavin monooxygenase gene ScFMO include:
[0012] ScFMO-For:TTCTATGGAGAAGAGGGTGGC;
[0013] ScFMO-Rev:TCAGAGCTGATGAGGACTAATTCC.
[0014] The fourth aspect of the present invention provides a recombinant vector containing the flavin monooxygenase gene ScFMO from the medicinal plant Indigofera tinctoria.
[0015] The fifth aspect of the present invention provides a method for constructing the above-mentioned recombinant vector, selecting two restriction sites (such as EcoRI and HindIII) at the multiple cloning site of the expression vector for restriction digestion, purifying and recovering the linear vector, and adding the gene ScFMO through In-Fusion cloning technology to obtain a recombinant vector (such as pET28a-ScFMO).
[0016] Furthermore, the primers used to construct the recombinant vector include:
[0017] Upstream primer (e.g. pET28a-ScFMO-For):
[0018] TGGGTCGCGGATCCGAATTCATGGAGAAGAGGGTGGCAAT;
[0019] Downstream primer (for example: pET28a-ScFMO-Rev):
[0020] CTCGAGTGCGGCCGCAAGCTTTCAGAGCTGATGAGGACTAATTC.
[0021] The sixth aspect of the present invention provides an engineered cell or engineered bacteria for producing indigo, comprising the above-mentioned recombinant vector.
[0022] Furthermore, the engineered bacteria is an engineered Escherichia coli. For example, the method for obtaining the indigo-producing Escherichia coli engineered bacteria is as follows: design primers pET28a-ScFMO-For and pET28a-ScFMO-Rev, use plasmid Bluntzero-ScFMO as a template, obtain gene fragments, select EcoRI and HindIII two restriction sites in the multiple cloning site of the pET28a vector for enzyme cutting, purify and recover the linear vector, obtain pET28a-ScFMO plasmid through In-Fusion cloning technology, and express it in E. coli BL21 (DE3) to obtain a recombinant engineered strain producing flavin monooxygenase ScFMO.
[0023] The seventh aspect of the present invention provides a method for producing indigo, comprising the following steps: placing the engineered cells or engineered bacteria obtained by the above construction in a culture medium (the culture medium is selected from LB culture medium (Luria-Bertani) or M9 culture medium (M9 liquid medium)), fermenting and culturing at 37±0.5°C, and culturing until the OD value of the logarithmic phase is 600 The pH value is 0.4-0.7, and isopropyl-beta-D-thiogalactopyranoside (IPTG) is added for induction culture, and the product is collected.
[0024] The beneficial effects of the present invention are:
[0025] The flavin monooxygenase gene ScFMO from the medicinal plant Indigofera odorata in this application has a nucleotide sequence as shown in SEQ ID No. 1, and the nucleotide sequence of the gene is 1575 bases. The gene encodes a new type of flavin monooxygenase, which encodes 525 amino acids, and the amino acid sequence is shown in SEQ ID No. 2. The flavin monooxygenase can catalyze indole to produce indigo. By constructing the expression plasmid pET28a-ScFMO, an indigo-producing Escherichia coli engineered bacteria is obtained, and the new flavin monooxygenase gene is expressed in the Escherichia coli expression system to obtain an Escherichia coli flavin monooxygenase recombinant strain. After fermentation, the recombinant strain can efficiently convert indole in the culture medium into indigo. The new flavin monooxygenase obtained in this application has the function of efficiently catalyzing indole to produce indigo, can achieve efficient production of indigo, and the maximum yield can reach 57.1 mg / L. The growth environment can be artificially controlled, the reproduction speed is fast, and the subsequent treatment of the product is relatively simple, which is convenient for large-scale production and avoids the pollution of the environment caused by organic reagents. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is the electrophoresis diagram of PCR amplification of flavin monooxygenase gene; where: M is DNA Marker, 1 is flavin monooxygenase gene ScFMO.
[0027] Figure 2 This is the plasmid map of the recombinant plasmid pET28a-ScFMO of the present invention.
[0028] Figure 3 This is a diagram of the pET28a-ScFMO protein expression and purification results; wherein: M is Protein Marker, and pET28a-ScFMO is eluted with 0mM, 25mM, 50mM, 100mM, and 200mM imidazole.
[0029] Figure 4These are the fermentation result graphs and harvest comparison graphs of E. coli engineered bacteria after 0 hours, 12 hours, 18 hours, and 24 hours, as well as the 24-hour harvest and blank control. DETAILED DESCRIPTION
[0030] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not intended to limit the scope of the present invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0031] Source of test materials:
[0032] Strobilanthes cusia (Nees) Kuntze was provided by the School of Biomedical Sciences, Huaqiao University, Quanzhou, Fujian.
[0033] Plasmid Bluntzero (kana resistance) was purchased from Nanjing Novozymes Biotech Co., Ltd.
[0034] Plasmid pET28a (kana resistance) was purchased from Invitrogen.
[0035] Escherichia coli BL21 (DE3) was purchased from Shanghai Weidi Biotechnology Co., Ltd.
[0036] RNA electrophoresis buffer (TAE): Preparation steps of 50×TAE buffer stock solution: weigh Tris (242 g) and Na2EDTA·2H2O (37.2 g), then add 800 mL ddH2O and stir to dissolve; add 57.1 mL acetic acid and mix well; add ddH2O to make up to 1 L and store at room temperature.
[0037] LB medium: Tryptone: 10 g / L, Yeast extract: 5 g / L, NaCl: 10 g / L.
[0038] M9 culture medium: M9 mother liquor: disodium hydrogen phosphate (64 g), potassium dihydrogen phosphate (15 g), sodium chloride (2.5 g), ammonium chloride (5.0) g, add 1L ddH2O for sterilization; take 200mL of M9 mother liquor, add 700mL of water, add 2mL of sterilized 1M magnesium sulfate, add 100uL of sterilized 1M calcium chloride, and store at room temperature.
[0039] In the embodiments of the present invention, the relevant coding genes and amino acid sequences are as follows:
[0040] Among them, the sequence encoding the gene ScFMO is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2.
[0041] The nucleotide sequence SEQ ID NO.1 encoding the gene ScFMO is as follows:
[0042]
[0043] The amino acid sequence SEQ ID NO.2 encoded by the coding gene ScFMO is as follows:
[0044] *. (* represents the stop codon)
[0045] Example 1
[0046] This embodiment provides a method for obtaining a flavin monooxygenase gene, comprising the following steps:
[0047] 1. Extraction of total RNA from Malan
[0048] (1) Avoid RNA enzyme interference. The consumables used in the experiment should be cleaned with pure water, sterilized in an autoclave (121°C, 20 min), and dried at 50°C for later use. The buffer used for RNA electrophoresis should be prepared and used immediately, and the electrophoresis tank should be kept clean.
[0049] (2) Precool the mortar with liquid nitrogen, select young leaves of Indigofera ovata, place them in the precooled mortar, add liquid nitrogen and grind them, replenish liquid nitrogen in time during the grinding process, grind them into powder, divide them into 2.0 mL EP tubes, add 1 mL of precooled TRIzol™ Reagent, shake and mix, and leave them at room temperature for 3-5 min to fully lyse the plant cells, then add 200 μL of chloroform, shake and mix, leave them for 2-4 min, centrifuge at low temperature and high speed (4°C, 12000 rpm, 15 min), and aspirate the supernatant and transfer it to an RNase free EP tube. Add 500 μL of isopropanol, let stand for 6-10 min, centrifuge at low temperature and high speed (4°C, 12000 rpm, 10 min), and discard the supernatant; add 1 mL of 75% ethanol to wash the precipitate, centrifuge at low temperature and high speed (4°C, 12000 rpm, 5 min), discard the supernatant, open the lid to evaporate the ethanol for 5-10 min; add 40 μL RNase free water to dissolve RNA, perform concentration and quality tests, and store in a -80°C refrigerator for future use to obtain total RNA from Malan.
[0050] 2. Reverse transcription to obtain the cDNA of E. indigofera.
[0051] 1) Prepare the following mixture in an RNase-free centrifuge tube: 1 μg of horse blue RNA, 8 μL of RNase-free ddH2O, heat at 65°C for 5 min, quickly cool on ice, and let stand on ice for 2 min.
[0052] 2) Remove the residual genomic DNA in the RNA sample: 8 μL of the mixture in the previous step, 2 μL of 5×gDNA wiper mix, gently pipette to mix. Incubate at 42℃ for 2 min.
[0053] 3) Prepare the cDNA first-strand synthesis reaction solution: 10 μL of the previous mixture, 2 μL of 10×RT Mix, 2 μL of HiScript III Enzyme Mix, and Oligo(dT) 20 VN 1μL, RNase-free ddH2O 5μL, mix gently by pipetting.
[0054] 4) Perform the first-strand cDNA synthesis reaction under the following conditions: 25℃ for 5 min, 37℃ for 45 min, 85℃ for 5 sec. The product can be used immediately for PCR reaction.
[0055] S3, positive clone verification:
[0056] Using cDNA as template, specific primers, and HF high-fidelity enzyme, PCR reaction was performed to amplify gene fragments. After the amplified fragments were recovered from gel, they were constructed into Bluntzero vectors and PCR reaction was performed with Taq DNA polymerase to verify positive clones.
[0057] The specific primers are as follows:
[0058] ScFMO-For:TTCTATGGAGAAGAGGGTGGC;
[0059] ScFMO-Rev:TCAGAGCTGATGAGGACTAATTCC.
[0060] The PCR reaction procedure was as follows: 95°C for 3 min (pre-denaturation), 95°C for 15 sec, 60°C for 15 sec, 72°C for 1 min, 30 to 35 amplification cycles, and a final extension at 72°C for 5 min.
[0061] The flavin monooxygenase gene ScFMO was amplified by PCR reaction. The PCR reaction results were detected by agarose gel electrophoresis, and the target gene bands of 1575 bp were found, indicating that the amplification was successful. The results are as follows Figure 1 .
[0062] Example 2
[0063] This embodiment provides a method for constructing an indigo-producing Escherichia coli engineered bacterium, comprising the following steps:
[0064] 1) Use pET28a (kan resistance) for vector construction, combined with Figure 2 In the process, EcoRI and HindIII restriction sites were selected in the multiple cloning site of pET28a vector for double restriction digestion, and the linear vector was purified and recovered.
[0065] 2) Design specific primers pET28a-ScFMO-For and pET28a-ScFMO-Rev, use Bluntzero-ScFMO as a template, perform PCR, and obtain a linear target fragment.
[0066] 3) The ScFMO gene was added to the pET28a vector by In-Fusion cloning technology, and the recombinant plasmid was named pET28a-ScFMO.
[0067] 4) Transform pET28a-ScFMO into Escherichia coli BL21 (DE3) to obtain indigo Escherichia coli engineered bacteria.
[0068] Example 3 Expression of indigo Escherichia coli engineered bacteria
[0069] 1) The recombinant indigo Escherichia coli engineered bacteria obtained in Example 2 were inoculated into M9 medium and cultured at 37°C until OD 600The induction agent IPTG (0.1mM) was added, induced at 24℃ for 24h, and the cells were collected by high-speed centrifugation. The cell solution was resuspended in protein buffer, eluted through a nickel column, and eluted with protein elution buffer containing imidazole (concentration: 25, 50, 100, 200mM) in sequence. Samples were taken, SDS-PAGE was performed, and the recombinant protein was concentrated and desalted to obtain a relatively pure recombinant protein, such as Figure 3 .
[0070] 2) After 0-24 hours of fermentation, the indigo Escherichia coli engineered bacteria were photographed at different time points. It can be clearly observed that the color of the bacterial solution gradually darkened with the extension of fermentation time. Finally, the 24-hour fermentation liquid was centrifuged and recovered. Compared with the blank control (pET28a empty load), obvious indigo precipitation can be found, such as Figure 4 As shown, experiments have shown that the maximum indigo yield can reach 57.1 mg / L.
[0071] The technical features of the above embodiments may be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0072] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims
1. A flavin monooxygenase gene ScFMO from the medicinal plant Indigofera tinctoria, characterized in that: The nucleotide sequence of the flavin monooxygenase gene ScFMO is shown in SEQ ID No.
1.
2. The polypeptide encoded by the flavin monooxygenase gene ScFMO from the medicinal plant Indigofera tinctoria according to claim 1, characterized in that: The amino acid sequence of the polypeptide is shown in SEQ ID No.
2.
3. The method for preparing the flavin monooxygenase gene ScFMO from the medicinal plant Indigofera tinctoria according to claim 1, characterized in that: The medicinal plant Indigofera tinctoria was used as the experimental material, the total RNA was extracted, and the cDNA was obtained by reverse transcription. The nucleotide sequence of the ScFMO gene shown in SEQ ID No. 1 was amplified by PCR reaction using specific primers.
4. The method for preparing the flavin monooxygenase gene ScFMO from the medicinal plant Indigofera tinctoria according to claim 3, characterized in that: The specific primers used to amplify the gene sequence of the flavin monooxygenase gene ScFMO include: ScFMO-For: TTCTATGGAGAAGAGGGTGGC; ScFMO-Rev:TCAGAGCTGATGAGGACTAATTCC.
5. A recombinant vector containing the flavin monooxygenase gene ScFMO from the medicinal plant Indigofera tinctoria according to claim 1.
6. An engineered bacterium for producing indigo, characterized in that: Comprising the recombinant vector according to claim 5.
7. The indigo-producing engineered bacteria according to claim 6, characterized in that: The engineered bacteria are Escherichia coli engineered bacteria.
8. A method for producing indigo, characterized in that: The method comprises the following steps: placing the engineered bacteria according to claim 6 or claim 7 in LB medium or M9 medium, fermenting and culturing at 37°C until the OD value of the culture medium reaches the logarithmic phase; 600 is 0.4~0.7, add isopropyl-β-D-thiogalactoside inducer for induction culture, and collect the product.