Aspergillus niger base editing system, construction method and application thereof

Abstract

The application provides an Aspergillus niger base editing system and a construction method and application thereof. The editing efficiency of cytosine deaminase (AID) in the base editing system in Aspergillus niger is obviously higher than that of rat cytosine deaminase (rAPOBEC1) in the BEC system. When the same target gene (the same 20bp protospacer sequence in the AnpyrG gene An12g03570 in Aspergillus niger) is edited, the editing efficiency of the AID system is 93.8%, and the editing efficiency of the BEC system is 43.8%, which is more than doubled, further improving the efficiency of the base editing system in Aspergillus niger. The Target-AID system has high efficiency in the molecular breeding and host modification of Aspergillus niger, and provides a more efficient editing technology for the genetic engineering modification of Aspergillus niger.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology application, and mainly relates to a base editing system of Aspergillus niger, its construction method and application. Background Technology

[0002] CRISPR / Cas gene editing systems use Cas nucleases to disrupt and modify genes, precisely inducing DNA double-strand breaks (DSBs) at target sites. DSBs can be repaired through various mechanisms, including non-homologous end joining (NHEJ) mediated by the cell itself to induce random insertions or deletions, and homologous recombination repair (HDR) via the cell itself or by adding homologous DNA. Base editors (BEs) can perform precise nucleotide mutations at genomic DNA targets without DSBs, delivery of DNA donor templates, or reliance on HDR and NHEJ. Because base editing does not induce DSBs, it minimizes DNA damage caused by DSBs and unwanted random mutation insertions caused by NHEJ.

[0003] Base editors primarily consist of Cas9 (dCas9) or the cleavage enzyme Cas9 (nCas9) that has lost its nuclease activity, along with a deaminase. For example, the third-generation base editor BE3, developed by Komor et al., is a fusion protein composed of rat APOBEC1 (rAPOBEC1), nCas9, and a uracil glycosylase inhibitor (UGI). The single-guided RNA (sgRNA) consists of a 20-bp protospacer sequence that recognizes the target site and the downstream sgRNA scaffold sequence through base pairing. The target DNA contains a 20-bp target sequence followed by the essential 3-bp protospacer adjacent motif (PAM) 5'-NGG. The mature sgRNA guides nCas9 to a specific 20-nt genomic site, where nCas9 introduces a single-strand break in the target DNA upstream of the PAM. After BE3 binds to the target site mediated by sgRNA, rAPOBEC1 targets cytosine (C) to uracil (U). UGI inhibits DNA glycosidase to remove U, which is then converted to thymine (T) through DNA replication or repair.

[0004] Aspergillus niger has long been used in industrial production due to its naturally high secretory capacity, including the production of homologous and heterologous proteins. The continuous improvement of genetic engineering technology has enabled microbial breeding to move from traditional random mutagenesis to targeted modification. Although the CRISPR / Cas9 genome editing tool for filamentous fungi has greatly improved the efficiency of modification, in order to increase the probability of homologous recombination during genetic modification, it is necessary to eliminate the repair mechanism of non-homologous end joining by knocking out the Ku70 / Ku80 gene. After knocking out Ku70 / Ku80, when knocking out genes using CRISPR / Cas9, donor DNA is often needed to prevent Cas9 cleavage from causing double-strand breaks (DSBs) that would prevent normal cell growth. Huang Lianggang et al. first constructed the BEC system in filamentous fungi and achieved point mutations in the pyrG, fwnA, and prtT genes. However, the BEC system still has certain limitations in its application in filamentous fungi. For example, the editing efficiency at certain gene sites is not high, and the editing process is limited by PAM sites, preventing the achievement of base mutations in the target gene sequence. Therefore, further optimization of the base editing system for filamentous fungi is of great significance for the genetic modification of filamentous fungi. Summary of the Invention

[0005] In order to overcome the shortcomings and deficiencies of the existing technology and further optimize the base editing system of filamentous fungi, the primary objective of this invention is to provide a base editing system for Aspergillus niger that overcomes the problems of PAM (5'-NGG) limitation and low editing efficiency of the BEC system in filamentous fungi.

[0006] Another objective of this invention is to provide a method for constructing a cytosine base editing system, which includes a fusion protein of cytosine deaminase, uracil glycosidase inhibitor, and nCas9 (NGG, NGN, NRY).

[0007] Another object of the present invention is to provide a method for editing the bases of Aspergillus niger.

[0008] Another objective of this invention is to provide an application of an Aspergillus niger base editing system in the mutation or knockout of Aspergillus niger genes.

[0009] Another objective of this invention is the application of the Target-AID-NGN / NRY base editing system and its application in knocking out glycated background protein glycosylation enzyme (glaA).

[0010] The objective of this invention is achieved through the following technical solution:

[0011] A base editing system for Aspergillus niger, comprising the Target-AID-NGG plasmid obtained by replacing the rAPOBEC1 gene in the pFC332-BEC plasmid with the AID gene.

[0012] The nucleotide sequence of the AID gene is the nucleotide sequence shown in SEQ ID NO.2 or its complementary sequence.

[0013] The Aspergillus niger base editing system further includes at least one of the following: a Target-AID-NGN plasmid in which a partial NGN mutant sequence is constructed onto a Target-AID-NGG plasmid, and a Target-AID-NRY plasmid in which a partial NRY mutant sequence is constructed onto a Target-AID-NGG plasmid.

[0014] The nucleotide sequence of the NGN partial mutant sequence is the nucleotide sequence shown in SEQ ID NO.3 or its complementary sequence.

[0015] The nucleotide sequence of the NRY partial mutant sequence is the nucleotide sequence shown in SEQ ID NO.4 or its complementary sequence.

[0016] The Target-AID-NGG plasmid can identify PAM sequences as NGG editing sites.

[0017] The Target-AID-NGN plasmid is obtained by constructing a partial NGN mutant sequence onto the nCas9 gene to obtain the nCas-NGN gene, which can recognize the PAM sequence as the NGN editing site.

[0018] The Target-AID-NRY plasmid is obtained by constructing a partial NRY mutant sequence onto the nCas9 gene to obtain the nCas-NRY gene. It can more efficiently identify PAM sequences as NRY editing sites and is PAM-free.

[0019] The aforementioned Aspergillus niger base editing system achieves the editing of specific bases by inserting sgRNA.

[0020] The sgRNA is an sgRNA capable of recognizing a specific protospacer sequence; preferably, it is an sgRNA driven by the U6 promoter.

[0021] A method for constructing a base editing system for Aspergillus niger includes the following steps:

[0022] (1) Synthesize the AID gene fragment, the nucleotide sequence of which is shown in SEQ ID NO.2;

[0023] (2) Using pFC332-BEC plasmid as a template, Ptef and link-nCas fragments were obtained;

[0024] (3) Linearize the pFC332 plasmid and ligate it with the AID gene fragment, Ptef and link-nCas fragment to obtain the Target-AID-NGG vector of Aspergillus niger base editing system.

[0025] The construction method further includes the following steps:

[0026] (4) Synthesize the NGN mutant sequence fragment, the nucleotide sequence of which is shown in SEQ ID NO.3;

[0027] (5) Using the Target-AID-NGG vector as a template, SpG-2, SpG-3 and SpG-4 fragments were obtained;

[0028] (6) Linearize the pFC332 plasmid and ligate it with the NGN mutant sequence fragment, SpG-2, SpG-3 and SpG-4 to obtain the Target-AID-NGN vector of Aspergillus niger base editing system;

[0029] or

[0030] (4) Synthesize the NRY mutant sequence fragment, the nucleotide sequence of which is shown in SEQ ID NO.4;

[0031] (5) Using the Target-AID-NGG vector as a template, SpRY-1, SpRY-2, SpRY-3 and SpRY-4 fragments were obtained;

[0032] (6) Linearize the pFC332 plasmid and ligate it with the NRY mutant sequence fragment, SpRY-1, SpRY-2, SpRY-3 and SpRY-4 to obtain the Target-AID-NRY vector of Aspergillus niger base editing system.

[0033] The method for obtaining the fragment in step (2) is to perform PCR amplification using primers; preferably, primers 332-Ptef-F and Ptef-R are used to amplify the Ptef fragment, and primers AID-link-nCas-F and Ptef-R ncas9-Ttef-R are used to amplify the link-nCas fragment.

[0034] The linearization described in steps (3) and (6) is performed by double digestion with restriction endonucleases PacI and PmlI.

[0035] The ligation described in steps (3) and (6) involves using the in-fusion method to ligate DNA fragments into circular plasmids.

[0036] The method for obtaining SpG-2, SpG-3 and SpG-4 fragments in step (5) is to perform PCR amplification using primers; preferably, the SpG-2 fragment is amplified using primers 332-Ptef-F and SpRY-2-R, the SpG-3 fragment is amplified using primers SpRY-3-F and SpRY-3-R, and the SpG-4 fragment is amplified using primers SpRY-4-F and SpRY-4-R.

[0037] The method for obtaining the SpRY-1, SpRY-2, SpRY-3 and SpRY-4 fragments in step (5) is to perform PCR amplification using primers; preferably, the SpRY-1 fragment is obtained by amplifying with primers 332-Ptef-F and SpRY-1-R, the SpRY-2 fragment is obtained by amplifying with primers SpRY-2-F and SpRY-2-F, the SpRY-3 fragment is obtained by amplifying with primers SpRY-3-F and SpRY-3-R, and the SpRY-4 fragment is obtained by amplifying with primers SpRY-4-F and SpRY-4-R.

[0038] A method for editing the bases of Aspergillus niger includes the following steps:

[0039] (1) Design and synthesize sgRNA sequences;

[0040] (2) Linearize the Target-AID vector, ligate it with the sgRNA sequence, transform it into E. coli, and extract and sequence it to obtain the sgRNA-Target-AID vector;

[0041] (3) Prepare Aspergillus niger protoplasts, transfer the sgRNA-Target-AID vector into the protoplasts, and screen for transformants.

[0042] The sgRNA sequence mentioned in step (1) is an sgRNA that can recognize a specific protospacer sequence; preferably, it is an sgRNA driven by the U6 promoter.

[0043] The Target-AID vector mentioned in step (2) is at least one of Target-AID-NGG, Target-AID-NGN or Target-AID-NRY; preferably, the most suitable Target-AID vector is selected according to the PAM sequence of the edit site.

[0044] The Target-AID-NGG vector is capable of editing a PAM sequence to an NGG site, where N is any nucleotide; preferably, it is capable of editing a PAM sequence to an CGG site.

[0045] The Target-AID-NGN vector is capable of editing a PAM sequence to an NGN site, where N is any nucleotide; preferably, it is capable of editing a PAM sequence to a TGC, GGA, or GGT site; more preferably, it is capable of editing a PAM sequence to a TGC site.

[0046] The Target-AID-NRY vector is capable of editing a PAM sequence to an NRY site, where N is any nucleotide, R is A or G, and Y is C or T / U; preferably, it is capable of editing a PAM sequence to a TGC or TAC site; more preferably, it is capable of editing a PAM sequence to a TGC site.

[0047] The linearization described in step (2) is achieved by digestion with the restriction endonuclease MssI.

[0048] The Escherichia coli mentioned in step (2) is E. coli Mach1-T1.

[0049] The Aspergillus niger mentioned in step (3) is Aspergillus niger CBS513.88.

[0050] The above-mentioned Aspergillus niger base editing system is used in the mutation or knockout of Aspergillus niger genes.

[0051] The present invention has the following advantages and effects compared with the prior art:

[0052] (1) The cytosine deaminase (AID) in the base editing system of this invention has a significantly higher editing efficiency in Aspergillus niger than the rat cytidine deaminase (rAPOBEC1) in the BEC system. When editing with the same target gene (the same 20bp protospacer sequence in the AnpyrG gene An12g03570 in Aspergillus niger), the editing efficiency of the AID system is 93.8%, while that of the BEC system is 43.8%, which is more than double the editing efficiency, further improving the efficiency of the base editing system in Aspergillus niger.

[0053] (2) This invention uses the optimized nCas9 mutants NGN and NRY from Aspergillus niger to further overcome the PAM (5'-NGG) restriction and achieve genomic base editing of Aspergillus niger with many PAM types, including NGA, NGC, NGT and NAC, in addition to NGG.

[0054] (3) This invention utilizes optimized nCas9 mutants NGN and NRY from Aspergillus niger. Editing efficiency varies across different types of PAMs. When all PAMs are 5'-NGG, Target-AID-NGG is more efficient than Target-AID-NGN, and Target-AID-NGN is more efficient than Target-AID-NRY. Taking AnpyrG (gene An12g03570) from Aspergillus niger as an example, this study demonstrates how to select a more efficient Target-AID system for base editing in the Aspergillus niger genome based on different PAM types.

[0055] (4) This invention utilizes the optimized Target-AID-NGN system from *Aspergillus niger* to knock out the overexpressed background protein glucoamylase (glaA). Without causing double-strand breaks in the *Aspergillus niger* genome, the glucoamylase gene expression was efficiently inactivated, and SDS-PAGE gel imaging showed that the overexpressed background protein glucoamylase in the fermentation sample was completely knocked out. This efficient knockout of glucoamylase further validates the high efficiency of the Target-AID system in molecular breeding and host modification of *Aspergillus niger*, providing a more efficient editing technology for genetic engineering modification of *Aspergillus niger*. Attached Figure Description

[0056] Figure 1 This is a schematic diagram of the plasmid structure of the filamentous fungal base editing system provided by the present invention.

[0057] Figure 2 This is a schematic diagram of the Aspergillus niger BEC system and the Target-AID (NGG, NGN, NRY) base editing system in Example 1. The promoter Ptef drives the expression of the fusion protein, in which the NGG, NG, or NRY protein is responsible for the cleavage of DNA single strands, the AID protein is responsible for the deamination of cytosine (C), and the UGI protein inhibits the function of DNA self-repair.

[0058] Figure 3 This is a schematic diagram comparing the editing efficiency of the BEC system and Target-AID (NGG, NGN, NRY) for the same target sequence AnpyrG of Aspergillus niger in Example 1. After Target-AID editing, the C at the template underline becomes T, and the PAM sequence is 5'-CGG.

[0059] Figure 4 This is a sequencing image of the edited Target-AID (NGG, NG, NRY) transformants of the same target sequence AnpyrG from Aspergillus niger in Example 1. The box indicates that C was changed to T after editing.

[0060] Figure 5This is a schematic diagram illustrating the editing efficiency of Target-AID-NGN-GGA, Target-AID-NGN-TGC, Target-AID-NGN-GGT, Target-AID-NRY-GAT, Target-AID-NRY-AGT, Target-AID-NRY-TAC, and Target-AID-NRY-TGC in Aspergillus niger CBS513.88 in Example 2.

[0061] Figure 6 This is the sequencing results of the Target-AID-NGN transformant in Example 2. Since the Target-AID-NGN-GGT region encodes the negative strand, the positive strand after editing is changed from G to A. The sequencing results of the Target-AID-NGN-TGC and Target-AID-NGN-GGA transformants are shown in the box, where C is changed to T after editing.

[0062] Figure 7 This is the sequencing results of the Target-AID-NRY transformant edited in Aspergillus niger in Example 2. The sequencing results of the Target-AID-NRY-TAC and Target-AID-NRY-TGC transformants edited are shown in the box, where C is changed to T after editing.

[0063] Figure 8 This is a sequencing image of the genome editing results of Target-AID-NGN-KoglaA in Aspergillus niger in Example 3. The box indicates that C was changed to T after editing.

[0064] Figure 9 This is an SDS-PAGE gel image of the transformant in Aspergillus niger edited with Target-AID-NGN-KoglaA in Example 3, fermented to day 6. It can be seen that the saccharifying enzyme band near 100kDa has completely disappeared. Detailed Implementation

[0065] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0066] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0067] The molecular biology experimental techniques used in the following examples include PCR amplification, plasmid extraction, DNA fragment ligation, gel electrophoresis, etc. For details, please refer to "Molecular Cloning: A Laboratory Manual" (3rd edition) (translated by Sambrook J, Russell DW, Janssen K, Argentine J, Huang Peitang et al., 2002, Beijing: Science Press).

[0068] The formulation of hypertonic CD medium is as follows: containing 1M sucrose, 0.3% (w / v) NaNO3, 0.2% (w / v) KCl, 0.05% (w / v) MgSO4·7H2O, 0.1% (w / v) K2HPO4·3H2O, 0.001% (w / v) FeSO4·7H2O, 2% (w / v) agar powder, pH 5.5, where w / v is in g / mL.

[0069] The formulation of CD solid medium is as follows: containing 2% (w / v) glucose, 0.3% (w / v) NaNO3, 0.2% (w / v) KCl, 0.05% (w / v) MgSO4·7H2O, 0.1% (w / v) K2HPO4·3H2O, 0.001% (w / v) FeSO4·7H2O, 2% (w / v) agar powder, pH 5.5, where w / v is in g / mL.

[0070] The formulation of CD liquid culture medium is as follows: it contains 2% (w / v) glucose, 0.3% (w / v) NaNO3, 0.2% (w / v) KCl, 0.05% (w / v) MgSO4·7H2O, 0.1% (w / v) K2HPO4·3H2O, 0.001% (w / v) FeSO4·7H2O, 0.05% (w / v) agar powder, pH 5.5, where w / v is in g / mL.

[0071] The fermentation medium is formulated as follows: it contains 5% starch, 3% corn steep liquor, 2% soybean meal powder, and the remainder is water. The percentage sign here indicates the mass percentage content.

[0072] Example 1: Construction of Target-AID (SpCas9n / NGG, NGN, NRY) base editing system in Aspergillus niger CBS513.88 and comparison of editing efficiency of SpCas9n / NGG, NGN and NRY in the system (BEC system)

[0073] (1) Synthesis of gene fragments: The amino acid sequence of cytidine deaminase (AID) is shown in SEQ ID NO.1 (NCBI database Sequence ID: ABO15149.1). Based on the previous research results of the research group, the optimized nucleotide sequence of AID after codon optimization for the Aspergillus niger expression system is shown in SEQ ID NO.2. In order to expand the recognition range of PAM sequence, mutants of the nCas9 gene, nCas-NGN and nCas-NRY, were designed. nCas-NGN was obtained by replacing part of the NGN mutant sequence, and its nucleotide sequence is shown in SEQ ID NO.3. nCas-NRY was obtained by replacing part of the NRY mutant sequence, and its nucleotide sequence is shown in SEQ ID NO.4. All the above genes were synthesized at Genscript Biotech Co., Ltd.

[0074] (2) PCR amplification of gene fragments: Using the PFC332-BEC plasmid preserved in the laboratory (plasmid source reference: Huang Lianggang. Study on transcriptional regulation mechanism at the genome level of Aspergillus niger [D]. South China University of Technology, 2020. DOI:10.27151 / d.cnki.ghnlu.2020.000068.) as a template, and the synthesized gene sequence SEQ ID NO.2 as a template, primers were used to amplify the DNA fragments so that they contained homologous fragments of about 20 bp with the adjacent fragments.

[0075] Target-AID-NGG fragment: Ptef (using pFC332-BEC plasmid as template, primers 332-Ptef-F and Ptef-R), link-nCas (using pFC332-BEC plasmid as template, primers AID-link-nCas-F and Ptef-R ncas9-Ttef-R), AID (synthesized by Genscript Biotech in step 1, SEQ ID NO.2, primers are Ptef-AID-F and AID-R);

[0076] The size of the PCR product was consistent with that of the target product. For PCR products with impurities, agarose gel recovery was performed, and the rest of the column was recovered.

[0077] 332-Ptef-F:tagctgtttccgctgagggtGTTTAAACcgagacagcagaatcaccgc

[0078] Ptef-R:ggtgaaggttgtgttatgttttgt

[0079] Ptef-AID-F:aacataacacaaccttcaccATGACCGATGCCGAATATGTGC

[0080] AID-R: GACAGCGGGGCTTTTAGTTGTA

[0081] AID-link-nCas-F: CAACTAAAAGCCCCGCTGTCagcggttccgagaccccgg

[0082] ncas9-Ttef-R:ggcataaatcgaatgtccgcctacaccttgcgctttttcttgg

[0083] (3) The pFC332 plasmid (CS, Nielsen, JB, Kogle, ME, & Mortensen, UH (2015). A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS One, 10(7), e0133085.) was double-digested with restriction endonucleases PacI (purchased from New England Biolabs (Beijing) LTD.) and PmlI (purchased from New England Biolabs (Beijing) LTD.). The linearized nucleic acid fragment containing the hygB marker, the ampicillin resistance gene AmpR, and the filamentous fungal autonomous replication sequence AMA1 was recovered by gel electrophoresis and gel excision.

[0084] (4) Construction of the Target-AID-NGG vector: The Ptef, link-nCas, AID obtained in step (2) and the fragments recovered after double digestion with restriction endonucleases PacI and PmlI obtained in step (3) were ligated into a circular plasmid using the in-fusion method (see NEBuilder's Hi Fi DNA Assembly Master Mix for specific operation methods) to construct the nCas9 base editing plasmid pFC332-AID (pFC332-AID-XTEN-nCas9-UGI). The plasmid was first transformed into E. coli (E. coli Mach1-T1 purchased from Takara) by chemical transformation to obtain positive clones. After sequencing, the plasmid was extracted to obtain the Target-AID-NGG vector.

[0085] (5) PCR amplification of NGN / NRY gene fragments:

[0086] Target-AID-NGN fragments: SpG-2 (using the Target-AID-NGG plasmid as a template, primers 332-Ptef-F and SpRY-2-R), SpG-3 (using the synthesized NGN partial mutant sequence as a template, primers SpG\RY-3-F and SpG\RY-3-R), SpG-4 (using the Target-AID-NGG plasmid as a template, primers SpG\RY-4-F and SpG\RY-4-R);

[0087] Target-AID-NRY fragments: SpRY-1 (using Target-AID-NGG plasmid as template, primers 332-Ptef-F and SpRY-1-R), SpRY-2 (using pFC332-BEC plasmid as template, primers SpG\RY-2-F and SpG\RY-2-F), SpRY-3 (using the synthesized NRY partial mutant sequence as template, primers SpG\RY-3-F and SpG\RY-3-F), and SpRY-4 (using Target-AID-NGG plasmid as template, primers SpG\RY-4-F and SpG\RY-4-R).

[0088] SpRY-1-R:tcgagtacgttcggcggtctccccactat

[0089] SpRY-2-F:gccgaacgtactcgactgaagcgaacggct

[0090] SpG\RY-2-R:tgtctgcacctcggttttcttg

[0091] SpG\RY-3-F:caagaaaaccgaggtgcagaca

[0092] SpG\RY-3-R:tgaatcagggtcgcatcaagca

[0093] SpG\RY-4-F:tgcttgatgcgaccctgattca

[0094] SpG\RY-4-R:TTGGGGTGGACGAGAAAACTAC

[0095] (6) Construction of Target-AID-NGN / NRY vectors: The fragments of PFC332 obtained in step (3) after double digestion with restriction endonucleases PacI and PmlI, the SpG-2, SpG-3, and SpG-4 fragments of Target-AID-NGN obtained in step (2), and the SpRY-1, SpRY-2, SpRY-3, and SpRY-4 fragments of Target-AID-NRY obtained in step (5) were ligated into circular plasmids using the in-fusion method to construct Target-AID-NGN and Target-AID-NRY base editing plasmids. The plasmids were first transformed into E. coli (E. coli Mach1-T1) by chemical transformation to obtain positive clones. After sequencing, the plasmids were extracted to obtain Target-AID-NGN and Target-AID-NRY plasmids (see Figure 1 (AID sequence SEQ ID NO.2; NGN partial sequence SEQ ID NO.3; NRY partial sequence SEQ ID NO.4).

[0096] (7) AnpyrG fragment (using pFC332-BEC-AnpyrG as a template, primers PU6-F and TU6-Ptef-R were used; Huang Lianggang. Study on transcriptional regulation mechanism at the genome level of Aspergillus niger [D]. South China University of Technology, 2020. DOI:10.27151 / d.cnki.ghnlu.2020.000068.)

[0097] PU6-F: tagctgtttccgctgagggtgcaggcggttgcaagcgatc

[0098] TU6-Ptef-R:gcggtgattctgctgtctcgTTAATTAAagcagctctatatcacgtgacg

[0099] (8) Construction of AnpyrG-Target-AID (NGG, NGN, NRY) vectors:

[0100] When constructing the Target-AID (NGG, NGN, NRY) plasmids, a MssI restriction site was reserved before the Ptef element to facilitate the insertion of sgRNA; the inserted sgRNA is responsible for guiding the specific editing location of the Target-AID (NGG, NGN, NRY) fusion protein in the genome. Target-AID-NGG, Target-AID-NGN, and Target-AID-NGN were digested with the restriction endonuclease MssI (purchased from New England Biolabs (Beijing) LTD.) respectively. The Target-AID-NGG, Target-AID-NGN, and Target-AID-NGN fragments obtained by enzyme digestion and linearization were ligated with the AnpyrG fragment obtained in step (7) to form a circular plasmid. The plasmid was first transformed into E. coli (E. coli Mach1-T1) by chemical transformation to obtain positive clones. After sequencing, the plasmid was extracted to obtain AnpyrG-Target-AID (NGG, NGN, NRY) respectively (the inserted sgRNA is from the reference Huang Lianggang. Study on transcriptional regulation mechanism at the genome level of Aspergillus niger [D]. South China University of Technology, 2020. DOI:10.27151 / d.cnki.ghnlu.2020.000068.).

[0101] (9) Expression of the base editing vector in Aspergillus niger CBS513.88:

[0102] Preparation of protoplasts of the host bacterium *Aspergillus nidulans* CBS513.88 (specific steps refer to the literature Gomi K, Iimura Y, Hara S. Integrative transformation of *Aspergillus oryzae* with a plasmid containing the *Aspergillus nidulans* argB gene [J]. Agricultural and Biological Chemistry, 1987, 51(9):2549-2555.), the base editing vectors AnpyrG-Target-AID (NGG, NGN, NRY) and pFC332-BEC-AnpyrG (source: Huang Lianggang. Study on transcriptional regulation mechanism at the genome level of Aspergillus niger [D]. South China University of Technology, 2020. DOI:10.27151 / d.cnki.ghnlu.2020.000068.) obtained in step (8) were transformed into protoplasts, plated on hypertonic CD medium containing 100mM hygromycin and 10mM uracil nucleoside (U) at a final concentration, and placed in a 30℃ incubator. The growth of transformants was observed after 5 days.

[0103] After the transformants grew on the hyperosmolar CD plates, they were picked and transferred to CD solid medium containing 0.1% (w / v) 5-fluoroorotic acid (5-FOA) and 10 mM uracil nucleoside (U). The plates were then incubated at 30°C for 3 days until colonies grew. After colonies grew, the transformants of AnpyrG-Target-AID (NGG, NGN, NRY) and pFC332-BEC-AnpyrG were counted to obtain the editing efficiency. The results are as follows: Figure 3 As shown.

[0104] (10) PCR and Sanger sequencing of target sites in Aspergillus niger transformants:

[0105] Transformants successfully grown on CD solid medium containing 5-fluoroorotic acid and uridine in step (7) were selected, and their genomes were extracted as PCR templates to amplify a portion of the AnpyrG gene. Primers for amplifying the AnpyrG partial sequence were designed as follows:

[0106] AnpyrG-F:GAATGGGCCCACATCATCAACT

[0107] AnpyrG-R:GTATTAGTTTTCCGCCGACACG

[0108] Sequencing results of Target-AID-AnpyrG transformants are as follows: Figure 4 As shown.

[0109] Example 2: Editing efficiency of different PAM sequences in the Target-AID-NGN / NRY base editing system of Aspergillus niger CBS513.88

[0110] (1) Construction of the universal vector Target-AID-NGN / NRY-1: In order to make it easier to change different sgRNAs, in this embodiment, the U6 promoter is linked to the vector to construct the universal vector Target-AID-NGN / NRY-1. The Target-AID-NGN / NRY vector obtained in step (6) of Example 1 is digested with the restriction endonuclease MssI and then linked with the U6-Mss1-PacI fragment (which is amplified using AnpyrG-Target-AID-NGN in Example 1 as a template and primers PU6-F and U6-Mss1-PacI-R).

[0111] PU6-F: tagctgtttccgctgagggtgcaggcggttgcaagcgatc

[0112] U6-Mss1-PacI-R:

[0113] ggtgattctgctgtctcgTTAATTAAGTTTAAAACCtttcattcttacagacctcttttg

[0114] The enzyme-digested Target-AID-NGN / NRY fragment and the U6-Mss1-PacI fragment were ligated into circular plasmids using the in-fusion method. The plasmids were then transformed into E. coli (E. coli Mach1-T1) by chemical transformation to obtain positive clones. After sequencing, the plasmids were extracted to obtain the universal vectors Target-AID-NGN / NRY-1.

[0115] (2) Vector construction of different PAM sequence types for Target-AID-NGN / NRY

[0116] Using bioinformatics methods, different PAM sequence types of NGN and NRY were designed based on AnpyrG (gene An12g03570) from Aspergillus niger CBS513.88. After Target-AID base editing, a stop codon was formed prematurely during gene transcription, causing the AnpyrG gene to be inactivated, resulting in the protospacer sequence (20 bp) shown in Table 1. Using AnpyrG-Target-AID-NGN from Example 1 as a template, DNA fragments were amplified to include homologous fragments of approximately 20 bp with adjacent fragments. Primers were TU6-Ptef-R and U6-NG-GGA-sg-F, U6-NG-TGC-sg-F, U6-NG-GGT-sg-F, U6-NRY-GAT-sg-F, U6-NRY-AGT-sg-F, U6-NRY-TAC-sg-F, and U6-NRY-TGC-sg-F, respectively.

[0117] Table 1. Protospacer sequences corresponding to different PAM sequences.

[0118]

[0119]

[0120] Design primers:

[0121] TU6-Ptef-R:gcggtgattctgctgtctcgTTAATTAAagcagctctatatcacgtgacg

[0122] U6-NG-GGA-sg-F:

[0123] agaggtctgtaagaatgaaaGGCTGCGCAACAGTATCAGAAgttttagagctagaaatagcaagt

[0124] U6-NG-TGC-sg-F:

[0125] agaggtctgtaagaatgaaaGGCGTCTGGTACTGCTGACCAgttttagagctagaaatagcaagt

[0126] U6-NG-GGT-sg-F:

[0127] agaggtctgtaagaatgaaaGGCCCATTCCGAGATACGGAGgttttagagctagaaatagcaagt

[0128] U6-NRY-GAT-sg-F:

[0129] agaggtctgtaagaatgaaaGGGCTTCCCACCCCTCCTTCTgttttagagctagaaatagcaagt

[0130] U6-NRY-AGT-sg-F:

[0131] agaggtctgtaagaatgaaaGTCCGGTGCAGGCTGCGCAACgttttagagctagaaatagcaagt

[0132] U6-NRY-TAC-sg-F:

[0133] agaggtctgtaagaatgaaaGCAGAAGCAATACCACGGCGGgttttagagctagaaatagcaagt

[0134] U6-NRY-TGC-sg-F:

[0135] agaggtctgtaagaatgaaaGAAGTCGCGATTGACCTACACgttttagagctagaaatagcaagt

[0136] The seven fragments obtained after the amplification were ligated into circular plasmids by in-fusion with the universal vector Target-AID-NGN / NRY-1, which was digested with restriction endonucleases Mss1 and PacI. The plasmids were then transformed into E. coli (E. coli Mach1-T1) by chemical transformation to obtain positive clones. After sequencing, the plasmids were extracted to obtain the plasmid vectors Target-AID-NGN-GGA, Target-AID-NGN-TGC, Target-AID-NGN-GGT, Target-AID-NRY-GAT, Target-AID-NRY-AGT, Target-AID-NRY-TAC, and Target-AID-NRY-TGC.

[0137] (3) Expression and editing efficiency statistics of base editing vector in Aspergillus niger CBS513.88:

[0138] Following the method in step (9) of Example 1, protoplasts of the host bacterium Aspergillus niger CBS513.88 were prepared. The base editing vector plasmids Target-AID-NGN-GGA, Target-AID-NGN-TGC, Target-AID-NGN-GGT, Target-AID-NRY-GAT, Target-AID-NRY-AGT, Target-AID-NRY-TAC, and Target-AID-NRY-TGC obtained above were transformed into the protoplasts. The protoplasts were coated with hypertonic CD medium containing 100 mM hygromycin and 10 mM uracil nucleoside (U) and placed in a 30°C incubator. The growth of the transformants was observed after 5 days.

[0139] After the transformants grew on the hypertonic CD medium, they were picked and transferred to CD solid medium containing 0.1% (w / v) 5-fluoroorotic acid (5-FOA) and 10 mM uracil nucleoside (U). The medium was then incubated at 30°C for 3 days until colonies grew. After colonies grew, the transformants from the seven groups were counted to obtain the editing efficiency (see [link to article]). Figure 5 ).

[0140] (4) PCR and Sanger sequencing of target sites in Aspergillus niger transformants:

[0141] Transformants successfully grown on CD solid medium containing 5-fluoroorotic acid and uridine in step (3) were selected, and transgenic genomes were extracted and used as PCR templates to amplify a portion of the AnpyrG gene. Primers for amplifying the AnpyrG partial sequence were designed as follows:

[0142] VerifyAnpyrG_up-F:CCCACGGGTCGGAGGCGG

[0143] Verify An_pyrg_dw-R: CACCCGTCGCCATTTTCTCTAC

[0144] Sequencing results of Target-AID-NGN transformants are shown below. Figure 6 Sequencing results of Target-AID-NRY transformants are shown in [link to relevant documentation]. Figure 7 .

[0145] Example 3: Application of the Target-AID-NGN base editing system in Aspergillus niger HL-1 for knocking out the overexpressed background protein glycanylase (glaA)

[0146] (1) Construction of the Target-AID-NGN-Ko glaA vector: Using bioinformatics methods, an NG-type base editing was designed based on the glaA (gene An03g06550) of Aspergillus niger CBS513.88 on the website (http: / / www.rgenome.net / cas-designer / ). After Target-AID-NGN base editing, the stop codon was formed prematurely during gene transcription, causing the glaA gene expression to terminate, and a 20bp protospacer (GCTCAATACTGGAACCAGAC) sequence was obtained. Using AnpyrG-Target-AID-NGN obtained in step (8) of Example 1 as a template, the DNA fragment was amplified to carry a homologous fragment of about 20 bp with the adjacent fragment. The primers were TU6-Ptef-R and U6-NG-glaA-sg-F, respectively. The plasmid was ligated with the universal vector Target-AID-NGN-1, which was digested with restriction endonucleases Mss1 and PacI, to form a circular plasmid. The plasmid was first transformed into E. coli (E. coli Mach1-T1) by chemical transformation to obtain a positive clone. After sequencing, the plasmid was extracted to obtain the plasmid vector Target-AID-NGN-Ko glaA.

[0147] U6-NG-glaA-sg-F:

[0148] agaggtctgtaagaatgaaaGGCTCAATACTGGAACCAGACgttttagagctagaaatagcaagt

[0149] TU6-Ptef-R:

[0150] gcggtgattctgctgtctcgTTAATTAAagcagctctatatcacgtgacg

[0151] (2) Expression of Target-AID-NGN-KoglaA in Aspergillus niger:

[0152] Following the method in step (9) of Example 1, protoplasts of Aspergillus niger CBS513.88 were prepared. The base editing vector plasmid Target-AID-NGN-Ko glaA obtained above was transformed into the protoplasts. The protoplasts were coated with hypertonic CD medium containing 100mM hygromycin and placed in a 30℃ incubator. The growth of the transformants was observed after 5 days.

[0153] After the transformants grew on the hyperosmolar CD plate, the transformants were picked and transferred to CD solid medium and incubated at 30°C for 3 days until the colonies grew. After the colonies grew, the transgenic genome was extracted and used as a PCR template to amplify the glaA gene.

[0154] Design primers for partial glaA sequence amplification.

[0155] KoglaA-F:TACTTCTACACCTGGACTCGCG

[0156] KoglaA-R:CAACAGCCTCGCTGTCACTGA

[0157] Transformant sequencing results as follows Figure 8 As shown.

[0158] (3) Target-AID-NGN-KoglaA Aspergillus niger positive transformants were inoculated into liquid CD and fermentation medium:

[0159] In step (2), the correctly identified transformants were scraped from CD solid medium, ground with sterile water using a low-speed tissue homogenizer, and then inoculated into CD liquid medium. After static incubation at 30°C for 5 days, they were inoculated into fermentation medium and fermented at 30°C with a shaking speed of 220 rpm. On the sixth day of fermentation, the protein content in the supernatant was detected by SDS-PAGE. Protein gel electrophoresis image (see...) Figure 9 The results showed that the glycating enzyme (glaA) protein band above 100 kDa completely disappeared.

[0160] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A base editing system for Aspergillus niger, characterized in that: This includes at least one of the following: a Target-AID-NGG plasmid obtained by replacing the rAPOBEC1 gene in the pFC332-BEC plasmid with the AID gene; a Target-AID-NGN plasmid constructed with a partial NGN mutant sequence on the Target-AID-NGG plasmid; and a Target-AID-NRY plasmid constructed with a partial NRY mutant sequence on the Target-AID-NGG plasmid. The nucleotide sequence of the AID gene is the nucleotide sequence shown in SEQ ID NO.2; The nucleotide sequence of the NGN partial mutant sequence is the nucleotide sequence shown in SEQ ID NO.3; The nucleotide sequence of the NRY partial mutant sequence is the nucleotide sequence shown in SEQ ID NO.4; The Target-AID-NGG plasmid can identify PAM sequences as NGG editing sites; The Target-AID-NGN plasmid is obtained by constructing a partial NGN mutant sequence onto the nCas9 gene to obtain the nCas-NGN gene, which can recognize the PAM sequence as the NGN editing site; The Target-AID-NRY plasmid is obtained by constructing a partial NRY mutant sequence into the nCas9 gene to obtain the nCas-NRY gene. It can more efficiently identify PAM sequences as NRY editing sites and is not limited by PAM. The aforementioned Aspergillus niger base editing system achieves the editing of specific bases by inserting sgRNA; The sgRNA mentioned is an sgRNA that can recognize a specific protospacer sequence.

2. A method for constructing a base editing system of Aspergillus niger, characterized in that... Includes the following steps: (1) Synthesize the AID gene fragment, the nucleotide sequence of which is shown in SEQ ID NO.2; (2) Using pFC332-BEC plasmid as a template, Ptef and link-nCas fragments were obtained; (3) Linearize the pFC332 plasmid and ligate it with the AID gene fragment, Ptef and link-nCas fragment to obtain the Target-AID-NGG vector of Aspergillus niger base editing system; It also includes steps (4-1), (5-1) and (6-1), or steps (4-2), (5-2) and (6-2); (4-1) Synthesize the NGN mutant sequence fragment, the nucleotide sequence of which is shown in SEQ ID NO.3; (5-1) Using the Target-AID-NGG vector as a template, SpG-2, SpG-3 and SpG-4 fragments were obtained; (6-1) The pFC332 plasmid was linearized and ligated with the NGN mutant sequence fragment, SpG-2, SpG-3 and SpG-4 to obtain the Target-AID-NGN vector of Aspergillus niger base editing system; (4-2) Synthesize the NRY mutant sequence fragment, the nucleotide sequence of which is shown in SEQ ID NO.4; (5-2) Using the Target-AID-NGG vector as a template, the SpRY-1, SpRY-2, SpRY-3 and SpRY-4 fragments were obtained; (6-2) The pFC332 plasmid was linearized and ligated with NRY mutant sequence fragments, SpRY-1, SpRY-2, SpRY-3 and SpRY-4 to obtain the Target-AID-NRY vector of Aspergillus niger base editing system; The linearization described in steps (3), (6-1), and (6-2) is performed by double digestion with the restriction endonucleases PacI and PmlI. The ligation described in steps (3), (6-1), and (6-2) involves using the In-fusion method to ligate DNA fragments into circular plasmids; The method for obtaining the fragment in step (2) is to amplify the Ptef fragment using primers 332-Ptef-F and Ptef-R, and to amplify the link-nCas fragment using primers AID-link-nCas-F and Ptef-R ncas9-Ttef-R. The method for obtaining SpG-2, SpG-3 and SpG-4 fragments in step (5-1) is as follows: SpG-2 fragment is amplified using primers 332-Ptef-F and SpG\RY-2-R, SpG-3 fragment is amplified using primers SpG\RY-3-F and SpG\RY-3-R, and SpG-4 fragment is amplified using primers SpG\RY-4-F and SpG\RY-4-R. The method for obtaining the SpRY-1, SpRY-2, SpRY-3, and SpRY-4 fragments in step (5-2) is as follows: SpRY-1 fragment is amplified using primers 332-Ptef-F and SpRY-1-R; SpRY-2 fragment is amplified using primers SpRY-2-F and SpRY-2-R; SpRY-3 fragment is amplified using primers SpRY-3-F and SpRY-3-R; and SpRY-4 fragment is amplified using primers SpRY-4-F and SpRY-4-R. The nucleotide sequence of primer 332-Ptef-F is as follows: tagctgtttccgctgagggtGTTTAAACcgagacagcagaatcaccgc; The nucleotide sequence of the primer Ptef-R is as follows: ggtgaaggttgtgttatgttttgt; The nucleotide sequence of the primer AID-link-nCas-F is as follows: CAACTAAAAGCCCCGCTGTCagcggttccgagaccccgg; The nucleotide sequence of the primer Ptef-R ncas9-Ttef-R is as follows: ggcataaatcgaatgtccgcctacaccttgcgctttttcttgg; The nucleotide sequence of the primer SpRY-1-R is as follows: tcgagtacgttcggcggtctccccactat; The nucleotide sequence of the primer SpRY-2-F is as follows: gccgaacgtactcgactgaagcgaacggct; The nucleotide sequence of the primer SpG\RY-2-R is as follows: tgtctgcacctcggttttcttg; The nucleotide sequence of the primer SpG\RY-3-F is as follows: caagaaaaccgaggtgcagaca; The nucleotide sequence of the primer SpG\RY-3-R is as follows: tgaatcagggtcgcatcaagca; The nucleotide sequence of the primer SpG\RY-4-F is as follows: tgcttgatgcgaccctgattca; The nucleotide sequence of the primer SpG\RY-4-R is as follows: TTGGGGTGGACGAGAAAACTAC.

3. A method for editing the bases of Aspergillus niger, characterized in that... Includes the following steps: (1) Design and synthesize sgRNA sequences; (2) Linearize the Target-AID vector, ligate it with the sgRNA sequence, transform it into E. coli, extract and sequence it to obtain the sgRNA-Target-AID vector; (3) Prepare Aspergillus niger protoplasts, transform the sgRNA-Target-AID vector into the protoplasts, and screen for transformants; The sgRNA sequence mentioned in step (1) is an sgRNA that can recognize a specific protospacer sequence; The Target-AID vector in step (2) is at least one of the Target-AID-NGG plasmid, Target-AID-NGN plasmid, or Target-AID-NRY plasmid as described in claim 1; The linearization described in step (2) is achieved by digestion with the restriction endonuclease MssI. The Escherichia coli mentioned in step (2) is E. coli Mach1-T1; The Aspergillus niger mentioned in step (3) is Aspergillus niger CBS513.

88.

4. The application of the Aspergillus niger base editing system according to claim 1 in the mutation or knockout of Aspergillus niger genes; The mutation or knockout is achieved by mutating cytosine to thymine at the target site.

Images