Method for judging single base mutation of erm(41) gene of acid-fast bacteria belonging to mycobacterium abscessus complex, primer set and probe used in the method
By detecting specific indicator base sequences in acid-fast bacteria of the Mycobacterium abscess complex, primer sets and probes were designed to solve the accuracy and false positive problems of erm(41) gene mutation judgment in the existing technology, and to realize the effective judgment of sensitivity to macrolide antibiotics.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NATIONAL HEALTH CRISIS MANAGEMENT RESEARCH INSTITUTE
- Filing Date
- 2021-04-01
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies are insufficient to effectively identify single-base mutations in the erm(41) gene in the Mycobacterium abscess complex, making it difficult to determine the resistance of acid-fast bacteria to macrolide antibiotics. In particular, existing methods suffer from numerous false positives and low flexibility in the Mycobacterium abscess complex.
By detecting specific indicator base sequences in the genomic DNA of acid-fast bacteria in the Mycobacterium abscess complex, primer sets and probes were designed to identify the 28th base of the erm(41) gene as cytosine or thymine. The primer sets were then used for nucleic acid amplification reactions or hybridization with probes to determine the sensitivity to macrolide antibiotics.
It improves the accuracy of identifying single-base mutations in the erm(41) gene, reduces false positives, effectively distinguishes the sensitivity of macrolide antibiotics, and provides a more reliable method for determining drug resistance.
Smart Images

Figure CN115427567B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for determining single-base mutations in the erm(41) gene of acid-fast bacteria belonging to the Mycobacterium abscessis complex, as well as the primer set and probe used in this method. Furthermore, this invention relates to a method for determining single-base mutations in the erm(41) gene of acid-fast bacteria, as well as the primer set and probe used in this method. Background Technology
[0002] Acid-fast bacteria are acid-resistant, non-motile Gram-positive bacilli. They are broadly classified into two types: Mycobacterium tuberculosis complex and nontuberculous mycobacteria (NTM).
[0003] Currently, more than 170 species of nontuberculous mycobacteria have been reported, of which about 30 are known to be pathogenic to humans.
[0004] In nontuberculous mycobacterial infections, existing antibiotics are ineffective against Mycobacterium abscessus complex, and no effective treatment has been established. Consequently, the number of patients and severe cases is increasing. The Mycobacterium abscessus complex comprises three subspecies: Mycobacterium abscessus subsp. abscessus, Mycobacterium abscessus subsp. massiliense, and Mycobacterium abscessus subsp. bolletii. It should be noted that Mycobacterium abscessus is sometimes also referred to as Mycobacterium abscessus.
[0005] In Patent Document 1, in order to identify the above three subspecies of Mycobacterium abscessus complex, a primer set containing a first primer and a second primer is disclosed. The first primer is designed to target the downstream region of a membrane transporter gene common to the three subspecies and to produce amplification products of different sizes for each subspecies. The second primer is designed to target the downstream region of an ATP-binding cassette transporter gene common to the three subspecies and to produce amplification products of different sizes for each subspecies.
[0006] In the Mycobacterium abscessus complex, antibiotic resistance is known to develop through gene mutations. The Mycobacterium abscessus complex contains macrolide-sensitive strains and drug-induced resistant strains that develop resistance upon administration. The presence or absence of this induced resistance is known to be related to single nucleotide polymorphisms in the erm(41) gene. The T28 strain, with thymine at position 28 of the erm(41) gene, exhibits induced resistance, while the C28 strain, with cytosine at position 28, is sensitive (see Non-Patent Literature 1).
[0007] On the other hand, as a method for detecting macrolide-resistant mutant bacteria such as Mycoplasma pneumoniae, Patent Document 2 describes a method of contacting a hydrolysis probe that behaves differently in standard strains and mutant strains with a biological sample of the test subject and detecting it by real-time PCR.
[0008] As a technique for determining single nucleotide polymorphisms (SNPs), techniques utilizing primer elongation reactions (including nucleic acid amplification methods) based on allele-specific primers are known. Allele-specific primers are primers whose elongation reaction efficiency varies significantly depending on the type of base in the target SNP. Therefore, for example, PCR can be performed using allele-specific primers, and the amount of amplified product can be analyzed to determine the type of base in the target SNP. However, in this case, false positives can occur if the reaction conditions are not strictly defined. Patent Document 3 describes a method for determining SNPs with fewer false positives, which uses allele-specific primers with a specific pattern of the second and third bases from the 3' end, and the 3' end base corresponding to the target SNP. However, regardless of the method, in designing allele-specific primers for direct detection of single nucleotide polymorphisms, it is necessary to place a position corresponding to the single nucleotide polymorphism site near the 3' end of the primer. This reduces the flexibility of the design, and it is difficult to screen primers that have both sufficient elongation efficiency for judgment and few false positive reactions based on the surrounding sequence of the single nucleotide polymorphism.
[0009] Existing technical documents
[0010] Patent documents
[0011] Patent Document 1: Japanese Patent Application Publication No. 2019-97493
[0012] Patent Document 2: International Publication WO2013 / 136818
[0013] Patent Document 3: Japanese Patent No. 3859678
[0014] Non-patent literature
[0015] Non-patent literature 1: J Antimicrob Chemother 2017; 72:1669-1677 Summary of the Invention
[0016] The problem that the invention aims to solve
[0017] As mentioned above, the presence or absence of macrolide-induced resistance in the Mycobacterium abscessis complex is known to be related to the single nucleotide polymorphism (SNP) of the erm(41) gene. The T28 strain, with thymine at position 28 of the erm(41) gene, exhibits induced resistance, while the C28 strain, with cytosine at position 28, is susceptible. Therefore, determining whether it is the T28 or C28 strain is useful in estimating macrolide susceptibility in the Mycobacterium abscessis complex.
[0018] To obtain allele-specific primers for the direct detection of single nucleotide polymorphisms, as described in Patent Document 3, primers that combine sufficient elongation efficiency for judgment and few false positives need to be designed from a limited pool of sequence candidates, which is not easy to implement.
[0019] Therefore, one or more embodiments of the present invention provide a novel method for determining whether the 28th base of the erm(41) gene in acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine or thymine. Furthermore, one or more embodiments of the present invention provide a novel method for determining whether the 28th base of the erm(41) gene in acid-fast bacteria is cytosine.
[0020] Methods for solving problems
[0021] The inventors unexpectedly discovered an indicator base sequence on the genomic DNA of acid-fast bacteria belonging to the Mycobacterium abscess complex, which exists at position 28 of the erm(41) gene when the base is cytosine but not when the base is thymine. They then discovered that the presence or absence of this indicator base sequence allows them to determine the 28th base of the erm(41) gene of the target acid-fast bacteria, thus completing the following invention. [1]
[0023] A method for determining whether the 28th base of the erm(41) gene, corresponding to sequence number 1, in acid-fast bacteria belonging to the Mycobacterium abscessis complex is cytosine or thymine, the method comprising:
[0024] Indicator base sequences were detected in the genomic DNA of the aforementioned acid-fast bacteria used to determine the target. These indicator base sequences were present in regions outside the aforementioned erm(41) gene when the base in the aforementioned erm(41) gene was cytosine, and were absent when the base was thymine.
[0025] The detection of the above-mentioned indicator base sequence indicates that the above-mentioned base in the erm(41) gene of the above-mentioned acid-fast bacteria is cytosine.
[0026] The absence of the above-mentioned base sequence indicates that the above-mentioned base in the erm(41) gene in the genomic DNA of the above-mentioned acid-fast bacteria is thymine. [2]
[0028] According to the method described in [1], the index base sequence is a first base sequence containing more than 10 consecutive bases in the base sequence of sequence number 2, or a second base sequence complementary to the first base sequence. [3]
[0030] According to the method described in [2], the first base sequence is at least a sequence of 10 or more consecutive bases contained in a portion of the base sequence containing sequence numbers 3, 5, 7, 9 or 11. [4]
[0032] A method for determining the susceptibility of acid-fast bacteria belonging to the Mycobacterium abscessus complex to macrolide antibiotics, the method comprising any one of [1] to [3], wherein,
[0033] The detection of the above-mentioned base sequences indicates that the acid-fast bacteria are sensitive to macrolide antibiotics.
[0034] The absence of the above-mentioned base sequences indicates that the acid-fast bacteria are not sensitive to macrolide antibiotics. [5]
[0036] A primer set is used to detect an indicator base sequence, which is present in a region of the genomic DNA outside the aforementioned erm(41) gene when the 28th base of the corresponding sequence number 1 of the erm(41) gene in acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine, and absent when the 28th base is thymine.
[0037] The primer set includes a first primer and a second primer.
[0038] The first primer contains a polynucleotide with the base sequence f12 at its 3' end, which is capable of hybridizing with the complementary base sequence f11, a partial base sequence of 10 or more consecutive bases contained in the aforementioned indicator base sequence.
[0039] The second primer contains a polynucleotide with a base sequence r12 at its 3' end, which is capable of hybridizing with a partial base sequence r11 consisting of 10 or more consecutive bases contained in the above-mentioned index base sequence and located closer to the 3' end than the partial base sequence f11. [6]
[0041] According to the primer set described in [5], the above-mentioned index base sequence is the third base sequence containing more than 20 consecutive bases in the base sequence of sequence number 2. [7]
[0043] According to the primer set described in [6], the base sequence of the third base sequence, from the 5' end of the partial base sequence f11 to the 3' end of the partial base sequence r11, is at least a consecutive base sequence of more than 20 bases contained in a portion of the base sequences containing sequence numbers 3, 5, 7, 9 or 11. [8]
[0045] According to the primer set described in [6] or [7], the aforementioned partial base sequence f11 is:
[0046] The sequence of serial number 2 (f11-12-1) contains a sequence of 10 or more consecutive bases in the range of positions 4624 to 4668.
[0047] The sequence of serial number (f11-18-1) 2 contains a sequence of 10 or more consecutive bases in the range of positions 2356 to 2397.
[0048] The sequence of serial number (f11-20-1) 2 contains a sequence of 10 or more consecutive bases in the range of positions 2624 to 2663.
[0049] The sequence of serial number 2 (f11-22-1) contains a sequence of 10 or more consecutive bases in the range of positions 4044 to 4083.
[0050] The sequence of serial number 2 (f11-24-1) contains a sequence of more than 10 consecutive bases in the range of positions 6535 to 6575.
[0051] (f11-26-1) The sequence of serial number 2 contains a sequence of 10 or more consecutive bases in the range of positions 7478 to 7520, or
[0052] (f11-28-1) The sequence of sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 7629 to 7673.
[0053] The above partial base sequence r11 is:
[0054] The sequence of (r11-13-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 4694 to 4740.
[0055] The sequence of (r11-19-1) sequence number 2, specifically positions 2672 to 2711, contains a sequence of 10 or more consecutive bases.
[0056] The sequence of (r11-21-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 3539 to 3583.
[0057] The sequence of (r11-23-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 5061 to 5103.
[0058] The sequence of (r11-25-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 6566 to 6605.
[0059] (r11-27-1) The sequence of sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 7931 to 7976, or
[0060] The (r11-29-1) sequence number 2 contains a sequence of more than 10 consecutive bases in the range of positions 8302 to 8346. [9]
[0062] According to any one of [5] to [8], one of the first primer and the second primer further includes a tag portion as a tag or a tag portion of the tag that can bind to the tagging substance, and the other further includes a binding portion as a tag that can bind to the solid carrier.
[10]
[0064] A reagent kit comprising:
[0065] [9] The primer set and
[0066] At least a portion of the solid carrier includes a part capable of bonding with the aforementioned joint.
[0067] The primer set is used to detect an indicator base sequence, which is present in the region outside the erm(41) gene of the genomic DNA when the 28th base of the corresponding sequence number 1 of the erm(41) gene in acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine, and is absent when the base is thymine.
[11]
[0069] A probe is used to detect an indicator base sequence, which is present in a region of the genomic DNA outside the aforementioned erm(41) gene when the 28th base of the erm(41) gene corresponding to sequence number 1 in acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine, and absent when the 28th base is thymine.
[0070] The probe comprises a polynucleotide that contains a base sequence capable of hybridizing with a partial base sequence p1 consisting of 10 or more consecutive bases contained in the aforementioned indicator base sequence.
[12]
[0072] According to the probe described in
[11] , the index base sequence is a first base sequence containing more than 10 consecutive bases contained in the base sequence of sequence number 2, or a second base sequence complementary to the first base sequence.
[13]
[0074] According to the probe described in
[12] , the aforementioned partial base sequence p1 is at least a sequence of 10 or more consecutive bases contained in a base sequence containing sequence numbers 3, 5, 7, 9 or 11, or its complementary base sequence.
[14]
[0076] According to the probe described in
[12] or
[13] , wherein,
[0077] The above partial base sequence p1 is:
[0078] (p1-12-1) The base sequence of sequence number 2, from position 4624 to 4668, or a sequence of 10 or more consecutive bases contained in its complementary base sequence.
[0079] (p1-18-1) The base sequence of sequence number 2, ranging from position 2356 to 2397, or a complementary base sequence containing a sequence of 10 or more consecutive bases.
[0080] (p1-20-1) The base sequence of sequence number 2, from position 2624 to 2663, or its complementary base sequence, containing a sequence of 10 or more consecutive bases.
[0081] (p1-22-1) The base sequence of sequence number 2, from position 4044 to 4083, or its complementary base sequence, contains a sequence of 10 or more consecutive bases.
[0082] (p1-24-1) The base sequence of sequence number 2, from position 6535 to 6575, or a sequence of 10 or more consecutive bases contained in its complementary base sequence.
[0083] (p1-26-1) The base sequence of sequence number 2, from position 7478 to 7520, or its complementary base sequence, contains a sequence of 10 or more consecutive bases.
[0084] (p1-28-1) The base sequence of sequence number 2, specifically positions 7629 to 7673, or its complementary base sequence, containing a sequence of 10 or more consecutive bases.
[0085] (p1-13-1) The sequence of sequence number 2, specifically positions 4694 to 4740, or its complementary sequence, contains a sequence of 10 or more consecutive bases.
[0086] (p1-19-1) The base sequence of sequence number 2, ranging from position 2672 to 2711, or its complementary base sequence, containing a sequence of 10 or more consecutive bases.
[0087] (p1-21-1) The base sequence of sequence number 2, from position 3539 to 3583, or a sequence of 10 or more consecutive bases contained in its complementary base sequence.
[0088] (p1-23-1) The base sequence of sequence number 2, from position 5061 to 5103, or its complementary base sequence, contains a sequence of 10 or more consecutive bases.
[0089] (p1-25-1) The base sequence of sequence number 2, from position 6566 to 6605, or a sequence of 10 or more consecutive bases contained in its complementary base sequence.
[0090] (p1-27-1) The base sequence of sequence number 2, from position 7931 to 7976, or a sequence of 10 or more consecutive bases contained in its complementary base sequence, or
[0091] (p1-29-1) The base sequence of sequence number 2, from position 8302 to 8346, or the base sequence of its complementary base sequence, containing a sequence of more than 10 consecutive bases.
[15]
[0093] A method for determining whether the 28th base of the erm(41) gene, corresponding to sequence number 1, in acid-fast bacteria belonging to the Mycobacterium abscessis complex is cytosine or thymine, the method comprising:
[0094] Using the genomic DNA of the acid-fast bacteria of the target or the polynucleotide induced by the genomic DNA of the acid-fast bacteria of the target as a template, a nucleic acid amplification reaction was performed using the primer set described in any one of [5] to [9];
[0095] Detection of the amplification products obtained from the above nucleic acid amplification reaction; and
[0096] If the above amplification product is detected, the base of the above erm(41) gene in the genomic DNA of the above acid-fast bacteria is determined to be cytosine; if the above amplification product is not detected, the base is determined to be thymine.
[16]
[0098] A method for determining the susceptibility of acid-fast bacteria belonging to the Mycobacterium abscessis complex to macrolide antibiotics, comprising the method described in
[15] , wherein,
[0099] If the above amplification product is detected, the acid-fast bacteria are determined to be sensitive to macrolide antibiotics; if the above amplification product is not detected, the acid-fast bacteria are determined to be not sensitive to macrolide antibiotics.
[17]
[0101] A method for determining whether the 28th base of the erm(41) gene, corresponding to sequence number 1, in acid-fast bacteria belonging to the Mycobacterium abscessis complex is cytosine or thymine, the method comprising:
[0102] The genomic DNA of the acid-fast bacteria of the target or the polynucleotide induced by the genomic DNA of the acid-fast bacteria of the target, and the probe of any one of
[11] to
[14] are incubated under conditions that enable hybridization;
[0103] Detecting hybridization of the above-mentioned genomic DNA or polynucleotide with the above-mentioned probe; and
[0104] If the above hybridization is detected, the base of the above erm(41) gene in the genomic DNA of the acid-fast bacteria of the above-mentioned target is determined to be cytosine; if the above hybridization is not detected, the base is determined to be thymine.
[18]
[0106] A method for determining the susceptibility of acid-fast bacteria belonging to the Mycobacterium abscessis complex to macrolide antibiotics, the method comprising the method described in
[17] , wherein,
[0107] If the above hybridization is detected, the acid-fast bacteria are determined to be sensitive to macrolide antibiotics; if the above hybridization is not detected, the acid-fast bacteria are determined to be not sensitive to macrolide antibiotics.
[19]
[0109] A method for determining that the 28th base of the erm(41) gene in acid-fast bacteria, corresponding to sequence number 1, is cytosine, the method comprising:
[0110] Indicator base sequences were detected in the genomic DNA of the acid-fast bacteria to be identified. These indicator base sequences were present in regions outside the genomic DNA of the aforementioned erm(41) gene when the base in the erm(41) gene was cytosine, and absent when the base was thymine.
[0111] The detection of the above-mentioned indicator base sequence indicates that the above-mentioned base in the erm(41) gene of the above-mentioned acid-fast bacteria in the above-mentioned target is cytosine.
[20]
[0113] According to the method described in
[19] , the index base sequence is a first base sequence containing more than 10 consecutive bases in the base sequence of sequence number 2, or a second base sequence complementary to the first base sequence. [twenty one]
[0115] According to the method described in
[20] , the first base sequence is at least a sequence of 10 or more consecutive bases contained in a portion of the base sequence containing sequence numbers 3, 5, 7, 9 or 11. [twenty two]
[0117] A method for determining the susceptibility of acid-fast bacteria to macrolide antibiotics, the method comprising any one of
[19] to
[21] , wherein,
[0118] The detection of the above-mentioned base sequences indicates that the acid-fast bacteria are sensitive to macrolide antibiotics. [twenty three]
[0120] A primer set is provided for detecting an indicator base sequence, which is present in a region of the genomic DNA outside the aforementioned erm(41) gene when the 28th base of the sequence corresponding to sequence number 1 in the acid-fast bacteria is cytosine, and absent when the 28th base is thymine.
[0121] The primer set includes a first primer and a second primer.
[0122] The first primer contains a polynucleotide with the base sequence f12 at its 3' end, which is capable of hybridizing with the complementary base sequence f11, a partial base sequence of 10 or more consecutive bases contained in the aforementioned indicator base sequence.
[0123] The second primer contains a polynucleotide with a base sequence r12 at its 3' end, which is capable of hybridizing with a partial base sequence r11 consisting of 10 or more consecutive bases contained in the above-mentioned index base sequence and located closer to the 3' end than the partial base sequence f11. [twenty four]
[0125] According to the primer set described in
[23] , the above-mentioned index base sequence is the third base sequence containing more than 20 consecutive bases in the base sequence of sequence number 2.
[25]
[0127] According to the primer set described in
[24] , the base sequence of the third base sequence, from the 5' end of the partial base sequence f11 to the 3' end of the partial base sequence r11, is at least a consecutive base sequence of more than 20 bases contained in a portion of the base sequences containing sequence numbers 3, 5, 7, 9 or 11.
[26]
[0129] According to the primer set described in
[24] or
[25] , wherein,
[0130] The above partial base sequence f11 is:
[0131] The sequence of serial number 2 (f11-12-1) contains a sequence of 10 or more consecutive bases in the range of positions 4624 to 4668.
[0132] The sequence of serial number (f11-18-1) 2 contains a sequence of 10 or more consecutive bases in the range of positions 2356 to 2397.
[0133] The sequence of serial number (f11-20-1) 2 contains a sequence of 10 or more consecutive bases in the range of positions 2624 to 2663.
[0134] The sequence of serial number 2 (f11-22-1) contains a sequence of 10 or more consecutive bases in the range of positions 4044 to 4083.
[0135] The sequence of serial number 2 (f11-24-1) contains a sequence of more than 10 consecutive bases in the range of positions 6535 to 6575.
[0136] (f11-26-1) The sequence of serial number 2 contains a sequence of 10 or more consecutive bases in the range of positions 7478 to 7520, or
[0137] (f11-28-1) The sequence of sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 7629 to 7673.
[0138] The above partial base sequence r11 is:
[0139] The sequence of (r11-13-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 4694 to 4740.
[0140] The sequence of (r11-19-1) sequence number 2, specifically positions 2672 to 2711, contains a sequence of 10 or more consecutive bases.
[0141] The sequence of (r11-21-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 3539 to 3583.
[0142] The sequence of (r11-23-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 5061 to 5103.
[0143] The sequence of (r11-25-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 6566 to 6605.
[0144] (r11-27-1) The sequence of sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 7931 to 7976, or
[0145] The (r11-29-1) sequence number 2 contains a sequence of more than 10 consecutive bases in the range of positions 8302 to 8346.
[27]
[0147] According to any one of
[23] to
[26] , one of the first primer and the second primer further includes a tag portion as a tag or a tag portion of the tag that can bind to the tagging substance, and the other further includes a binding portion as a tag that can bind to the solid carrier.
[28]
[0149] A reagent kit comprising:
[0150]
[27] the primer set, and
[0151] At least a portion of the solid carrier includes a part capable of bonding with the aforementioned joint.
[0152] The kit is used to detect an indicator base sequence that is present in the region outside the erm(41) gene in the genomic DNA when the 28th base of the corresponding sequence number 1 of the erm(41) gene in acid-fast bacteria is cytosine, and is absent when the base is thymine.
[29]
[0154] A probe for detecting an indicator base sequence, wherein the indicator base sequence is present in a region of the genomic DNA outside the aforementioned erm(41) gene when the 28th base of the sequence corresponding to sequence number 1 in the erm(41) gene of acid-fast bacteria is cytosine, and is absent when the base is thymine.
[0155] The probe comprises a polynucleotide that contains a base sequence capable of hybridizing with a partial base sequence p1 consisting of 10 or more consecutive bases contained in the aforementioned indicator base sequence.
[30]
[0157] According to the probe described in
[29] , the index base sequence is a first base sequence containing more than 10 consecutive bases in the base sequence of sequence number 2, or a second base sequence complementary to the first base sequence.
[31]
[0159] According to the probe described in
[30] , the aforementioned partial base sequence p1 is at least a sequence of 10 or more consecutive bases contained in a portion of a base sequence containing sequence numbers 3, 5, 7, 9 or 11, or its complementary base sequence.
[32]
[0161] According to the probe described in
[30] or
[31] , wherein,
[0162] The above partial base sequence p1 is:
[0163] (p1-12-1) The base sequence of sequence number 2, from position 4624 to 4668, or a sequence of 10 or more consecutive bases contained in its complementary base sequence.
[0164] (p1-18-1) The base sequence of sequence number 2, ranging from position 2356 to 2397, or a complementary base sequence containing a sequence of 10 or more consecutive bases.
[0165] (p1-20-1) The base sequence of sequence number 2, from position 2624 to 2663, or its complementary base sequence, containing a sequence of 10 or more consecutive bases.
[0166] (p1-22-1) The base sequence of sequence number 2, from position 4044 to 4083, or its complementary base sequence, contains a sequence of 10 or more consecutive bases.
[0167] (p1-24-1) The base sequence of sequence number 2, from position 6535 to 6575, or a sequence of 10 or more consecutive bases contained in its complementary base sequence.
[0168] (p1-26-1) The base sequence of sequence number 2, from position 7478 to 7520, or its complementary base sequence, contains a sequence of 10 or more consecutive bases.
[0169] (p1-28-1) The base sequence of sequence number 2, specifically positions 7629 to 7673, or its complementary base sequence, containing a sequence of 10 or more consecutive bases.
[0170] (p1-13-1) The sequence of sequence number 2, specifically positions 4694 to 4740, or its complementary sequence, contains a sequence of 10 or more consecutive bases.
[0171] (p1-19-1) The base sequence of sequence number 2, ranging from position 2672 to 2711, or its complementary base sequence, containing a sequence of 10 or more consecutive bases.
[0172] (p1-21-1) The base sequence of sequence number 2, from position 3539 to 3583, or a sequence of 10 or more consecutive bases contained in its complementary base sequence.
[0173] (p1-23-1) The base sequence of sequence number 2, from position 5061 to 5103, or its complementary base sequence, contains a sequence of 10 or more consecutive bases.
[0174] (p1-25-1) The base sequence of sequence number 2, from position 6566 to 6605, or a sequence of 10 or more consecutive bases contained in its complementary base sequence.
[0175] (p1-27-1) The base sequence of sequence number 2, from position 7931 to 7976, or a sequence of 10 or more consecutive bases contained in its complementary base sequence, or
[0176] (p1-29-1) The base sequence of sequence number 2, from position 8302 to 8346, or the base sequence of its complementary base sequence, containing a sequence of more than 10 consecutive bases.
[33]
[0178] A method for determining that the 28th base of the erm(41) gene in acid-fast bacteria, corresponding to sequence number 1, is cytosine, the method comprising:
[0179] Using the genomic DNA of the acid-fast bacteria of the target or the polynucleotide induced by the genomic DNA of the acid-fast bacteria of the target as a template, a nucleic acid amplification reaction was performed using the primer set described in any one of
[23] to
[27] ;
[0180] Detection of the amplification products obtained from the above nucleic acid amplification reaction, and
[0181] If the above amplification product is detected, the above base of the above erm(41) gene in the genomic DNA of the above acid-fast bacteria is determined to be cytosine.
[34]
[0183] A method for determining the susceptibility of acid-fast bacteria to macrolide antibiotics, the method comprising the method described in
[33] , wherein,
[0184] If the above amplification products are detected, the above acid-fast bacteria are determined to be sensitive to macrolide antibiotics.
[35]
[0186] A method for determining that the 28th base of the erm(41) gene in acid-fast bacteria, corresponding to sequence number 1, is cytosine, the method comprising:
[0187] The genomic DNA of the acid-fast bacteria of the target or the polynucleotide induced by the genomic DNA of the acid-fast bacteria of the target, and the probe of any one of
[29] to
[32] are incubated under conditions that enable hybridization;
[0188] Detecting hybridization of the above-mentioned genomic DNA or polynucleotide with the above-mentioned probe; and
[0189] In the case of detecting the above hybridization, the base of the above erm(41) gene in the genomic DNA of the acid-fast bacteria of the above-mentioned target is determined to be cytosine.
[36]
[0191] A method for determining the susceptibility of acid-fast bacteria to macrolide antibiotics, the method comprising the method described in
[35] , wherein,
[0192] If the above hybridization is detected, the above-mentioned acid-fast bacteria are determined to be sensitive to macrolide antibiotics.
[37]
[0194] The use of the primer set described in any one of [5] to [8], the kit described in
[10] , or the probe described in any one of
[11] to
[14] for detecting an indicator base sequence which is present in the region of the genomic DNA outside the aforementioned erm(41) gene when the base at position 28 of the base sequence corresponding to sequence number 1 of the erm(41) gene in acid-fast bacteria is cytosine, and is absent when the base is thymine.
[38]
[0196] The primer set described in any one of [5] to [8], the kit described in
[10] , or the probe described in any one of
[11] to
[14] are used to determine whether the 28th base of the erm(41) gene in acid-fast bacteria, corresponding to sequence number 1, is cytosine or thymine.
[39]
[0198] The use of the primer set described in any one of [5] to [8], the kit described in
[10] , or the probe described in any one of
[11] to
[14] , for determining the susceptibility of acid-fast bacteria to macrolide antibiotics.
[40]
[0200] The primer set described in any one of [5] to [8], the kit described in
[10] , or the probe described in any one of
[11] to
[14] are used to determine that the 28th base of the serm(41) gene corresponding to sequence number 1 in acid-fast bacteria is cytosine.
[0201] This specification includes the disclosure of Japanese Patent Application No. 2020-066277, which forms the basis of the priority claim of this application.
[0202] The effects of the invention
[0203] According to one or more embodiments of the present invention, it is easy to determine whether the 28th base of the erm(41) gene in acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine or thymine. Furthermore, according to one or more embodiments of the present invention, it is easy to determine whether the 28th base of the erm(41) gene in acid-fast bacteria is cytosine. Attached Figure Description
[0204] Figure 1 A schematic diagram of the nucleic acid detection device 10 is shown. 1: Solid carrier; 2: Binding pad (labeled substance holding part); 3: Sample pad (sample receiving part); 4: Absorbent pad; 5: Substrate; 6: Part containing the tag capture mechanism.
[0205] Figure 2 The results shown in Example 2 are obtained by detecting the amplification products of PCR using a primer set that specifically amplifies the indicator base sequence shown in Serial No. 2, with genomic DNA of different acid-fast strains as templates, by nucleic acid chromatography.
[0206] Figure 3 The results shown are from Example 2, which used genomic DNA of Mycobacteroides abscessus ATCC19977 (strain T28) and Mycobacteroides abscessus LRC18036 (strain C28) as templates, and detected the amplification products of PCR using primers 2-7 that specifically amplified different regions of the indicator base sequence shown in sequence number 2 by agarose gel electrophoresis. Figure 3 In the diagram, A shows the results obtained by detecting the PCR amplification products using primer set 2, B shows the results using primer set 3, C shows the results using primer set 4, D shows the results using primer set 5, E shows the results using primer set 6, and F shows the results obtained by detecting the PCR amplification products using primer set 7 by agarose gel electrophoresis. Detailed Implementation
[0207] The present invention will now be described in detail.
[0208] <Terminology>
[0209] In this invention, the terms polynucleotide or nucleic acid refer to DNA or RNA, typically DNA. The term polynucleotide or nucleic acid does not have a specific limit on the number of bases and also includes oligonucleotides. In this invention, the polynucleotide or nucleic acid contained in primers or probes is typically a polymer of natural nucleotides. Natural nucleotides are nucleotides composed of the bases of natural adenine, thymine, guanine, cytosine, and uracil, as well as the sugar moiety of deoxyribose or ribose and a phosphate group; they are nucleotides in which each part is unmodified. Natural nucleotides are usually D-type nucleotides. D-type nucleotides indicate nucleotides whose sugar moiety is composed of D-type deoxyribose or ribose.
[0210] The phrase "capable of hybridization" for base sequence X and base sequence Y means that a polynucleotide (especially a DNA fragment) containing base sequence X hybridizes with a polynucleotide (especially a DNA fragment) containing base sequence Y under stringent conditions, but not with a polynucleotide not containing base sequence Y. In other words, hybridization refers to specific hybridization. Here, "stringent conditions" refers to conditions that form so-called specific heterozygotes without forming non-specific heterozygotes, which can be appropriately determined, for example, with reference to Green and Sambrook, Molecular Cloning, 4th Ed (2012), Cold Spring Harbor Laboratory Press. Specifically, stringent conditions can be set by the temperature during Southern hybridization, the salt concentration in the solution, and the temperature and salt concentration in the solution during the washing step of Southern hybridization. More specifically, stringent conditions include, for example, a sodium concentration of 25–500 mM, preferably 25–300 mM, and a temperature of 40–68°C, preferably 40–65°C, during the hybridization step. More specifically, hybridization can be performed at 1–7 × SSC (1 × SSC is 150 mM sodium chloride, 15 mM monosodium citrate, pH 7.2), 0.02–3% SDS, and a temperature of 40–60°C. Additionally, a washing step can be performed after hybridization, for example, at 0.1–2 × SSC, 0.1–0.3% SDS, and a temperature of 50–65°C.
[0211] As a specific example of stringent conditions, the following conditions can be cited: A DNA fragment containing base sequence X is hybridized with a DNA fragment containing base sequence Y overnight (approximately 8–16 hours) in a hybridization solution containing 5×SSC, 0.1% (w / v) N-lauroyl sarcosine, and 0.02% (w / v) SDS. Then, the DNA fragment is washed twice for 15 minutes using a washing solution containing 0.1–0.5×SSC, 0.1% (w / v) SDS, preferably 0.1×SSC and 0.1% (w / v) SDS. The temperature for hybridization and washing is preferably 50°C or higher, more preferably 65°C or higher, and the hybridization solution preferably further contains 0.5–2 (w / v) of a blocking reagent for nucleic acid hybridization. Under these conditions, if the DNA probe containing base sequence X hybridizes with the DNA fragment containing base sequence Y, it can be said that base sequence X and base sequence Y "can hybridize".
[0212] When a base sequence X can hybridize with a base sequence Y, the polynucleotide (especially DNA) containing the base sequence X and the polynucleotide (especially DNA) containing the base sequence Y only need to be a combination capable of hybridizing under the annealing conditions of a nucleic acid amplification reaction to form stable double-stranded hydrogen bonds; they do not need to be completely complementary base sequences. For example, there can be several mismatches between base sequences X and Y, such as one mismatch in 10 bases, one mismatch in 20 bases, or one mismatch in 30 bases.
[0213] In cases where base sequence X can hybridize with base sequence Y, or expressed as "base sequence Y that can hybridize with base sequence X", it is preferable to satisfy one or more of the following relationships (A) to (C).
[0214] (A) The complementary base sequence of base sequence X is the same as that of base sequence Y. It should be noted that when one of the complementary base sequence of base sequence X and the base sequence of base sequence Y is a DNA base sequence and the other is an RNA base sequence, thymine in one and uracil in the other are considered to be the same base.
[0215] (B) Base sequence Y is a base sequence in which one or more bases are deleted, substituted, added and / or inserted in the complementary base sequence of base sequence X.
[0216] (C) The base sequence Y is a base sequence that has more than 80% identity with the complementary base sequence X.
[0217] In (B) above, "one or more" is preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 3, particularly preferably 1 or 2, and most preferably 1.
[0218] In (C) above, the identity value represents the value calculated using software capable of calculating the identity between multiple base sequences (e.g., FASTA, DANASYS, and BLAST) with default settings. For the identity value of a base sequence, the number of consistent bases when aligning a pair of base sequences in a manner maximizing consistency is calculated as a ratio of the number of consistent bases to the total number of bases in the compared base sequences. Here, in the presence of vacancies, the total number of bases mentioned above is the number of bases where one vacancy is counted as one base. For details on the method for determining identity, see, for example, Altschul et al, Nuc. Acids. Res. 25, 3389-3402, 1977 and Altschul et al, J. Mol. Biol. 215, 403-410, 1990.
[0219] In (C) above, the identity is more preferably 90% or more, more preferably 95% or more, more preferably 96% or more, more preferably 97% or more, more preferably 98% or more, and more preferably 99% or more.
[0220] Of the above (A) to (C), (A) is particularly preferred.
[0221] In this invention, the method of manufacturing the polynucleotides contained in the primers and / or probes is not particularly limited. They can be manufactured using a polynucleotide synthesis apparatus or by using a contract synthesis service.
[0222] <Nucleic Acid Amplification Reaction>
[0223] When performing nucleic acid amplification reactions using primer sets from one or more embodiments of the present invention, the nucleic acid amplification reaction can be performed using a thermostable polymerase or a strand displacement polymerase. The polymerase refers to a nucleic acid polymerase, specifically a DNA polymerase or an RNA polymerase, preferably a DNA polymerase.
[0224] As a nucleic acid amplification reaction using a thermostable polymerase, polymerase chain reaction (PCR) is an example. Commercially available DNA polymerases can be used, such as TaKaRa Ex Taq (registered trademark). Furthermore, the temperature, time, and buffer composition can be appropriately selected based on the DNA polymerase used and the concentration of each primer. The time, temperature, buffer composition, substrate nucleotide concentration, and cycle number of each step in the denaturation, annealing, and elongation processes in PCR can be appropriately set considering factors such as the selected DNA polymerase, primer sequence, target nucleic acid base number, and template concentration.
[0225] Chain displacement polymerases are enzymes that dissociate the hydrogen bonds of double-stranded nucleic acids containing target nucleic acids and synthesize new DNA chains. Examples include: DNA polymerases, including Bst DNA polymerase, Klenow fragment of DNA polymerase I, Vent DNA polymerase, Vent(Exo-) DNA polymerase, DeepVent DNA polymerase, DeepVent(Exo-) DNA polymerase, 96-7 DNA polymerase, Aac DNA polymerase, and Csa DNA polymerase, etc. Strand substitution polymerases do not require double-strand dissociation, thus enabling isothermal nucleic acid amplification.
[0226] As a nucleic acid amplification reaction using chain substitution polymerase, isothermal nucleic acid amplification is preferred, and examples include RPA (Recombinase Polymerase Amplification), TRIAmp (Tandem Repeat-mediated Isothermal Amplification), LAMP (Loop-mediated Isothermal Amplification), and HDA (Helicase-dependent Amplification).
[0227] Isothermal nucleic acid amplification using strand substitution polymerase can be performed as follows: template nucleic acid, primers, strand substitution polymerase, and substrate nucleotides coexist; the amplification primers form stable base pairs with the template nucleic acid; and incubation is carried out at a temperature that allows the enzyme to exert its activity. The temperature, buffer composition, substrate nucleotide concentration, reaction time, and other conditions for nucleic acid amplification in isothermal nucleic acid amplification can be appropriately set by considering factors such as the selected strand substitution polymerase, primer sequence, number of bases in the target nucleic acid, and template nucleic acid concentration.
[0228] "Target nucleic acid" refers to a nucleic acid whose indicator base sequence contains the base sequence to be detected and / or amplified, or a nucleic acid whose complementary base sequence contains the base sequence to be detected and / or amplified. The target nucleic acid can exist in a double-stranded form together with its complementary strand. One strand of the target nucleic acid existing in a double-stranded form can also be called the "target nucleic acid." Either the nucleic acid to be detected or its complementary strand can also be called the "target nucleic acid." That is, in this invention, "detecting target nucleic acid" or "amplifying target nucleic acid" includes both: detecting or amplifying the target nucleic acid for the purpose of the target nucleic acid itself, and detecting or amplifying the target nucleic acid, its complementary strand, or a double-stranded nucleic acid of the target nucleic acid and its complementary strand for the purpose of detecting or amplifying the complementary strand of the target nucleic acid or the double-stranded nucleic acid of the target nucleic acid and its complementary strand.
[0229] In the case of nucleic acid amplification reactions, the nucleic acid serving as the template only needs to partially contain the target base sequence and / or its complementary base sequence; it can be DNA or RNA, but DNA is preferred. Typically, the nucleic acid serving as the template for a nucleic acid amplification reaction is a double-stranded DNA that at least partially contains the target nucleic acid polynucleotide chain and the complementary strand of that polynucleotide chain.
[0230] The nucleic acid used as a template can be natural or artificially synthesized. For example, it can be a natural nucleic acid extracted from a biological sample, or a nucleic acid amplified by nucleic acid amplification reactions such as PCR, or cDNA synthesized by reverse transcription.
[0231] <Acid-resistant bacteria>
[0232] In this specification, "acid-fast bacteria" as the object of judgment refers to acid-fast, non-motile Gram-positive bacilli. In this specification, "acid-fast bacteria" may include "nontuberculous mycobacteria (NTM)," which may include "acid-fast bacteria belonging to the Mycobacteroides abscessus complex." The Mycobacteroides abscessus complex contains three subspecies as already described. One or more embodiments of the present invention are preferably used to detect mutations at position 28 of the erm(41) gene in the Mycobacteroides abscessus complex, and particularly preferably to detect mutations at position 28 of the erm(41) gene in Mycobacteroides abscessus subsp. abscessus and Mycobacteroides bleae subsp. abscessus. It should be noted that the genus Mycobacteroides is sometimes referred to as the genus Mycobacterium.
[0233] <erm(41) gene>
[0234] The erm(41) gene encodes erythromycin ribosomal methyltransferase. The erm(41) gene expresses erythromycin ribosomal methyltransferase in the presence of macrolide antibiotics such as clarithromycin, inducing resistance to macrolide antibiotics.
[0235] The genomic DNA of the standard strain of *Mycobacterium abscessus* complex contains the erm(41) gene with sequence number 1. In sequence number 1, the 28th base is thymine. Acid-fast bacteria with the erm(41) gene containing sequence number 1 are drug-resistant bacteria capable of inducing resistance to macrolide antibiotics.
[0236] On the other hand, in approximately 10% of the Mycobacterium abscesses complex, the erm(41) gene has a thymine-cytosine mutation at position 28 of the sequence corresponding to sequence number 1. This genotype of acid-fast bacteria cannot induce resistance to macrolide antibiotics and is macrolide-sensitive.
[0237] It should be noted that some of the acid-fast bacteria belonging to the Mycobacterium abscessis complex are strains with a partial deletion of the erm(41) gene, which do not possess the full length of the base sequence shown in sequence number 1 of the erm(41) gene but have a partial deletion. Even in strains with a partial deletion of the erm(41) gene, there are strains with thymine and strains with cytosine in the base sequence upstream of position 28 of sequence number 1.
[0238] In the following description, the type of erm(41) gene whose 28th base is thymine, corresponding to the sequence of sequence number 1, is represented as "normal", "erm(41)T28", or "T28". Additionally, acid-fast strains of the erm(41) gene whose 28th base is thymine, corresponding to the sequence of sequence number 1, are represented as "T28 strain". It should be noted that the erm(41)T28 gene sequence refers to the sequence whose 28th base is thymine, corresponding to the sequence of sequence number 1. Other base sequences may be identical to the sequence of sequence number 1, or may be sequences with one or more bases deleted, substituted, added, and / or inserted in the sequence of sequence number 1. Furthermore, as mentioned above, a portion of the sequence downstream of position 28 in the erm(41) gene may be deleted.
[0239] In the following description, the type in which the 28th base of the erm(41) gene corresponding to sequence number 1 is cytosine will be referred to as "mutant", "erm(41)C28" or "C28". Additionally, acid-fast strains in which the 28th base of the erm(41) gene corresponding to sequence number 1 is cytosine will be referred to as "C28 strain". It should be noted that the erm(41)C28 gene sequence refers to the sequence in which the 28th base of the erm(41) gene corresponding to sequence number 1 is cytosine. The base sequences at other positions can be the same as the erm(41) gene sequence, or they can be sequences in which one or more bases are deleted, substituted, added, and / or inserted. Furthermore, as mentioned above, a portion of the sequence downstream of position 28 in the erm(41) gene may be deleted.
[0240] In the two paragraphs above, "one or more" is preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 3, particularly preferably 1 or 2, and most preferably 1.
[0241] <Method for determining the erm(41) genotype of acid-resistant bacteria 1>
[0242] The first embodiment of the present invention relates to a method for determining whether the 28th base of the erm(41) gene, corresponding to sequence number 1, in acid-fast bacteria belonging to the Mycobacterium abscessis complex is cytosine or thymine, the method comprising:
[0243] In the genomic DNA of the acid-fast bacteria mentioned above, an indicator base sequence was detected. The indicator base sequence was present in a region outside the genomic DNA when the base of the erm(41) gene was cytosine, and absent when the base was thymine.
[0244] The detection of the above-mentioned indicator base sequence indicates that the above-mentioned base in the erm(41) gene of the above-mentioned acid-fast bacteria is cytosine.
[0245] The absence of the above-mentioned base sequence indicates that the above-mentioned base in the erm(41) gene in the genomic DNA of the above-mentioned acid-fast bacteria is thymine.
[0246] According to the method of the first embodiment described above, it is possible to determine whether an acid-fast bacterium belonging to the Mycobacterium abscess complex is strain C28 or strain T28 by detecting an indicator base sequence without detecting single-base mutations in the erm(41) gene. The indicator base sequence is specifically present in a region of the genomic DNA outside the erm(41) gene when the acid-fast bacterium is strain C28. In the method of the first embodiment described above, it is not necessary to directly detect single-base mutations; as long as the presence or absence of the indicator base sequence in the genomic DNA can be detected, it is possible to determine whether it is strain C28 or strain T28, thus allowing for simple implementation.
[0247] Furthermore, the method of the first embodiment described above can be used to determine whether acid-fast bacteria, particularly those belonging to the Mycobacterium abscess complex, are sensitive to macrolide antibiotics. The method for determining the sensitivity of acid-fast bacteria to macrolide antibiotics includes detecting the aforementioned indicator base sequence in the genomic DNA of the acid-fast bacteria being determined. Detection of the indicator base sequence indicates that the acid-fast bacteria are sensitive to macrolide antibiotics, while the absence of the indicator base sequence indicates that the acid-fast bacteria are not sensitive to macrolide antibiotics.
[0248] In addition, the above-mentioned index sequence can be used as an indicator to determine that the 28th base of the erm(41) gene in acid-fast bacteria, which corresponds to sequence number 1, is cytosine.
[0249] The inventors unexpectedly discovered that a region with sequence number 2 is specifically present in the genomic DNA of strain C28, but not in the genomic DNA of strain T28.
[0250] The base sequence of Serial No. 2 is formed by connecting the base sequences of Serial No. 3, Serial No. 4, Serial No. 5, Serial No. 6, Serial No. 7, Serial No. 8, Serial No. 9, Serial No. 10, and Serial No. 11 in this order from the 5' end to the 3' end. The positions of the 5' and 3' end bases of each of Serial Nos. 3 to 11 on the base sequence of Serial No. 2 are shown in the table below.
[0251] Table 1
[0252]
[0253] In the sequence of sequence number 2, the sequences of sequence number 3, sequence number 5, sequence number 7, sequence number 9, and sequence number 11 are particularly preferred as the criteria for identifying C28 strain because they are sequences with high homology that are not found in the genomic DNA of strain T28.
[0254] The aforementioned indicator base sequence can be any base sequence specifically present in the genomic DNA of acid-fast bacteria strain C28. Specifically, it is preferably a first base sequence of 10 or more consecutive bases contained in the base sequence of sequence number 2, or a second base sequence complementary to the aforementioned first base sequence. More preferably, the aforementioned first base sequence is a base sequence of 20 or more consecutive bases, 50 or more bases, 100 or more bases, 500 or more bases, or 1000 or more bases contained in the base sequence of sequence number 2. There is no particular upper limit to the number of bases in the aforementioned first base sequence; for example, it can be less than 3000 bases or less than 1500 bases.
[0255] The first base sequence is more preferably a sequence of 10 or more consecutive bases, preferably 20 or more, 50 or more, 100 or more, 500 or more, or 1000 or more, contained in at least a portion of the base sequence containing sequence numbers 3, 5, 7, 9, or 11. Such a first base sequence, or the second base sequence serving as its complementary base sequence, is a base sequence in which there is no highly homologous base sequence in the genomic DNA of strain T28; therefore, strain C28 can be identified with high precision based on its presence.
[0256] In the method of the first embodiment described above, the method for detecting the index base sequence is not particularly limited. For example, it can be implemented by using probes or primers described later.
[0257] In the method of the first embodiment described above, if the above-mentioned indicator base sequence is detected in the genomic DNA of acid-fast bacteria belonging to the Mycobacterium abscessus complex, the acid-fast bacteria can be identified as strain C28; if the above-mentioned indicator base sequence is not detected in the genomic DNA of the acid-fast bacteria, the acid-fast bacteria can be identified as strain T28.
[0258] <Probes for detecting indicator base sequences specific to strain C28>
[0259] A second embodiment of the present invention relates to a probe for detecting an indicator base sequence, wherein the indicator base sequence is present in a region outside the aforementioned erm(41) gene of the acid-fast bacterium belonging to the Mycobacterium abscess complex when the 28th base of the sequence corresponding to sequence number 1 of the erm(41) gene is cytosine, and is absent when the base is thymine.
[0260] The probe comprises a polynucleotide that contains a base sequence capable of hybridizing with a partial base sequence p1 consisting of 10 or more consecutive bases contained in the aforementioned indicator base sequence.
[0261] The index base sequence in the second embodiment described above can be selected from the same range as the index base sequence associated with the first embodiment.
[0262] The aforementioned partial base sequence p1 is the region in the aforementioned index base sequence that hybridizes with the probe of the second embodiment.
[0263] The aforementioned partial base sequence p1 is a continuous partial base sequence within the aforementioned index base sequence. It only needs to have the number of bases necessary to maintain specificity, which can be 10 or more bases, more preferably 15 or more bases, more preferably 17 or more bases, and more preferably 20 or more bases. There is no particular upper limit to the number of bases in the aforementioned partial base sequence p1; for example, it can be a partial base sequence of the aforementioned index base sequence with fewer than 400 bases, fewer than 300 bases, fewer than 200 bases, fewer than 100 bases, or fewer than 50 bases.
[0264] The aforementioned partial base sequence p1 is more preferably a sequence containing at least 10 or more consecutive bases, more preferably 15 or more, more preferably 17 or more, more preferably 20 or more, for example, less than 400 bases, less than 300 bases, less than 200 bases, less than 100 bases, or less than 50 bases, contained in a portion of the base sequence containing sequence numbers 3, 5, 7, 9, or 11 or its complementary base sequence.
[0265] The preferred partial base sequence p1 is as follows:
[0266] (p1-12-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 4624 to 4668 of the sequence of sequence number 2 or its complementary base sequence.
[0267] (p1-18-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 2356 to 2397 or its complementary base sequence of sequence number 2.
[0268] (p1-20-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 2624 to 2663 or its complementary base sequence of sequence number 2.
[0269] (p1-22-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 4044 to 4083 or its complementary base sequence of sequence number 2.
[0270] (p1-24-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 6535 to 6575 of the sequence of sequence number 2 or its complementary base sequence.
[0271] (p1-26-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 7478 to 7520 or its complementary base sequence of sequence number 2.
[0272] (p1-28-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 7629 to 7673 or its complementary base sequence of sequence number 2.
[0273] (p1-13-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 4694 to 4740 or its complementary base sequence of sequence number 2.
[0274] (p1-19-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 2672 to 2711 or its complementary base sequence of sequence number 2.
[0275] (p1-21-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 3539 to 3583 or its complementary base sequence of sequence number 2.
[0276] (p1-23-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 5061 to 5103 or its complementary base sequence of sequence number 2.
[0277] (p1-25-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 6566 to 6605 of the sequence of sequence number 2 or its complementary base sequence.
[0278] (p1-27-1) The base sequence of sequence number 2, from position 7931 to 7976, or its complementary base sequence, comprising a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, or
[0279] (p1-29-1) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 8302 to 8346 or its complementary base sequence of sequence number 2.
[0280] More preferably
[0281] (p1-12-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 4629 to 4663 or its complementary base sequence of sequence number 2.
[0282] (p1-18-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 2361 to 2392 or its complementary base sequence of sequence number 2.
[0283] (p1-20-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 2629 to 2658 or its complementary base sequence of sequence number 2.
[0284] (p1-22-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 4049 to 4078 of the sequence of sequence number 2 or its complementary base sequence.
[0285] (p1-24-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 6540 to 6570 or its complementary base sequence of sequence number 2.
[0286] (p1-26-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 7483 to 7515 or its complementary base sequence of sequence number 2.
[0287] (p1-28-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 7634 to 7668 of the sequence of sequence number 2 or its complementary base sequence.
[0288] (p1-13-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 4699 to 4735 of the sequence of sequence number 2 or its complementary base sequence.
[0289] (p1-19-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 2677 to 2706 or its complementary base sequence of sequence number 2.
[0290] (p1-21-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 3544 to 3578 or its complementary base sequence of sequence number 2.
[0291] (p1-23-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 5066 to 5098 of the sequence of sequence number 2 or its complementary base sequence.
[0292] (p1-25-2) A sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, contained in the base sequence of position 6571 to 6600 or its complementary base sequence of sequence number 2.
[0293] (p1-27-2) The base sequence of sequence number 2, from position 7936 to 7971, or its complementary base sequence, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, or
[0294] (p1-29-2) The base sequence of sequence number 2, from position 8307 to 8341, or its complementary base sequence, contains a base sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more.
[0295] The probe of the second embodiment of the present invention is capable of hybridizing under stringent conditions with the region of the p1 portion of the base sequence in a polynucleotide containing the aforementioned indicator base sequence. Therefore, the probe of the second embodiment of the present invention can be used in nucleic acid hybridization methods (e.g., Southern hybridization), real-time PCR methods (e.g., TaqMan™ method, Molecular Beacon method), etc.
[0296] The polynucleotide constituting the probe of the second embodiment described above contains a base sequence that is identical or homologous to the complementary base sequence of the partial base sequence p1 described above. Here, "homology" means satisfying the conditions (B) or (C) above, specifically, satisfying the following conditions (B1) or (C1).
[0297] (B1) The polynucleotide base sequence constituting the probe of the second embodiment described above is a base sequence in which one or more bases are missing, substituted, added and / or inserted in the complementary base sequence of the partial base sequence p1 described above.
[0298] (C1) The base sequence of the polynucleotide constituting the probe of the second embodiment described above is a base sequence that has more than 80% identity with the complementary base sequence of the partial base sequence p1 described above.
[0299] The preferred range of “one or more” in (B1) above and “identity” in (C1) above is as described in the parts related to (B) and (C) above.
[0300] The polynucleotide constituting the probe of the second embodiment described above does not need to be composed solely of a base sequence that is identical or homologous to the complementary base sequence of the aforementioned partial base sequence p1 (hereinafter referred to as "base sequence q1"). Other base sequences may be added to one or both of the 5' end and 3' end of base sequence q1. Base sequence q1 is particularly preferably identical to the complementary base sequence of the aforementioned partial base sequence p1.
[0301] The total number of bases in the polynucleotide constituting the probe of the second embodiment described above is not particularly limited, and may be 8 or more bases, 10 or more bases, more preferably 15 or more bases, more preferably 20 or more bases, and preferably 400 or less bases, 300 or less bases, or 200 or less bases. When using this probe in a real-time PCR method, the polynucleotide is preferably 50 or less bases, more preferably 40 or less bases or 35 or less bases.
[0302] As a specific example of the polynucleotide constituting the probe of the second embodiment described above, examples include: a polynucleotide containing any base sequence of sequence numbers 12, 13, 18 to 29 or its complementary base sequence containing a continuous base sequence of 10 or more bases, more preferably 15 or more bases, more preferably 17 or more bases, and particularly preferably 20 or more bases.
[0303] The probe of the second embodiment described above may have a labeling portion further added to the polynucleotide, wherein the labeling portion is a tag or labeling substance capable of binding to a labeling substance. Specific examples of such a labeling portion are related to the primer, as described later. The complex formed by hybridization of the probe containing the labeling portion and the polynucleotide containing the aforementioned indicator base sequence allows for easy detection of the labeling portion as an indicator.
[0304] Furthermore, the probe of the second embodiment described above can be further augmented with a binding portion, which is a tag capable of binding to a solid-phase support. Specific examples of such binding portions are related to primers, as described later. The complex formed by hybridization of the probe containing the binding portion and the polynucleotide containing the aforementioned indicator base sequence can be immobilized on the solid-phase support via the binding portion, facilitating the detection and separation of the complex.
[0305] The probe containing the binding portion can be provided in a state where it is pre-immobilized on a solid support via the binding portion. The probe immobilized on the solid support is capable of capturing polynucleotides containing the aforementioned indicator base sequence.
[0306] When using the probe of the second embodiment described above in a real-time PCR method, it is preferable to label it with a labeling substance commonly used in the real-time detection of amplification products. For example, a reporter fluorescent substance is attached to the 5' end of the polynucleotide used as the probe, and a quencher dye is attached to the 3' end. Examples of reporter fluorescent substances include carboxyfluorescein (FAM), hexachlorofluorescein (HEX), and tetrachlorofluorescein (TET). Examples of quencher dyes include fluorescent substances such as carboxytetramethylrhodamine (TAMRA), Black Hole Quencher dye (BHQ), and non-fluorescent substances such as 4-((4-(dimethylamino)phenyl)azo)benzoic acid (DABCYL).
[0307] The probe described in the second embodiment above can be used to determine whether the 28th base of the erm(41) gene, which corresponds to sequence number 1, in acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine or thymine.
[0308] Specifically, the method may include:
[0309] The genomic DNA of the acid-fast bacteria to be identified, or the polynucleotide induced from the genomic DNA of the acid-fast bacteria to be identified, and the above-mentioned probe are incubated under conditions that enable hybridization.
[0310] Detecting hybridization of the above-mentioned genomic DNA or polynucleotide with the above-mentioned probe; and
[0311] If the above hybridization is detected, the base of the above erm(41) gene in the genomic DNA of the acid-fast bacteria of the above-mentioned target is determined to be cytosine; if the above hybridization is not detected, the base is determined to be thymine.
[0312] Furthermore, the probe of the second embodiment described above can be used to determine the sensitivity of acid-fast bacteria, particularly those belonging to the Mycobacterium abscessis complex, to macrolide antibiotics. Specifically, the method may include:
[0313] The genomic DNA of the acid-fast bacteria to be identified, or the polynucleotide induced from the genomic DNA of the acid-fast bacteria to be identified, and the above-mentioned probe are incubated under conditions that enable hybridization.
[0314] Detecting hybridization of the above-mentioned genomic DNA or polynucleotide with the above-mentioned probe; and
[0315] If the above hybridization is detected, the acid-fast bacteria are determined to be sensitive to macrolide antibiotics; if the above hybridization is not detected, the acid-fast bacteria are determined to be not sensitive to macrolide antibiotics.
[0316] Furthermore, the probe of the second embodiment described above can be used to determine that the 28th base of the serm(41) gene in acid-fast bacteria, corresponding to sequence number 1, is cytosine. Specifically, the method includes:
[0317] The genomic DNA of the acid-fast bacteria to be identified, or the polynucleotide induced from the genomic DNA of the acid-fast bacteria to be identified, and the above-mentioned probe are incubated under conditions that enable hybridization.
[0318] Detecting hybridization of the above-mentioned genomic DNA or polynucleotide with the above-mentioned probe; and
[0319] In the case of detecting the above hybridization, the base of the above erm(41) gene in the genomic DNA of the acid-fast bacteria of the above-mentioned target is determined to be cytosine.
[0320] Here, "polynucleotides induced by the genomic DNA of the acid-fast bacteria to be identified" can be listed as: partial polynucleotides of a portion of the aforementioned genomic DNA, and amplification products obtained by amplifying all or a portion of the aforementioned genomic DNA containing the aforementioned indicator base sequence through a nucleic acid amplification reaction.
[0321] As for the "conditions that enable hybridization" in the above-mentioned methods, the preferred condition is the same as the condition described as a "strict condition".
[0322] <Primer set for detecting indicator base sequences specific to strain C28>
[0323] The third embodiment of the present invention relates to a primer set for detecting an indicator base sequence, wherein the indicator base sequence is present in a region outside the aforementioned erm(41) gene of the acid-fast bacteria belonging to the Mycobacterium abscess complex when the 28th base of the sequence corresponding to sequence number 1 of the erm(41) gene is cytosine, and is absent when the base is thymine.
[0324] The primer set includes a first primer and a second primer.
[0325] The first primer contains a polynucleotide with the base sequence f12 at its 3' end, which is capable of hybridizing with the complementary base sequence f11, a partial base sequence of 10 or more consecutive bases contained in the aforementioned indicator base sequence.
[0326] The second primer contains a polynucleotide with a base sequence r12 at its 3' end, which is capable of hybridizing with a partial base sequence r11 consisting of 10 or more consecutive bases contained in the above-mentioned index base sequence and located closer to the 3' end than the partial base sequence f11.
[0327] The aforementioned indicator base sequence can be any base sequence specifically present in the genomic DNA of acid-fast bacteria strain C28. Specifically, it is preferably a third base sequence consisting of 20 or more consecutive bases contained in the base sequence of sequence number 2. More preferably, the third base sequence is a base sequence consisting of 40 or more, 50 or more, 100 or more, 500 or more, or 1000 or more consecutive bases contained in the base sequence of sequence number 2. There is no particular upper limit to the number of bases in the third base sequence; for example, it can be less than 3000 bases or less than 1500 bases.
[0328] In the following description, the base sequence from the 5' end of the partial base sequence f11 to the 3' end of the partial base sequence r11 contained in the third base sequence described above is referred to as the "target sequence". The target sequence and its complementary base sequence can be amplified by nucleic acid amplification reaction using the primer set of this embodiment. The target sequence is preferably a sequence of at least 20 consecutive bases, preferably 40 bases, 50 bases, 100 bases, 500 bases, or 1000 bases, contained in at least a portion of the base sequence containing sequence numbers 3, 5, 7, 9, or 11. This target sequence is a base sequence in which there is no highly homologous base sequence in the genomic DNA of strain T28, therefore, strain C28 can be identified with high precision based on its presence.
[0329] The length of the target sequence is not particularly limited. To improve detection accuracy, the target sequence preferably includes a continuous portion of the aforementioned index base sequence, preferably 20 or more bases, more preferably 40 or more bases, 50 or more bases, 100 or more bases, 500 or more bases, or 1000 or more bases. The upper limit of the target sequence length is not particularly limited, but is typically below 3000 bases or below 1500 bases.
[0330] The aforementioned partial base sequence f11 is located at the 5' end of the target sequence. The aforementioned partial base sequence r11 is located at the 3' end of the target sequence.
[0331] The lengths of the aforementioned partial base sequence f11 and the aforementioned partial base sequence r11 can be 10 or more bases, more preferably 15 or more bases, more preferably 17 or more bases, more preferably 20 or more bases, and representatively can be 40 or less bases, 30 or less bases, or 27 or less bases.
[0332] The aforementioned partial base sequence f11 is preferably...
[0333] (f11-12-1) The base sequence of sequence number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 4624 to 4668.
[0334] The sequence of serial number (f11-18-1) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the base sequence from position 2356 to 2397.
[0335] (f11-20-1) The base sequence of sequence number 2, from position 2624 to 2663, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more.
[0336] (f11-22-1) The base sequence of sequence number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 4044 to 4083.
[0337] The base sequence of sequence number (f11-24-1) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 6535 to 6575.
[0338] (f11-26-1) The base sequence of sequence number 2, in the range of positions 7478 to 7520, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, or
[0339] (f11-28-1) The base sequence of sequence number 2 contains a sequence of 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more, bases in the range of positions 7629 to 7673.
[0340] More preferably
[0341] (f11-12-2) The base sequence of sequence number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 4629 to 4661.
[0342] (f11-18-2) The base sequence of sequence number 2, from position 2361 to 2390, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more.
[0343] (f11-20-2) The base sequence of sequence number 2, from position 2629 to 2656, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more.
[0344] (f11-22-2) The base sequence of sequence number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 4049 to 4076.
[0345] (f11-24-2) The base sequence of sequence number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 6540 to 6568.
[0346] (f11-26-2) The base sequence of sequence number 2, in the range of positions 7483 to 7513, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, or
[0347] (f11-28-2) The base sequence of sequence number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 7634 to 7666.
[0348] Especially preferred
[0349] (f11-12-3) The base sequence of sequence number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 4629 to 4658.
[0350] (f11-18-3) The base sequence of sequence number 2, from position 2361 to 2387, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more.
[0351] (f11-20-3) The base sequence of sequence number 2, from position 2629 to 2653, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more.
[0352] (f11-22-3) The base sequence of sequence number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 4049 to 4073.
[0353] (f11-24-3) The base sequence of sequence number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 6540 to 6565.
[0354] (f11-26-3) The base sequence of sequence number 2 contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, in the range of positions 7483 to 7510.
[0355] (f11-28-3) The base sequence of serial number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the base sequence from position 7634 to 7663.
[0356] In the above (f11-12-1) to (f11-28-1), "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases" is preferably "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases from the 1st to the 12th bases from the 3' end to the 5' end".
[0357] In the above (f11-12-2) to (f11-28-2), "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases" is preferably "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases from the 1st to the 5th base from the 3' end to the 5' end".
[0358] In (f11-12-3) to (f11-28-3) above, "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases" is preferably "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases from the 1st or 2nd base from the 3' end to the 5' end". Here, "the 1st or 2nd base from the 3' end" is more preferably "the 3' end base".
[0359] The aforementioned partial base sequence r11 is preferably...
[0360] The base sequence of sequence number (r11-13-1) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 4694 to 4740.
[0361] The base sequence of sequence number (r11-19-1) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 2672 to 2711.
[0362] The base sequence of sequence number (r11-21-1) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 3539 to 3583.
[0363] The base sequence of sequence number (r11-23-1) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 5061 to 5103.
[0364] The base sequence of sequence number (r11-25-1) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 6566 to 6605.
[0365] The sequence of (r11-27-1) serial number 2 contains 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, in the base sequence ranging from position 7931 to 7976.
[0366] The base sequence of sequence number (r11-29-1) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 8302 to 8346.
[0367] More preferably
[0368] The (r11-13-2) sequence number 2 contains a sequence of 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the base sequence from position 4701 to 4735.
[0369] The base sequence of sequence number (r11-19-2) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 2679 to 2706.
[0370] The base sequence of sequence number (r11-21-2) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 3546 to 3578.
[0371] The sequence of (r11-23-2) serial number 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the base sequence from position 5068 to 5098.
[0372] The base sequence of sequence number (r11-25-2) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 6573 to 6600.
[0373] (r11-27-2) The base sequence of sequence number 2, specifically the base sequence from position 7938 to 7971, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, or...
[0374] The (r11-29-2) sequence number 2 contains a sequence of 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more, bases in the range of positions 8309 to 8341.
[0375] Especially preferred
[0376] The base sequence of sequence number (r11-13-3) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 4704 to 4735.
[0377] The base sequence of sequence number (r11-19-3) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 2682 to 2706.
[0378] The base sequence of sequence number (r11-21-3) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 3549 to 3578.
[0379] The base sequence of sequence number (r11-23-3) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 5071 to 5098.
[0380] The base sequence of sequence number (r11-25-3) contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the range of positions 6576 to 6600.
[0381] (r11-27-3) The base sequence of sequence number 2, from position 7941 to 7971, contains a sequence of 10 or more consecutive bases, more preferably 17 or more, more preferably 20 or more, or
[0382] The base sequence of (r11-29-3) 2 contains 10 or more consecutive bases, more preferably 17 or more, and more preferably 20 or more consecutive bases in the base sequence from position 8312 to 8341.
[0383] In the above (r11-13-1) to (r11-29-1), "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases" is preferably "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases from the 1st to the 12th bases from the 5' end to the 3' end".
[0384] In (r11-13-2) to (r11-29-2) above, "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases" is preferably "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases from the 1st to the 5th base from the 5' end to the 3' end".
[0385] In the above (r11-13-3) to (r11-29-3), "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases" is preferably "a base sequence of 10 or more consecutive bases, more preferably 17 or more consecutive bases, more preferably 20 or more consecutive bases from the 1st or 2nd base from the 5' end to the 3' end". "The 1st or 2nd base from the 5' end" is more preferably "the 5' end base".
[0386] The above partial base sequences f11 and r11 can be any combination in which the 3' end base of the above partial base sequence f11 is located closer to the 5' end (upstream side) than the 5' end base of the above partial base sequence r11 in the base sequence of sequence number 2.
[0387] When the aforementioned partial base sequence f11 is preferably (f11-12-1), (f11-12-2), or (f11-12-3), the aforementioned partial base sequence r11 is (r11-13-1), (r11-13-2), (r11-13-3), (r11-23-1), (r11-23-2), or (r11-23-3). In this case, the partial base sequence of sequence number 7 can be amplified.
[0388] Preferably, when the aforementioned partial base sequence f11 is (f11-18-1), (f11-18-2), or (f11-18-3), the aforementioned partial base sequence r11 is (r11-19-1), (r11-19-2), (r11-19-3), (r11-21-1), (r11-21-2), or (r11-21-3). In this case, the partial base sequence of sequence number 5 can be amplified.
[0389] When the aforementioned partial base sequence f11 is preferably (f11-20-1), (f11-20-2), or (f11-20-3), the aforementioned partial base sequence r11 is (r11-19-1), (r11-19-2), (r11-19-3), (r11-21-1), (r11-21-2), or (r11-21-3). In this case, the partial base sequence of sequence number 5 can be amplified.
[0390] When the aforementioned partial base sequence f11 is preferably (f11-22-1), (f11-22-2), or (f11-22-3), the aforementioned partial base sequence r11 is (r11-13-1), (r11-13-2), (r11-13-3), (r11-23-1), (r11-23-2), or (r11-23-3). In this case, the partial base sequence of sequence number 7 can be amplified.
[0391] Preferably, when the aforementioned partial base sequence f11 is (f11-24-1), (f11-24-2), or (f11-24-3), the aforementioned partial base sequence r11 is (r11-25-1), (r11-25-2), or (r11-25-3). In this case, the partial base sequence of sequence number 9 can be amplified.
[0392] When the aforementioned partial base sequence f11 is (f11-26-1), (f11-26-2), or (f11-26-3), the aforementioned partial base sequence r11 is (r11-27-1), (r11-27-2), (r11-27-3), (r11-29-1), (r11-29-2), or (r11-29-3). In this case, the partial base sequence of sequence number 11 can be amplified.
[0393] When the aforementioned partial base sequence f11 is preferably (f11-28-1), (f11-28-2), or (f11-28-3), the aforementioned partial base sequence r11 is (r11-27-1), (r11-27-2), (r11-27-3), (r11-29-1), (r11-29-2), or (r11-29-3). In this case, the partial base sequence of sequence number 11 can be amplified.
[0394] The polynucleotide in the first primer can be designed such that it contains a base sequence f12 at the 3' end that can hybridize with the complementary base sequence f11 described above. The polynucleotide in the first primer only needs to contain the base sequence f12 at the 3' end; other base sequences can be added further at the 5' end of the base sequence f12. The full length of the polynucleotide in the first primer is not particularly limited; for example, it can be 10 or more bases, more preferably 17 or more bases, more preferably 20 or more bases, and representatively, it can be 40 or less bases, 30 or less bases, or 27 or less bases.
[0395] If the aforementioned base sequence f12 can hybridize with the complementary base sequence of the aforementioned partial base sequence f11, then the aforementioned partial base sequence f11 and the aforementioned base sequence f12 are identical or homologous. Here, "homology" means satisfying the above conditions (B) or (C), specifically, satisfying the following conditions (B2) or (C2).
[0396] (B2) The above base sequence f12 is a base sequence in which one or more bases are missing, substituted, added and / or inserted in the above partial base sequence f11.
[0397] (C2) The above base sequence f12 is a base sequence that has more than 80% identity with the above partial base sequence f11.
[0398] The preferred range of “one or more” in (B2) above and “identity” in (C2) above is as described in the relevant parts of (B) and (C) above.
[0399] The polynucleotide in the second primer can be designed to include a base sequence r12 at its 3' end, which can hybridize with the aforementioned partial base sequence r11. The polynucleotide in the second primer only needs to include the base sequence r12 at its 3' end; other base sequences can be added further at the 5' end of the base sequence r12. The full length of the polynucleotide in the second primer is not particularly limited; for example, it can be 10 or more bases, more preferably 17 or more bases, more preferably 20 or more bases, and representatively, it can be 40 or less bases, 30 or less bases, or 27 or less bases.
[0400] If the aforementioned base sequence r12 can hybridize with the aforementioned partial base sequence r11, the complementary base sequence of the aforementioned partial base sequence r11 is identical or homologous to the aforementioned base sequence r12. Here, "homology" means satisfying the above conditions (B) or (C), specifically, satisfying the following conditions (B3) or (C3).
[0401] (B3) The above-mentioned base sequence r12 is a base sequence in which one or more bases are missing, substituted, added and / or inserted in the complementary base sequence of the above-mentioned partial base sequence r11.
[0402] (C3) The above-mentioned base sequence r12 is a base sequence that has more than 80% identity with the complementary base sequence r11.
[0403] The preferred range of “one or more” in (B3) above and “identity” in (C3) above is as described in the relevant parts of (B) and (C) above.
[0404] There are no particular restrictions on the combination of the first and second primers; they can be combined in a way that enables the target region of genomic DNA to be amplified into polynucleotide fragments through a nucleic acid amplification reaction.
[0405] As a preferred example of the primer set in the third embodiment described above, the following primer set can be exemplified, wherein,
[0406] The first primer is a polynucleotide containing fewer than 40 bases, which contains at its 3' end a sequence of 10 or more consecutive bases, C28fb, that is identical or homologous to the base sequence shown in sequence numbers 12, 18, 20, 22, 24, 26, or 28 of (C28f).
[0407] The second primer is a polynucleotide containing less than 40 bases, which contains at its 3' end a sequence of more than 10 consecutive bases, namely C28rb, which is identical or homologous to the base sequence shown in sequence numbers 13, 19, 21, 23, 25, 27 or 29 of (C28r).
[0408] In (C28f) above, the base sequence C28fa is the same as or homologous to the base sequences of sequence numbers 12, 18, 20, 22, 24, 26 or 28, that is, it satisfies the relationship (B) or (C) above (the base sequences of sequence numbers 12, 18, 20, 22, 24, 26 or 28 are equivalent to base sequence X, and the base sequence C28fa is equivalent to base sequence Y).
[0409] In the above (C28f), the base sequence C28fa is preferably the following base sequence: the portion of which is the same as the base sequence shown in sequence number 12, 18, 20, 22, 24, 26 or 28, starting from the 3' end, preferably 3 or more, more preferably 5 or more, more preferably 10 or more, more preferably 12 or more, more preferably 15 or more, more preferably 17 or more, more preferably 20 or more, is homologous (i.e., satisfies the relationship (B) or (C) above (the remaining portion of the base sequence of sequence number 12, 18, 20, 22, 24, 26 or 28 is equivalent to base sequence X, and the remaining portion of base sequence C28fa is equivalent to base sequence Y)), preferably the same as the base sequence shown in sequence number 12, 18, 20, 22, 24, 26 or 28.
[0410] The aforementioned base sequence C28fb is preferably a continuous base sequence of 12 or more, 15 or more, 17 or more, or 20 or more bases contained in the aforementioned base sequence C28fa, and more preferably a continuous base sequence starting from the 3' end of the aforementioned base sequence C28fa.
[0411] The base sequence C28fb is more preferably the same as the base sequence C28fa.
[0412] In (C28r) above, the base sequence C28ra is the same as or homologous to the base sequences of sequence numbers 13, 19, 21, 23, 25, 27 or 29, that is, it satisfies the relationship (B) or (C) above (the base sequences of sequence numbers 13, 19, 21, 23, 25, 27 or 29 are equivalent to base sequence X, and the base sequence C28ra is equivalent to base sequence Y).
[0413] In the above (C28r), the base sequence C28ra is preferably the following base sequence: the portion of which is continuously connected from the 3' end, preferably 3 or more bases, more preferably 5 or more bases, more preferably 10 or more bases, more preferably 12 or more bases, more preferably 15 or more bases, more preferably 17 or more bases, more preferably 20 or more bases, is the same as the base sequence shown in sequence number 13, 19, 21, 23, 25, 27 or 29, and the remaining portion is homologous (i.e., it satisfies the relationship (B) or (C) above (the remaining portion of the base sequence of sequence number 13, 19, 21, 23, 25, 27 or 29 is equivalent to base sequence X, and the remaining portion of base sequence C28ra is equivalent to base sequence Y)), preferably the same as the base sequence shown in sequence number 13, 19, 21, 23, 25, 27 or 29.
[0414] The aforementioned base sequence C28rb is preferably a continuous base sequence of 12 or more, 15 or more, 17 or more, or 20 or more bases contained in the aforementioned base sequence C28ra, and more preferably a continuous base sequence starting from the 3' end of the aforementioned base sequence C28ra.
[0415] The base sequence C28rb is more preferably the same as the base sequence C28ra.
[0416] The first primer may consist solely of the aforementioned polynucleotide, or may further include the labeling or binding portion described later. The polynucleotide and the labeling or binding portion may be chemically linked by a suitable spacer described later. In the first primer, the position where one of the labeling or binding portions is linked to the polynucleotide is not particularly limited, as long as it does not interfere with the annealing of the polynucleotide with the polynucleotide containing the target region or its complementary strand, or with the elongation during nucleic acid amplification reactions; it is preferably the 5' end of the polynucleotide.
[0417] The second primer may consist solely of the aforementioned polynucleotide, or may further include the labeling or binding portion described later. The polynucleotide and the labeling or binding portion may be chemically linked by a suitable spacer described later. In the second primer, the position where one of the labeling or binding portions is linked to the polynucleotide is not particularly limited, as long as it does not interfere with the annealing of the polynucleotide to the polynucleotide containing the target region or its complementary strand, or the elongation during nucleic acid amplification reactions; it is preferably the 5' end of the polynucleotide.
[0418] When at least one of the first and second primers contains a label, an amplification product containing the label can be obtained in the nucleic acid amplification reaction using it, thus facilitating the detection of the amplification product.
[0419] When at least one of the first and second primers contains a binding region, an amplification product containing the binding region can be obtained in the nucleic acid amplification reaction using it. Therefore, the amplification product can be immobilized on a solid support, making it easy to detect the amplification product.
[0420] More preferably, one of the first and second primers further includes a labeling portion, and the other further includes a binding portion. In nucleic acid amplification reactions using primer sets of this manner, double-stranded amplification products containing both the labeling and binding portions can be obtained, thus facilitating detection based on nucleic acid chromatography.
[0421] The primer set, which includes the marker part and the binding part, will be described below.
[0422] (Marking section)
[0423] The labeling part can be either a tag or a labeling substance capable of binding to a labeling substance, preferably a tag capable of binding to a labeling substance. In this specification, a tag capable of binding to a labeling substance is sometimes referred to as a labeling tag. When the labeling part is a labeling tag, the tag contained in one end of the amplification product can be labeled by contacting the amplification product of the nucleic acid amplification reaction with the labeling substance. When the labeling part is a labeling substance, an amplification product containing the labeling substance at one end can be obtained as the amplification product of the nucleic acid amplification reaction.
[0424] The labeling material is not particularly limited as long as it can be used to detect the amplification products, but it is preferred to be a labeling material that can be detected by the naked eye. Examples of such labeling materials include: colored particles, pigments, enzymes (peroxidase, alkaline phosphatase, luciferase, etc.), etc., with colored particles being preferred. "Colored particles" refers to metal particles (e.g., gold, silver, copper, platinum, etc.), metal rods, colored latex particles, silica nanoparticles containing pigments, etc., but is not limited to these. The size of the labeling material is only required to ensure that it does not impede the capture of the amplification products in the solid-phase carrier described later. The labeling material is preferably a material that shows good color development during detection, and can be appropriately selected in a way that is smaller than the pore size of various porous components of the nucleic acid detection device equipped with the solid-phase carrier described later. For example, the size of the labeling material can be about 500 nm or less, preferably about 0.1 nm to 250 nm, and more preferably about 1 nm to 100 nm. As a pigment, fluorescent pigments (fluorescein, phthalocyanine, etc.) can also be used. In this case, it is preferable to perform detection by irradiating the excitation wavelength of each fluorescent pigment.
[0425] The labeling tag can be used as long as it can bind to the labeling substance, and can be appropriately selected according to the structure of the labeling substance without particular limitation. For example, it can be a nucleic acid (DNA, RNA, etc.), protein, peptide, or other compound (e.g., low molecular weight compounds such as biotin, fluorescein isothiocyanate (FITC), digoxigenin (DIG), etc.), or a substance formed by a combination of them. As a preferred embodiment of the labeling tag, it contains a polynucleotide or is composed of polynucleotides. The polynucleotide that can be contained in the labeling tag is not particularly limited as long as it does not substantially hinder the nucleic acid amplification reaction based on the above-mentioned primer set. For example, it is a polynucleotide with 5 to 50 bases, preferably 10 to 35. More preferably, it can be a polynucleotide containing the base sequence shown in sequence number 14 or 15 or a portion thereof or their complementary base sequence (or composed of them). As another preferred embodiment of the labeling tag, it is formed from low molecular weight compounds such as biotin, FITC, and DIG.
[0426] When the labeling part is the labeling tag described above, the binding of the labeling substance and the labeling tag can be direct or indirect, and the binding method can be selected appropriately depending on the combination of the labeling substance and the labeling tag used. For example, when the labeling tag contains a polynucleotide, the labeling substance can be indirectly bound to the labeling tag by binding the labeling substance to a polynucleotide capable of hybridizing with that polynucleotide (e.g., a polynucleotide containing the base sequence of the polynucleotide and its complementary sequence), and then allowing the two polynucleotides to hybridize. The binding of the labeling substance to the polynucleotide can occur via peptides, proteins, nucleic acids, or via appropriate functional groups. The hybridization conditions are not particularly limited as long as hybridization occurs; for example, it can be carried out by reacting the substance at 20°C to 40°C in a buffer solution (pH 6 to 7) containing 10 mM to 50 mM phosphate. To improve hybridization efficiency, a salt such as sodium chloride can be further added to the buffer solution.
[0427] Alternatively, when the label is a low-molecular-weight compound, it can be labeled using a labeling substance that specifically binds to it (e.g., avidin bound to biotin, protein bound to FITC), antibody (e.g., anti-DIG antibody), or aptamer-like binding substances. In this case, the label and the binding substance can be bound together using various buffer solutions with near-neutral pH.
[0428] The label (label or labeling substance) and the polynucleotide contained in the first primer or the second primer can be combined in any manner, directly or indirectly. Where at least the portion of the label linked to the polynucleotide is formed of a polynucleotide, the polynucleotide is combined with the label via a spacer capable of inhibiting or stopping the DNA polymerase reaction, in a manner that prevents that portion from double-stranding with the polynucleotide during nucleic acid amplification. As such a "spacer," it is acceptable as long as it can inhibit or stop the DNA polymerase reaction and prevent the double-stranding of the labeled part. For example, nucleic acid sequences with a strong hairpin structure, pseudoknot structure, L-type nucleic acid, peptide nucleic acid (PNA), cross-linked nucleic acid (Bridged Nucleic Acid (BNA) or Locked Nucleic Acid (LNA)), fluorescein, Cy3, Cy5, divalent groups containing an azobenzene structure represented by the following formula I, aliphatic chains (alkylene chains or polyoxyalkylene chains), divalent groups containing reverse sequence structures such as 5'-5' bonds and 3'-3' bonds, etc., but it is not limited to these.
[0429] [Chemical Formula 1]
[0430]
[0431] In the case of two polynucleotide molecules being linked via a divalent group represented by Formula I, one of the 3' phosphate groups of the divalent group refers to the phosphate group of the 5' end nucleotide of one polynucleotide molecule, and the other 5' oxygen atom forms a phosphate ester bond with the phosphate group of the 3' end nucleotide of the other polynucleotide molecule.
[0432] As spacers for fatty chains, examples include spacers represented by the following formula (II).
[0433] 5'-OC m H 2m -O-3' Formula (II)
[0434] (In the formula, 5' represents the oxygen atom of the phosphodiester bond on the 5' side, 3' represents the oxygen atom of the phosphodiester bond on the 3' side, and m represents an integer greater than 1 and less than 40. H is optionally substituted by a substituent.)
[0435] In formula (II), m is preferably 2 or more and 36 or less, more preferably 3 or more and 16 or less. H in formula (II) may be optionally replaced by a substituent, such as alkyl, alkoxy, or hydroxyl groups. The alkyl and alkoxy groups preferably have 1 to 8 carbon atoms, more preferably 1 to 4. Furthermore, when there are two or more substituents, the substituents may be the same or different. Moreover, it is preferable to have no substituents.
[0436] In addition, as other spacers, the spacer represented by the following formula (III) can be cited.
[0437] 5'-(OC n H 2n ) L -O-3' Formula (III)
[0438] (In the formula, 5' represents the oxygen atom of the phosphodiester bond on the 5' side, 3' represents the oxygen atom of the phosphodiester bond on the 3' side, n represents an integer of 2 or more and 4 or less, and L represents an integer of 1 or more and (n+1)×L is 40 or less. H is optionally substituted by a substituent.)
[0439] In formula (III), (n+1)×L is preferably 2 or more and 36 or less, more preferably 3 or more and 16 or less. The substituents of H in formula (III) can be applied in the same manner as the substituents in formula (II).
[0440] Examples of divalent groups that can serve as spacers for other fatty chains include the following.
[0441] [Chemical Formula 2]
[0442]
[0443] When two polynucleotide molecules are linked via these divalent groups, the phosphate group at one end of each divalent group refers to the phosphate group of the 3' or 5' end of the nucleotide in one polynucleotide molecule, and the oxygen atom at the other end forms a phosphate ester bond with the phosphate group of the 5' or 3' end of the nucleotide in the other polynucleotide molecule.
[0444] (Bonding parts and solid support)
[0445] The bonding part is a label that can bond with the solid carrier described later. In this specification, the label that can bond with the solid carrier is sometimes referred to as a label for immobilization.
[0446] The immobilization tag that can be used as the binding site can be any tag that can bind to the solid-phase carrier. It can be appropriately selected based on the structure of the solid-phase carrier and is not particularly limited. For example, it can utilize polynucleotides (DNA, RNA, etc.), proteins, peptides, or other compounds (e.g., low-molecular-weight compounds), or substances formed from combinations thereof. The immobilization tag preferably contains or is composed of polynucleotides. The polynucleotide that can be included in the immobilization tag is not particularly limited as long as it does not substantially hinder the nucleic acid amplification reaction based on the aforementioned primer set. For example, it can be a polynucleotide with 5 to 50 bases, preferably 10 to 35. More preferably, a polynucleotide containing the base sequence shown in sequence number 14 or 15, or a portion thereof, or their complementary base sequence (or composed of them) can be used.
[0447] The solid-phase support is not particularly limited and can be made of resin, metal, polysaccharides, minerals, etc., and can take the form of sheets, membranes, non-woven fabrics, plates, gels, etc. Preferably, the solid-phase support has a porous structure to facilitate the unfolding of amplified products and labeled substances in solution. Examples of usable solid-phase supports in this invention include: filter paper, nitrocellulose membranes, polyethersulfone membranes, nylon membranes, various dried gels (silica gel, agarose gel, silica gel, gelatin gel), silicon, glass, plastics, etc. The size and shape of the solid-phase support can be appropriately selected to suit various operations and detection methods.
[0448] The solid-phase carrier can be configured such that at least a portion can bind to the immobilization tag, and more preferably, only a portion can bind to the immobilization tag. By configuring it in a way that only a specific portion of the solid-phase carrier can bind to the immobilization tag, the amplification product captured on the solid-phase carrier can be limited to only the aforementioned portion for detection, thus making it easy to determine whether it is positive or negative.
[0449] The binding of the solid-phase carrier and the immobilization tag can be direct or indirect, and the appropriate binding method can be selected based on the combination of the solid-phase carrier and the immobilization tag. For example, when the immobilization tag contains a polynucleotide, a tag-capture mechanism can be created by immobilizing a polynucleotide capable of hybridizing with that polynucleotide (e.g., a polynucleotide containing the base sequence of the polynucleotide and its complementary sequence) onto the solid-phase carrier, and then allowing the polynucleotides of both to hybridize, thereby indirectly binding the solid-phase carrier and the immobilization tag. The immobilization of polynucleotides onto the solid-phase carrier can be carried out via peptides, proteins, nucleic acids, etc., or via appropriate functional groups. The hybridization conditions can be determined by the conditions described above related to the binding of the tag and the labeling substance. When polynucleotides are immobilized on the solid-phase carrier, by restricting immobilization to a specific region, the captured amplification product is limited to the given region for detection, thus making it easy to determine positive or negative results.
[0450] The binding portion (immobilization tag) and the polynucleotide contained in the first primer or the second primer can be bound in any manner, directly or indirectly. Where at least the portion of the immobilization tag linked to the polynucleotide is formed of a polynucleotide, the polynucleotide is bound to the immobilization tag via a spacer capable of inhibiting or stopping the DNA polymerase reaction, in a manner that prevents that portion from double-stranding with the polynucleotide during nucleic acid amplification. Specific examples of the spacer disposed between the binding portion and the polynucleotide are the same as those described for the spacer disposed between the tag and the polynucleotide.
[0451]
[0452] Using the primer set of the third embodiment described above, which includes the first and second primers, it is possible to determine whether the 28th base of the erm(41) gene, which corresponds to sequence number 1, in acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine or thymine.
[0453] This determination method includes, for example:
[0454] Using the genomic DNA of the acid-fast bacteria to be identified or the polynucleotide induced from the genomic DNA of the acid-fast bacteria to be identified as a template, a nucleic acid amplification reaction is performed using the primer set of the third embodiment described above, which includes the first primer and the second primer described above.
[0455] Detection of the amplification products obtained from the above nucleic acid amplification reaction; and
[0456] If the above amplification product is detected, the base of the above erm(41) gene in the genomic DNA of the above acid-fast bacteria is determined to be cytosine; if the above amplification product is not detected, the base is determined to be thymine.
[0457] Furthermore, the primer set of the third embodiment described above, which includes the first and second primers, can be used to determine that the 28th base of the sequence corresponding to sequence number 1 of the erm(41) gene in acid-fast bacteria is cytosine. This method includes, for example:
[0458] Using the genomic DNA of the acid-fast bacteria to be identified or the polynucleotide induced from the genomic DNA of the acid-fast bacteria to be identified as a template, a nucleic acid amplification reaction is performed using the primer set of the third embodiment described above, which includes the first primer and the second primer described above.
[0459] Detection of the amplification products obtained from the above nucleic acid amplification reaction; and
[0460] If the above amplification product is detected, the above base of the above erm(41) gene in the genomic DNA of the above acid-fast bacteria is determined to be cytosine.
[0461] Here, “polynucleotides induced by the genomic DNA of the acid-fast bacteria to be identified” can be exemplified by partial polynucleotides of a portion of the aforementioned genomic DNA, or amplified products obtained by amplifying all or a portion of the aforementioned genomic DNA containing the aforementioned indicator base sequence through a nucleic acid amplification reaction.
[0462] Examples of nucleic acid amplification reactions are as described above.
[0463] If the genomic DNA of the acid-fast bacteria to be identified, or the polynucleotide induced from the genomic DNA of the acid-fast bacteria to be identified, contains the target sequence obtained by the nucleic acid amplification reaction using the first primer and the second primer described above, a polynucleotide fragment containing the target sequence is generated as an amplification product.
[0464] There are no particular limitations on the detection methods for amplification products generated by nucleic acid amplification reactions. For example, the following methods can be exemplified: using gel electrophoresis to fractionate the reaction solution of nucleic acid amplification reaction to confirm the presence of bands of a size equivalent to that of a polynucleotide fragment containing a given target sequence; or using a polynucleotide probe specifically labeled with a polynucleotide fragment containing a given target sequence to hybridize with the reaction solution of nucleic acid amplification reaction or its product to detect the complex.
[0465] In addition, nucleic acid amplification reactions are performed in the presence of a probe of the second embodiment of the present invention, in which a reporter fluorescent substance is attached to the 5' end of a polynucleotide and a quencher dye is attached to the 3' end. The fluorescence generated when a polynucleotide fragment containing a given target sequence is amplified is used as an indicator to detect the polynucleotide fragment. This is also a method for detecting amplification products.
[0466] Furthermore, if one of the first primer and the second primer further includes a tag or a tag portion of the tag that can bind to the tagging substance, and the other further includes a binding portion of a tag that can bind to the solid-phase carrier, then the detection process using the solid-phase carrier can be performed.
[0467] (Detection process using a solid support)
[0468] In this detection process, the product of the nucleic acid amplification reaction is brought into contact with a solid-phase carrier. The amplification product at the aforementioned portion of the solid-phase carrier is detected using a labeling portion as an indicator. The solid-phase carrier contains at least a portion that can bind to the binding portion.
[0469] When the labeling part is the labeling tag described above, a further labeling process can be performed to bind the labeling substance to the labeling tag. Details of the labeling process will be explained later. When the labeling part is the labeling substance described above, the labeling process is not required. In the detection process, "using the labeling part as an indicator" means that when the labeling part is a labeling tag, the amplification product is detected using the labeling substance bound through the labeling process as an indicator; and when the labeling part is a labeling substance, the amplification product is detected using that labeling substance as an indicator.
[0470] The products of a nucleic acid amplification reaction refer to the reaction solution of the nucleic acid amplification reaction that may contain amplification products, and the sample obtained by further concentrating the amplification products from the reaction solution.
[0471] The details of the solid support are as described above.
[0472] Regarding the contact between the aforementioned product and the portion that can bind to the solid support, depending on the combination of the solid support and the binding portion, if the aforementioned product contains an amplification product, the contact is carried out under conditions appropriately adjusted in such a way that the binding portion of the amplification product binds to the aforementioned portion (e.g., hybridization conditions, or buffer conditions with a pH of around 5 to 9).
[0473] The amplification products can be detected by detecting the labeled substances bound to the amplification products captured on the solid-phase carrier, preferably by visual inspection. In the presence of amplification products, the labeled substances of the amplification products captured / bound to the solid-phase carrier can be detected. The presence or absence of this detection serves as an indicator to determine whether amplification products (containing polynucleotide fragments of the target sequence) are present in the nucleic acid amplification reaction system.
[0474] (Marking process)
[0475] The labeling process is performed when the labeling portion included in the primer set is the aforementioned labeling tag. The labeling is achieved by contacting the product of the nucleic acid amplification reaction with the labeling substance, thereby binding the labeling tag to the labeling substance. The labeling process can be performed before, after, or simultaneously with contacting the product of the nucleic acid amplification reaction with the solid-phase support.
[0476] Regarding the contact between the labeling substance and the aforementioned product, depending on the combination of the labeling substance and the labeling tag, if the aforementioned product contains an amplification product, it can be carried out under conditions that have been appropriately adjusted in the manner of combining the labeling substance with the labeling tag of the amplification product (e.g., the hybridization conditions described above, or buffer conditions at around pH 5 to 9).
[0477] (Detection device)
[0478] The aforementioned detection and labeling procedures can be performed using a nucleic acid detection device employing nucleic acid chromatography. By using this device, the presence or absence of amplification products (containing polynucleotide fragments of the target sequence) in the reaction system can be detected / determined without the need for special equipment, providing simple and rapid results.
[0479] The nucleic acid detection device may use a known nucleic acid detection device (WO2012 / 070618) for detecting nucleic acid amplification products labeled by nucleic acid chromatography.
[0480] Figure 1 This paper illustrates one embodiment of a nucleic acid detection device that can be used in this invention, but the nucleic acid detection device is not limited to this embodiment. It should be noted that in the following description, the symbols assigned to each component are... Figure 1 The symbols shown correspond to each other.
[0481] Figure 1The nucleic acid detection device 10 is formed by sequentially contacting a sample pad 3 (as a reaction system container for accommodating the reaction system for nucleic acid amplification), a binding pad 2 (holding the labeled substance), a porous solid support 1 (including a portion 6 capable of binding to the binding portion contained in the amplification product), and an absorption pad 4 on a substrate 5. The portion 6 of the solid support 1 is a portion locally configured / fixed with a mechanism (capture mechanism) for capturing the amplification product (e.g., the aforementioned oligonucleotide). Although not shown, the surface of the solid support 1 can be covered with a membrane. The sample pad 3, binding pad 2, solid support 1, and absorption pad 4 can be constructed using components having a porous structure capable of serving as the aforementioned solid support. They can be constructed from the same component or from different components. The substrate 5 can support various components disposed thereon, as long as it facilitates the operation of the nucleic acid detection device; for example, a structure formed from resin, metal, mineral, etc., can be used. When the labeled substance is mixed in the developing solution, and the labeled portion is the labeled substance, the binding pad 2 can be omitted.
[0482] The nucleic acid amplification reaction system is added to sample pad 3. This reaction system can be added directly or together with a suitable developing solution (e.g., phosphate buffer, Tris buffer, Good's buffer, SSC buffer). The developing solution may further contain surfactants, salts, proteins, nucleic acids, etc., as needed. The reaction system added to sample pad 3 is amplified by capillary action. Figure 1 The arrows in the diagram indicate a direction that extends from upstream to downstream.
[0483] Alternatively, development can be performed by placing the nucleic acid detection device into a container holding the products of the nucleic acid amplification reaction and / or the developing solution (e.g., PCR tube, Eppendorf tube, 96-well plate, etc.) and immersing the sample pad 3 in the products of the nucleic acid amplification reaction and / or the developing solution. In this case, the width of the sample pad 3 is preferably 2.0–10.0 mm, more preferably 2.0–5.0 mm, to facilitate placing the sample pad 3 into the container holding the products of the nucleic acid amplification reaction and / or the developing solution.
[0484] In the embodiment where the marking part is a label for marking, when the amplification product in the reaction system passes through the binding pad 2 that holds the marking substance, it comes into contact with the marking substance and is marked by the marking substance via the label for marking.
[0485] Next, when the amplification product in the reaction system passes through the solid support 1, it comes into contact with the capture mechanism fixed in part 6 and is captured / bound to the solid support 1 by the immobilization tag.
[0486] In the presence of amplification products, a labeling substance bound to the amplification products in portion 6 of the solid support 1 containing the capture mechanism is detected in portion 6. If the labeling substance can be visually confirmed, portion 6 will develop color due to the labeling substance. The presence or absence of the detected labeling substance (color development) can be used as an indicator to determine whether the amplification products are present in the sample.
[0487] <A method for determining the susceptibility of a primer set to macrolide antibiotics using a primer set that detects a marker base sequence specific to strain C28 was employed.>
[0488] Using the primer set of the third embodiment described above, which includes the first and second primers, the sensitivity of acid-fast bacteria, especially those belonging to the Mycobacterium abscessus complex, to macrolide antibiotics can be determined.
[0489] This determination method includes, for example:
[0490] Using the genomic DNA of the acid-fast bacteria to be identified or the polynucleotide induced from the genomic DNA of the acid-fast bacteria to be identified as a template, a nucleic acid amplification reaction is performed using the primer set of the third embodiment described above, which includes the first primer and the second primer described above.
[0491] Detection of the amplification products obtained from the above nucleic acid amplification reaction; and
[0492] If the above amplification product is detected, the acid-fast bacteria are determined to be sensitive to macrolide antibiotics; if the above amplification product is not detected, the acid-fast bacteria are determined to be not sensitive to macrolide antibiotics.
[0493] The nucleic acid amplification reaction and detection of amplification products in the above-mentioned determination method can be performed in the same way as described above.
[0494] <Method 2 for determining the erm(41) genotype of acid-resistant bacteria>
[0495] The fourth embodiment of the present invention relates to a method for determining whether the 28th base of the erm(41) gene, corresponding to sequence number 1, in acid-fast bacteria belonging to the Mycobacterium abscessis complex is cytosine or thymine, the method comprising:
[0496] In the genomic DNA of the acid-fast bacteria mentioned above, an indicator base sequence was detected. When the base of the erm(41) gene is thymine, the indicator base sequence exists in a region of the genomic DNA outside the erm(41) gene. When the base of the erm(41) gene is cytosine, the indicator base sequence is not present.
[0497] The detection of the above-mentioned indicator base sequence indicates that the above-mentioned base in the erm(41) gene of the above-mentioned acid-fast bacteria is thymine.
[0498] The absence of the above-mentioned base sequence indicates that the above-mentioned base in the erm(41) gene of the above-mentioned acid-fast bacteria is cytosine.
[0499] Example
[0500] The genomic information of the standard strain of *Mycobacteroides abscessus complex* was obtained from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). The genomic information of clinical isolates and purchased strains of *Mycobacteroides abscessus complex* (strains shown in Table 5 below) was obtained by analyzing DNA prepared from simple bacterial cultures using a next-generation sequencer (MiSeq(illumina)). Based on this genomic information, molecular phylogenetic analysis was performed on strains with the normal erm(41) gene type (T28) (Strain T28) and strains with the erm(41) gene mutant type (C28) (Strain C28). The results showed that strains T28 and C28 could be classified into two different groups molecularly. In addition, the nucleic acid sequences were compared and analyzed using Mauve software (Darling et al. (2005)). The results showed that the inserted base sequence of sequence number 2, which is highly conserved for C28 strain, was found.
[0501] Sometimes the base sequence of sequence number 2 is referred to as the "insertion sequence".
[0502] <Example 1>
[0503] As a primer set for specific hybridization with the inserted base sequence of SEQ ID NO: 2, primers C28-f and C28-r were designed. The sequences of each primer are shown in Table 2. PCR was performed using the designed primer set, and the nucleic acid amplification products were analyzed by nucleic acid chromatography, thereby verifying the specificity of the detection of strain C28.
[0504] (I) Primer structure
[0505] To address detection using nucleic acid chromatography, DNA consisting of a tag sequence is attached to the 5' end of each primer by incorporating a divalent group representing the azobenzene structure described in Formula I above, which contains an azobenzene structure that inhibits polymerase reactions. In this case, the 5' end of the divalent group containing the azobenzene structure shown in Formula I forms a phosphate ester bond with the phosphate group of the nucleotide at the 3' end of the DNA consisting of the tag sequence, and the phosphate group at the 3' end of the divalent group forms a phosphate ester bond with the 5' hydroxyl group of the deoxyribose of the nucleotide at the 5' end of the primer portion of the primer.
[0506] A tag 1 for immobilization, consisting of the base sequence of sequence number 15, was added to the 5' end of the C28-f primer, which consists of the base sequence of sequence number 12, via an azobenzene structure. Similarly, a tag 1 for labeling, consisting of the base sequence of sequence number 14, was added to the 5' end of the C28-r primer, which consists of the base sequence of sequence number 13.
[0507] The first primer set was a combination of C28-f primers and C28-r primers, each tagged with a different primer.
[0508] The base sequence of Serial No. 12 is a partial base sequence from position 4634 to position 4658 of Serial No. 2, and a partial base sequence from position 581 to position 605 of Serial No. 7.
[0509] The base sequence of Serial No. 13 is the complementary base sequence of a portion of the base sequence from position 4704 to position 4730 of Serial No. 2, and the complementary base sequence of a portion of the base sequence from position 651 to position 677 of Serial No. 7.
[0510] Table 2
[0511] name sequence Serial Number C28-f TCCTCGGAATCGGCACTGTCCGTTG 12 C28-r TACAGCAGCTCAACAGTGACACCGAAG 13 Marked with label 1 TGGCAACATTTTTCACTGGGTTTATAG 14 Immobilization label 1 TGCATCGAGTGACAGCTAATGTGTGAT 15
[0512] (II) Preparation of oligonucleotide-bound gold colloids
[0513] Gold colloid (40nm, 9.0×10⁻⁶) 10 (Particles / ml, manufactured by British Biocell International) was mixed with a thiol-containing oligonucleotide having the base sequence of sequence number 16 in Table 3 and incubated at 50°C for 16 hours. After centrifugation at 6000 rpm for 15 minutes, the supernatant was removed, and 0.05 M sodium chloride and 5 mM phosphate buffer (pH 7) were added and mixed. The mixture was then incubated again at 50°C for 40 hours.
[0514] After incubation, centrifuge (6000 rpm, 15 minutes), remove the supernatant, and add 5 mM phosphate buffer (pH 7). Repeat the buffer replacement process.
[0515] Through the above operations, oligonucleotide-bound gold colloids were prepared.
[0516] The prepared oligonucleotide-bound gold colloid suspension was uniformly added to a glass fiber pad and then dried using a vacuum dryer to produce the binding pad.
[0517] (Thiol-containing oligonucleotides)
[0518] Thiol-containing oligonucleotides are oligonucleotides composed of the base sequence of sequence number 16, with the 3' phosphate group at the 3' end joined to HO-(CH2). m The hydroxyl groups of compounds represented by -SH (m=6) are bonded by phosphate ester bonds.
[0519] (III) Fabrication of a membrane with an immobilized tag-capture mechanism
[0520] As a tag-capture mechanism, a solution containing oligonucleotide probe 1, consisting of the base sequence of sequence number 17, was coated onto a nitrocellulose membrane (Hi-Flow180) manufactured by Merck Millipore in a 1 mm wide line orthogonal to the spreading direction using a dispenser. The membrane was then dried at 40°C for 30 minutes to produce the tag-capture mechanism. The line coated with oligonucleotide probe 1 of sequence number 17 was designated as the T1 line.
[0521] Table 3
[0522] name sequence Serial Number Thiol-containing oligonucleotides CTATAAACCCAGTGAAAAATGTTGCCA-SH 16 Oligonucleotide probe 1 ATCACACATTAGCTGTCACTCGATGCA 17
[0523] (IV) Fabrication of nucleic acid detection devices
[0524] according to Figure 1 The schematic diagram shows a nucleic acid testing device.
[0525] That is, the polypropylene backing plate (Lohmann) as substrate 5, the binding pad made in (II) above as binding pad 2, the membrane (solid support) 1 with oligonucleotide probe 1 as a tag capture mechanism in part 6 made in (III) above, the glass fiber sample pad as sample pad 3, and the cellulose absorbent pad as absorbent pad 4 are respectively as follows: Figure 1 The two parts were attached to each other as shown to create a nucleic acid detection device 10.
[0526] (V)PCR
[0527] Using the tagged first primer set described in (I) above, the following PCR reaction solution was prepared according to the manual of TaKaRa TaqHS perfect Mix.
[0528] Table 4
[0529] 2x TaKaRa TaqHS Perfect Mix 10.0μl Primer set 1 5 μM forward primer (serial number 12) 0.5μl 5 μM reverse primer (serial number 13) 0.5μl Template DNA (1 ng / μl) 1.0μl Sterile distilled water 8.0μl
[0530] As template DNA, DNA purified from the acid-fast strains shown in Table 5 (Mycobacteroides abscessus complex and other clinical isolates, purchased strains, and related acid-fast strains) was used. As a negative control, 1 μL of sterile distilled water was used instead of the template DNA solution; otherwise, the same PCR reaction solution was prepared. The 5 μM Mw primer solution and the 5 μM Rv primer solution were prepared by dissolving the given primers in sterile distilled water to achieve a 5 μM concentration.
[0531] The PCR reaction solution was placed in a PCR apparatus (Bioer, LifeEco) and reacted at 94°C for 1 minute. The reaction was then repeated 35 times in cycles of 94°C - 5 seconds / 62°C - 10 seconds / 72°C - 5 seconds.
[0532] It should be noted that, as mentioned above, for each strain of Mycobacteroides abscessus complex used in the experiment, sequencing analysis was used to identify whether it was strain T28 or strain C28.
[0533] (VI) Detection using a nucleic acid chromatography detection system
[0534] The PCR reaction solution under the above conditions was applied to the nucleic acid detection device 10 to test the detection of nucleic acid amplification products. Specifically, 5 μL of the PCR reaction solution was added to the sample pad 3 on the device 10, followed by 80 μL of developing solution (citric acid buffer containing a surfactant), thereby developing the reaction solution. After 10 minutes at room temperature, the presence or absence of staining of the T1 line in the portion 6 containing the linear tag capture mechanism fixed on the membrane 1 was confirmed by visual inspection.
[0535] The presence of T1 line staining indicates that the template DNA contains the inserted base sequence shown in sequence number 2, which is specific to strain C28, indicating that nucleic acid amplification products from strain C28 have been obtained.
[0536] The results are shown in Table 5 (Table 5-1 and Table 5-2). Figure 2 In Table 5, cases where coloring can be confirmed are represented by "+", and cases where coloring cannot be confirmed are represented by "-".
[0537] Table 5-1
[0538]
[0539] Table 5-2
[0540]
[0541] The results of the experiment showed that the constructed chromatographic detection system could specifically detect strains (C28 strain) whose erm(41) gene of Mycobacteroidesabscessus complex has cytosine at position 28, and confirmed that there was no cross-reaction with strain T28 and other acid-fast bacteria.
[0542] <Example 2>
[0543] Based on the sequence information of the insert sequence at sequence number 2, which is specifically present in the genomic DNA of strain C28, primers for the specific detection of strain C28 were designed. Each primer was designed to specifically hybridize with a portion of the insert sequence and to induce nucleic acid amplification in samples containing DNA from strain C28. PCR was performed using the designed primers, and the nucleic acid amplification products were analyzed by agarose gel electrophoresis, thereby verifying the specificity of the detection capability for strain C28.
[0544] Table 6
[0545]
[0546] (I)PCR
[0547] The following PCR reaction solutions were prepared according to the TaKaRa TaqHSperfect Mix manual using primer sets 2 (sequence numbers 18 and 19), 3 (sequence numbers 20 and 21), 4 (sequence numbers 22 and 23), 5 (sequence numbers 24 and 25), 6 (sequence numbers 26 and 27), and 7 (sequence numbers 28 and 29).
[0548] Table 7
[0549] 2x TaKaRa TaqHS Perfect Mix 10.0ul Primer sets 2-7 5μM forward primer 0.5μl 5μM reverse primer 0.5μl Template DNA (1 ng / μl) 1.0μl Sterile distilled water 8.0μl
[0550] Purified genomic DNA prepared from *Mycobacteroides abscessus* ATCC19977 and *Mycobacteroides abscessus* LRC18036 was used as template DNA. *Mycobacteroides abscessus* ATCC19977 is strain T28, and *Mycobacteroides abscessus* LRC18036 is strain C28. Based on the base sequence information, when using primer set 2 with genomic DNA from *Mycobacteroides abscessus* LRC18036 as a template for PCR, it was predicted that a 336 bp region could be specifically obtained as a nucleic acid amplification product. When using primer set 3, it was predicted that a 940 bp region could be specifically obtained as a nucleic acid amplification product. When using primer set 4, it was predicted that a 1040 bp region could be specifically obtained as a nucleic acid amplification product. When using primer set 5, it was predicted that a 51 bp region could be specifically obtained as a nucleic acid amplification product. When PCR was performed using primer set 6, it was predicted that a 479 bp region could be specifically obtained as a nucleic acid amplification product. When PCR was performed using primer set 7, it was predicted that a 698 bp region could be specifically obtained as a nucleic acid amplification product. On the other hand, when PCR was performed using genomic DNA of the T28 strain *Mycobacteroides abscessus* ATCC19977 as a template, it was predicted that no nucleic acid amplification product could be obtained using any primer set from primer sets 2 to 7.
[0551] As a negative control, 1 μL of sterile distilled water was used instead of the template DNA solution described above. Otherwise, a PCR reaction solution with the same composition was prepared. The 5 μM Fw primer solution and the 5 μM Rv primer solution were prepared by dissolving the given primers in sterile distilled water to achieve a 5 μM concentration.
[0552] The PCR reaction solution was placed in a PCR apparatus (Bioer, LifeEco) and reacted at 94°C for 1 minute, followed by 35 cycles of 94°C-5 seconds, 62°C-10 seconds, and 72°C-5 seconds. The resulting PCR reaction solution was analyzed by agarose gel electrophoresis to detect the presence of nucleic acid amplification products. The results are shown below. Figure 3 .exist Figure 3 In the diagram, A shows the results obtained by detecting the PCR amplification products using primer set 2, B shows the results using primer set 3, C shows the results using primer set 4, D shows the results using primer set 5, E shows the results using primer set 6, and F shows the results obtained by detecting the PCR amplification products using primer set 7 by agarose gel electrophoresis.
[0553] The results of the experiment showed that even with any primer set used, specific nucleic acid amplification products could be identified by agarose gel electrophoresis only when the sample contained DNA from strain C28 (Mycobacteroides abscessus LRC18036) of the Mycobacteroides abscessus complex. Based on these results, it can be confirmed that strain C28 can be specifically detected by detecting the presence or absence of the inserted base sequence shown in sequence number 2.
[0554] All publications, patents and patent applications referenced in this specification are incorporated herein by direct reference. sequence list <110> The Director-General of the National Institute of Infectious Diseases represented Japan. Kaneka Corporation <120> A method for identifying single-base mutations in the erm(41) gene of acid-fast bacteria belonging to the Mycobacterium abscessus complex, the primer set and probes used in this method <130> B190585 <150> JP 2020-066277 <151> 2020-04-01 <160> 31 <170> PatentIn version 3.5 <210> 1 <211> 522 <212> DNA <213> Mycobacterium abscessus <400> 1 gtgtccggcc aacggtcgcg acgccagtgg ggctggtatc cgctcactga tgactgggcg 60 gcgcggatcg tcgccgaatc cggtgttcgc tcaggggagt tcgttgtgga tctgggcgca 120 ggacacggcg cgctgacggc acatctggtt gccgctggtg ccagggtgct agccgtcgag 180 ctgcatccgg ggcgggctcg acaccttcgt tcacggtttg ccgaggaaga tgtccggata 240 gcggaagcgg acctgctcgc cttccggtgg ccgcgacggc catttcgggt ggtggcgagc 300 ccgccctacc aagtcaccag cgcactgata cggagtctct tgacgccgga atcccggctg 360 ctggctgccg acctggtgct gcagcgcggg gctgtgcaca aacatgcgaa gcgagcacct 420 gttcgccatt ggacgctacg ggccggaatc acattgccgc gaagcgcttt ccatcatcca 480 ccgcaggtgg attcgtcggt gctggtgatc aggcggcgct ga 522<cgagtacagg taccagttat cggttttgcg gagctccaca gtggcctcgg aggcaaaggg 240 ttttgggttg gggggatctt tgagcgtccg ccgagtatca gcggtgtagg tgtagcacac 300 gcgcaggacc gctgaaggcg gactcagcgc ggccagggcc gtatcggaca ggtgcagatc 360 gtcgtctctg taaatcctgc cctgcgattc gtcagctttc tgaactgttc cgagttcgtg 420 taccgcgtca cgcagacggc catattggtc tgcctcgaga tcgggcacca cgatcttcat 480 aaacttggcg taccgggcgc cgccctgatc acaggcacca ttgcaagcca ccactgcggg 540 ccagatgtcg ttggcgaacc ggggaattac cccgttggta tcgggaacat ttgttgacgt 600 gctggcgact ggggactgca gaatctccga gggcgcaggc ggtggactcg tacatcccgt 660 cagcaccgca agggttaacg acaggcaggc gagccgggtg cgggtggtca tggcttgagc 720 ctgagaacat cggcgctgtc ccggcgttcc gttacgtcat caagccttac cgccatgcct 780 gagccgggtg cgttaagcat gaagccgtta ccgacgtaga gcccggtgtg tggggtacct 840 ccaccagtga acggcgttcc gccttcgcgg aatacgagga tatcgccggg ctgtgcaaag 900 ttgtcgatct gcttggacgg cacagcttga ggctgaccgt ggtcgaagat ggggtttata 960 tcgaggcggt cggtccctgg gatgtctccg cgtggcacga acggatcgaa accggcccct 1020 tgttgcactg agtaccgcac aagcccgccg cagtcgaacc cgatccggtt ccaatcctcg 1080 taggtatccg ctgaggtgcc cttttcccca tgtccacgtg atggcccgtt ggggtcggtg 1140 ttgccgcccc aagcgtagga aactccctgt gagcggccag cggcgccgat cgatcgtaaa 1200 gccttgtcgc taacagcttc tggcttcggg agcgccagcg gcggttgacc tgccgcgcgc 1260 tgtgtgccgt cggcattctt gccggatagg tagtctttcc aggcttgatc acgtgctggt 1320 cccgggccgg tgttctggtc gtagcctggc ggattgtccg ccatgggaat ggttttcgcg 1380 ccatcgatca tcgtgggctt ggcaccgttg ggatatggcg gattaccgtc tgcgccgcct 1440 acgggctcgg aggcattgag cgcgacaggc ggggcttgtg gtgtaggtgc tggtgcgtcg 1500 gtgacatcgg cgcgcagagc ggctgcgatt tcctgctcaa cttgggtggc gcgttgttcg 1560 agggtggtga cttgttgttg caggcgggcg atttggtcgt cttgcaggtg cttgtcagtg 1620 tctttgacct tggtcgtggc gacgactttg ccgtcgtcgg tgatcgtggc gccgattgct 1680 tgagcgtctt gatcgagcat gcccagtttg ttggtgacct cccgtacgtc atcgatagcg 1740 ggtttgacgg ctttagcgac cttctcggcg gcatcagcct tatcgcccag atctacacgc 1800 gtcttgcccg cgctgtcttt ccacgccccc gcggtgacac cgccccacgt ggacagatca 1860 ttagcgacct gttccatacc ctccccgagg cgatgcaggc tggccgctcg tgctgcggcg 1920 gtatcgaaca gcttctccaa cgtctcggct ttccaatgcc ggatatcacc aaccttggcc 1980 acaatcagct cccgcttccc ggcccgccga aacggccagc gttaccgtca tcggcgccaa 2040 ccaccttggc ggtggcatca agaatccaag tcgcatgatc gcccacctgt ttgcgtatcg 2100 cctcgtgctg ctggtcccac ccggcacgta agttttccat tgctgagccg accacccctg 2160 gccagcgaga agctaattcg gtcaggtccg catcgtggcc gatgtggtcc tggcggtgcg 2220 tctccacatg gtccaacagc ttgttggcct gcctgtgcag caactccggg tcgaatctca 2280 acggctcgga catatcggcc tcccgcccga cttggtgacg gccatcaccc tgtttgccag 2340 cgagcctaac actgcgccca tagtggcgcg atgagacagg tcacccgtgc cgttactgcc 2400 aaggcggcgc gggtggcacc gctcagaacc tgcgtgcgct gatggcccag aaccaaaaag 2460 gtaggagaat gccgccgtgc gggaggacga acgtttaggc ggcggcttgc aagcgccggc 2520 tgctggaggc ttcccataag gccgctctgg gggcctctct caagaaccgg gcatcatttg 2580 acctgcgata atgatcaatc ggttggtggg tgtcggtcat agccgtcata gtggacgcag 2640 atacgatggt gcaatcgagg atctgagaaa ggagttccgc cgtgaccgtc acagagactg 2700 cgtgtgaagt agtggagttg acctcagatg aaggtgccga gttgttcgac agcatcgctc 2760 agaacaacat gggcatcaca ggggcggagt ttgtgcgacg ttggaacgca ggggaatttg 2820 aagggatcaa ctgggacgac gttccagggc tgacgtcggt cgcgacggcg ctgcctttcg 2880 caggcatctg agagacacgt ttgccaaagt gcctggtcgc acccctcacg acgcgatccg 2940 taattacata gatccgcttc aacaggcggt ttcatgttta gggtgcgcca agatccaact 3000 ttcacaaacg cccaagaggt acggcgaatt cggagcatgg atcctcaacg ggggcaacgg 3060 aatggtgctc cgaggattcg gtaagttcta cgccacccag cggtttgagt tagttcctac 3120 gacagcggat ctgcacgatg ctcctgaaaa ggagcccttt cgggttttcga cgcgcgaata 3180 tatctaccga ctcgaaattg ctaatgagag tcatgtcatc gaatggcact ggcaccccggt 3240 agggaacagc gacgagcggc gcccccacat ccaccctgca atcaaccggg atgcgcatct 3300 ccccggtccc cgggtggtgc tggagaacgt aatagagggc tgtatcgcac taggcgcgac 3360 acctgcctgc gaggactgga aagagcggct agccgccagc ggtggcgtcc acaagctgta 3420 caggacatgg gtccacgagc ctggcgatct aaagaagcct gcagtaaaag aggactagct 3480 agctttcacg tggtcccgaa cttgggacgc gtgagcgcca agagccgctg aggccgccgg 3540 gagagggcca catcgcacca gcagccggtt tcaccttccg tggatcgtgt tggtggcgaa 3600 taaaaaacgg gatttcagtg acggttgggt gttgaaaaca aattggggca ggggggcgt 3660 ttgcctaagc catgaggggc gggcgccgga cccctcgggt tcactccccc ggggggtcgt 3720 cgtggagtgc ggcttgtccg aggcgctcga cgtagccgct gacggtgggc agcactggcc 3780 gaaatccgca gcgggccacg tgccaggcgt cgcgcagatc agacttgttc ttggcgcggg 3840. cggcgacgat gcgtgcagcg gaggcatcgc cgttagggat caacgtgtgg gcgcggtcgc 3900 caccgatccc ggcagattgc agcagcgcgc cgagtccttc gacggcgtag ccgaatcgtt cgcgcgccac gagggcttcg gaccatgcga tgacggcttt cggtccggcc ttggtgatcg 4020. tcggcccgtc gttgaggtca tcggtcggga tcacttcagc ggcagcttca agcgaattag 4080. cgtatggttc aagggattta gaccactggg ccaatatggt gtcggcgtga gcgttgagcg 4140 cctcaccgat cgtgcgcccc tcctcgtcct tggcggcgcg gtctaggccg agctgcgcaa 4200 4260. gcatgtggtc aagaaggtgg ccggttacca cagggtcagc gtggtaatcc tggtccttct tcatgcagct gagcacggag tacctgaggg cgtccgcgct gccagcaccg atctgcgcct tctcgacca cgctcgggcc gaggccacag cctctacga tggatcggggc agcggaatt caaggcgttc ggcggcgcgt tgcacctgga cgaggtagga acggggttgtg gcggtgtaga 4440 cggacatgtg tttgtctcct agtagttttc gttgaaagcg atttcgccgg ttagggcttc 4500. gcgcaggaag ttgatttcga cttgacgcgg gtgtttccgg ggccggtgat tgttgccctc 4560 gcccggtacg tagttggacg attcaggctg cggtgcggga ggagtgccga ggcgttcgta 4620 aagacgctta aggtcctcgg aatcggcact gtccgttgcg gtctcgtcgc cacgcagtcg 4680 ccgtagcaga tcggtggcag gggcttcggt gtcactgttg agctgctgta gcacctgctt 4740 ccagtcgggt ttatccatgt ggttcttgcc tttcgtcgaa gatccagcgc ccgccgactt 4800 tgcgttgccc ggatttgagt gcgtggcggc ggatggtgcg gggcgaaact ccaaggcgct 4860 cagccctttg ttgcactgtc tccaattctg ctcccgccgt ttcggggtgt ccagaaacct 4920 gtccgctatc ggacacactg cgctgcaacg cttcccatgt tcgatgcaag gccggtggga 4980 tcggggtgcc ttggcggcga cggcgcgcta gttcctcccc gagcacccat gcggcggtgc 5040 gaagatcccg cacgctgacc acgcggtgct ctcccgtggc gcattgggtg caaggctgcg 5100 ctgtcgtgct catgccgccc ccgtcgcctc gtcctggccg tctttggtgg tgatttcctg 5160 cttctttcgc ggcgggtacg agttgaccac cacggcggcg gtaaccccga gcggccgctg 5220 ctcgtgcggc agggaatcga accactcccg gcacgaggcc agcgcagggc attggcggca 5280 tatccgcgtc gctgcctggc gggcgtagtc gcgctcgtcc agggcgcctc ggccatcgcc 5340 gatagcggcg tcgaacaact cgtgccgtcc ccggcagcgc gccccaggca gtacaggcgt 5400 ggctagttcg gccagcagcg tgtcccagtt caccgcgccc cctcctggtc ctgagcatct 5460 gtttcgttga gtgcttgtgc ggcagcccaa ttgccgtgtc gtgggcagtc ggtgaggttg 5520 tccaggcgcc cgtagtcgtc acagtgtggg cagttgcgta tctgccggat cgcttcgcgg 5580 cgggtgttgg cgcgctcgcg tgtcttgcgg cagtgtgcgc agtagcggca ggacatcagg 5640 cggttctccc tccctgggct tgcgcccagc tgacgtgacg cgggcagggc ttgagtccgt 5700 catcgacttc gatccggccc aagtcgtcgc aatccgggca gtcccgaatc acctgcacgg 5760 ctgcgcgttt gcgttcggcc tccgacgccg tggcagcctt gcgcagcgct gcgcagtcgc 5820 ggcagctctc acccacccag gcatcaggtg cgatgtgcgc gtgcttggcg caacgcgtcc 5880 ccgtctcatt gccgttagct gattgccgcc ctcggctggc gggggtgatc gcgtaggcgt 5940 ccgggtcgtc aagttccgta cccccataac gcaaccccct cttttgatgt ggtcctgatg 6000 tggtgggggg caccgccgtg cgggtcaaag aggcaccgcc gtacgggcta tcggaccgtt 6060 gacccgcacc gctgtgcggg ctttggctgt tttgacccgc acggccatgc ggggtatcac 6120 cgttttgacc cgcaccgcca tgcggggtat ttgcgatcgg aaccagccga tacacggcgg 6180 catgacgctt gaatccgttt gctgtgcgct ggatgagccc cagctcgcgg cctcgcttga 6240 gcgccgtttc cacagcccgt tcggtgagcc cgcatttccg catgagccct tctattccag 6300 gccgcgcgtt ggtgccgtcc gcgtagtcgg cgaacgtctc aagcgccagg agaactatcc 6360 gctgggccaa cgtcagggcc ttggccccga gaacataatc gcgccagtca cggcgctgct 6420 ctggcgtcac ggtaagccgc cctgtgcgtc agcaggcaat gcacggcttc ggctagcgcg 6480 cacgctggcg tgcaactggg ccgcgcgatg cacgtcgcag cgcacaacag ggcgcacacc 6540 atcacgcacc gtgacgcaca actcgtgcac tcccccaggc ccatcgggca gccgaccaac 6600 aagcccgccg cccaatggtg cccgtgcgca ctcacgcaga ggcatcgcgc tccaccgcgt 6660 gatgagtgca atctgttccg atcacaagga ctccacgacc tcagcggcgg cgcgcagcgc 6720 atcagtcagg cgtcgcgccg cgctcgcttc catccagtcc tcgacaccat tgacccaacg 6780 cacgccccac tcaaccgaac catctgcggc ctgctgggtg ccctctatga gcacatgccc 6840 caagccctcg cccacctcga accgggcgcc ctctagcctg cgcccccagt ccggcgattc 6900 cttagagccc atgttcatcc actggtcagc atgtgaggct tgagctggga tcggcacatg 6960 cgcgaaccgg ataccagctt gatgcgtctc gatatcgagg gtgatcttga aaaggagact 7020 caacgctgcg ttgtcggcct gactcgtggc ccgccatggc gtgaccccag ccgccgccaa 7080 ctcctcggcg cgctccaact gcgctaccca gtcagccggt agtcgatcaa ccaagtcacg 7140 ccatgtccgg gtgtcgtcgc caaattcgat ctgtaccatg agatttacct actttctgtt 7200 gatggttggt tgcagcggct cccgcccgac gttgccgcgt cggggactac gggggccgtt 7260 ggcatagccg aacttgtgcc gacgagctga acttgtgcgc gatattcgcg cttggccccg 7320 tcagcgtcgg tcacggtcac cgtgatcaca tcgccctcgg cctccacgct ggccgtggaa 7380 ttcggaacca ccttgccatc ccgaataatg catggcgaca agggaaccca cggctcttgc 7440 gtagccgcg ccgcgatcct gtacgcctcg atactcacgc cgcgccttca agcttggcga 7500 tgtactcgtt gatctgcctg tcagtgctga atcggcgctt accaatcctc acgctggcga 7560 gggcaccaga gtgccagagc tggaacacca gcgttctgct gatacctccg agctttgccc 7620 ccactgcctt gtggtcgtgc attgcgtcct cctccgttca tggctgcttg tgcgttcaaa 7680 cacgcagaca tccgataagt tgcgtttctg cgactcaata gataccaggc ggatggcaat 7740 gaacgcaagc agtgcatatc ctgcgtgtca tgacgcaatc agggccgaaa aggccgagtt 7800 ggacggaacg gccgcccgac agctgggcgg aacgtgaagc catagattg gcgcgcgagg 7860 tttaccggct tcgcggaaag aggtcagcgc agtggcttgc ggctcggacc aggaactcg 7920 gccacgaagt atcccgttcg gtgatttccg atttggagaa tgggcgacgt aggtatgtca 7980 cgaccgctga gctagtaata ctcgctgccg cactcgatac gtccccagta acgctgatgt 8040 accccggccc gtattccgat tcggtggaat ttctacctga acgagaagtt ccggaattcg 8100 atgcagcgca gtggttttcg gcaaacgggt ggtcgcaaga gctagcgagt gcgttcgacg 8160 gcgatttcgg atttgcttgg cgcacagatc agcttcgcca atggcgacgc ctggcggaat 8220 tggaagatgc ccgcgcccgc gtgacggcgc gagccgaact tgaccgtgac cgcgatcaaa 8280 tcgaaatgta cgacagaatg attcgcgaat tgtggcaaca aatcgagggt aacgag 8336 <210> 3 <211> 128 <212> DNA <213> Mycobacterium abscessus <400> 3 cgcatacgtt agagccattg gggcgcattg ctttacatcg gtttcatact gctgtgttcg 60 tactcgtacg ctagtgttca gctgcgtttg tatcaggaaa gtggcgacac gggagtcata 120 tctccttt 128 <210> 4 <211> 2237 <212> DNA <213> Mycobacterium abscessus <400> 4 gtcaagcttt cgatgatgtt gggcaccccg gcaccacatg atcgttcgtg atcgagtaca 60 ggtaccagtt atcggttttg cggagctcca cagtggcctc ggaggcaaag ggttttgggt 120 tggggggatc tttgagcgtc cgccgagtat cagcggtgta ggtgtagcac acgcgcagga 180 ccgctgaagg cggactcagc gcggccaggg ccgtatcgga caggtgcaga tcgtcgtctc 240 tgtaaatcct gccctgcgat tcgtcagctt tctgaactgt tccgagttcg tgtaccgcgt 300 cacgcagacg gccatattgg tctgcctcga gatcgggcac cacgatcttc ataaacttgg 360 cgtaccgggc gccgccctga tcacaggcac cattgcaagc caccactgcg ggccagatgt 420 cgttggcgaa ccggggaatt accccgttgg tatcgggaac atttgttgac gtgctggcga 480 ctggggactg cagaatctcc gagggcgcag gcggtggact cgtacatccc gtcagcaccg 540 caagggttaa cgacaggcag gcgagccggg tgcgggtggt catggcttga gcctgagaac 600 atcggcgctg tcccggcgtt ccgttacgtc atcaagcctt accgccatgc ctgagccggg 660 tgcgttaagc atgaagccgt taccgacgta gagcccggtg tgtggggtac ctccaccagt 720 gaacggcgtt ccgccttcgc ggaatacgag gatatcgccg ggctgtgcaa agttgtcgat 780 ctgcttggac ggcacagctt gaggctgacc gtggtcgaag atggggttta tatcgaggcg 840 gtcggtccct gggatgtctc cgcgtggcac gaacggatcg aaaccggccc cttgttgcac 900 tgagtaccgc acaagcccgc cgcagtcgaa cccgatccgg ttccaatcct cgtaggtatc 960 cgctgaggtg cccttttccc catgtccacg tgatggcccg ttggggtcgg tgttgccgcc 1020 ccaagcgtag gaaactccct gtgagcggcc agcggcgccg atcgatcgta aagccttgtc 1080 gctaacagct tctggcttcg ggagcgccag cggcggttga cctgccgcgc gctgtgtgcc 1140 gtcggcattc ttgccggata ggtagtcttt ccaggcttga tcacgtgctg gtcccgggcc 1200 ggtgttctgg tcgtagcctg gcggattgtc cgccatggga atggttttcg cgccatcgat 1260 catcgtgggc ttggcaccgt tgggatatgg cggattaccg tctgcgccgc ctacgggctc 1320 ggaggcattg agcgcgacag gcggggcttg tggtgtaggt gctggtgcgt cggtgacatc 1380 ggcgcgcaga gcggctgcga tttcctgctc aacttgggtg gcgcgttgtt cgagggtggt 1440 gacttgttgt tgcaggcggg cgatttggtc gtcttgcagg tgcttgtcag tgtctttgac 1500 cttggtcgtg gcgacgactt tgccgtcgtc ggtgatcgtg gcgccgattg cttgagcgtc 1560 ttgatcgagc atgcccagtt tgttggtgac ctcccgtacg tcatcgatag cgggtttgac 1620 ggctttagcg accttctcgg cggcatcagc cttatcgccc agatctacac gcgtcttgcc 1680 cgcgctgtct ttccacgccc ccgcggtgac accgccccac gtggacagat cattagcgac 1740 ctgttccata ccctccccga ggcgatgcag gctggccgct cgtgctgcgg cggtatcgaa 1800 cagcttctcc aacgtctcgg ctttccaatg ccggatatca ccaaccttgg ccacaatcag 1860 ctcccgcttc ccggcccgcc gaaacggcca gcgttaccgt catcggcgcc aaccaccttg 1920 gcggtggcat caagaatcca agtcgcatga tcgcccacct gtttgcgtat cgcctcgtgc 1980 tgctggtccc acccggcacg taagttttcc attgctgagc cgaccacccc tggccagcga 2040 gaagctaatt cggtcaggtc cgcatcgtgg ccgatgtggt cctggcggtg cgtctccaca 2100 tggtccaaca gcttgttggc ctgcctgtgc agcaactccg ggtcgaatct caacggctcg 2160 gacatatcgg cctcccgccc gacttggtga cggccatcac cctgtttgcc agcgagccta 2220 acactgcgcc catagtg 2237 <210> 5 <211> 1208 <212> DNA <213> Mycobacterium abscessus <400> 5 gcgcgatgag acaggtcacc cgtgccgtta ctgccaaggc ggcgcgggtg gcaccgctca 60 gaacctgcgt gcgctgatgg cccagaacca aaaaggtagg agaatgccgc cgtgcgggag 120 gacgaacgtt taggcggcgg cttgcaagcg ccggctgctg gaggcttccc ataaggccgc 180 tctgggggcc tctctcaaga accgggcatc atttgacctg cgataatgat caatcggttg 240 gtgggtgtcg gtcatagccg tcatagtgga cgcagatacg atggtgcaat cgaggatctg 300 agaaaggagt tccgccgtga ccgtcacaga gactgcgtgt gaagtagtgg agttgacctc 360 agatgaaggt gccgagttgt tcgacagcat cgctcagaac aacatgggca tcacaggggc 420 ggagtttgtg cgacgttgga acgcagggga atttgaaggg atcaactggg acgacgttcc 480 agggctgacg tcggtcgcga cggcgctgcc tttcgcaggc atctgagaga cacgtttgcc 540 aaagtgcctg gtcgcacccc tcacgacgcg atccgtaatt acatagatcc gcttcaacag 600 gcggtttcat gtttagggtg cgccaagatc caactttcac aaacgcccaa gaggtacggc 660 gaattcggag catggatcct caacgggggc aacggaatgg tgctccgagg attcggtaag 720 ttctacgcca cccagcggtt tgagttagtt cctacgacag cggatctgca cgatgctcct 780 gaaaaggagc cctttcgggt ttcgacgcgc gaatatatct accgactcga aattgctaat 840 gagagtcatg tcatcgaatg gcactggcac ccggtaggga acagcgacga gcggcgcccc 900 cacatccacc ctgcaatcaa ccgggatgcg catctccccg gtccccgggt ggtgctggaa 960 gacgtaatag agggctgtat cgcactaggc gcgacacctg cctgcgagga ctggaaagag 1020 cggctagccg ccagcggtgg cgtccacaag ctgtacagga catgggtcca cgagcctggc 1080 gatctaaaga agcctgcagt aaaagaggac tagctagctt tcacgtggtc ccgaacttgg 1140 gacgcgtgag cgccaagagc cgctgaggcc gccgggagag ggccacatcg caccagcagc 1200 cggtttca 1208 <210> 6 <211> 480 <212> DNA <213> Mycobacterium abscessus <400> 6 ccttccgtgg atcgtgttgg tggcgaataa aaaacgggat ttcagtgacg gttgggtgtt 60 gaaaacaaat tggggcaggg ggggcgtttg cctaagccat gaggggcggg cgccggaccc 120 ctcgggttca ctcccccggg gggtcgtcgt ggagtgcggc ttgtccgagg cgctcgacgt 180 agccgctgac ggtgggcagc actggccgaa atccgcagcg ggccacgtgc caggcgtcgc 240 gcagatcaga cttgttcttg gcgcgggcgg cgacgatgcg tgcagcggag gcatcgccgt 300 tagggatcaa cgtgtgggcg cggtcgccac cgatcccggc agattgcagc agcgcgccga 360 gtccttcgac ggcgtagccg aatcgttcgc gcgccacgag ggcttcggac catgcgatga 420 cggctttcgg tccggccttg gtgatcgtcg gcccgtcgtt gaggtcatcg gtcgggatca 480 <210> 7 <211> 1040 <212> DNA <213> Mycobacterium abscessus <400> 7 cttcagcggc agcttcaagc gaattagcgt atggttcaag ggatttagac cactgggcca 60 atatggtgtc ggcgtgagcg ttgagcgcct caccgatcgt gcgcccctcc tcgtccttgg 120 cggcgcggtc taggccgagc tgcgcaagca tgtggtcaag aaggtggccg gttaccacag 180 ggtcagcgtg gtaatcctgg tccttcttca tgcagctgag cacggagtac ctgagggcgt 240 ccgcgctgcc agcaccgatc tgcgccttct cgaccaacgc tcgggccgag gccacagcct 300 ctacgaatgg atcgggcagc ggaatttcaa ggcgttcggc ggcgcgttgc acctggacga 360 ggtaggaacg ggttgtggcg gtgtagacgg acatgtgttt gtctcctagt agttttcgtt 420 gaaagcgatt tcgccggtta gggcttcgcg caggaagttg atttcgactt gacgcgggtg 480 tttccggggc cggtgattgt tgccctcgcc cggtacgtag ttggacgatt caggctgcgg 540 tgcgggagga gtgccgaggc gttcgtaaag acgcttaagg tcctcggaat cggcactgtc 600 cgttgcggtc tcgtcgccac gcagtcgccg tagcagatcg gtggcagggg cttcggtgtc 660 actgttgagc tgctgtagca cctgcttcca gtcgggttta tccatgtggt tcttgccttt 720 cgtcgaagat ccagcgcccg ccgactttgc gttgcccgga tttgagtgcg tggcggcgga 780 tggtgcgggg cgaaactcca aggcgctcag ccctttgttg cactgtctcc aattctgctc 840 ccgccgtttc ggggtgtcca gaaacctgtc cgctatcgga cacactgcgc tgcaacgctt 900 cccatgttcg atgcaaggcc ggtgggatcg gggtgccttg gcggcgacgg cgcgctagtt 960 cctccccgag cacccatgcg gcggtgcgaa gatcccgcac gctgaccacg cggtgctctc 1020 ccgtggcgca ttgggtgcaa 1040 <210> 8 <211> 1338 <212> DNA <213> Mycobacterium abscessus <400> 8 ggctgcgctg tcgtgctcat gccgcccccg tcgcctcgtc ctggccgtct ttggtggtga 60 tttcctgctt ctttcgcggc gggtacgagt tgaccaccac ggcggcggta accccgagcg 120 gccgctgctc gtgcggcagg gaatcgaacc actcccggca cgaggccagc gcagggcatt 180 ggcggcatat ccgcgtcgct gcctggcggg cgtagtcgcg ctcgtccagg gcgcctcggc 240 catcgccgat agcggcgtcg aacaactcgt gccgtccccg gcagcgcgcc ccaggcagta 300 caggcgtggc tagttcggcc agcagcgtgt cccagttcac cgcgccccct cctggtcctg 360 agcatctgtt tcgttgagtg cttgtgcggc agcccaattg ccgtgtcgtg ggcagtcggt 420 gaggttgtcc aggcgcccgt agtcgtcaca gtgtgggcag ttgcgtatct gccggatcgc 480 ttcgcggcgg gtgttggcgc gctcgcgtgt cttgcggcag tgtgcgcagt agcggcagga 540 catcaggcgg ttctccctcc ctgggcttgc gcccagctga cgtgacgcgg gcagggcttg 600 agtccgtcat cgacttcgat ccggcccaag tcgtcgcaat ccgggcagtc ccgaatcacc 660 tgcacggctg cgcgtttgcg ttcggcctcc gacgccgtgg cagccttgcg cagcgctgcg 720 cagtcgcggc agctctcacc cacccaggca tcaggtgcga tgtgcgcgtg cttggcgcaa 780 cgcgtccccg tctcattgcc gttagctgat tgccgccctc ggctggcggg ggtgatcgcg 840 taggcgtccg ggtcgtcaag ttccgtaccc ccataacgca accccctctt ttgatgtggt 900 cctgatgtgg tggggggcac cgccgtgcgg gtcaaagagg caccgccgta cgggctatcg 960 gaccgttgac ccgcaccgct gtgcgggctt tggctgtttt gacccgcacg gccatgcggg 1020 gtatcaccgt tttgacccgc accgccatgc ggggtatttg cgatcggaac cagccgatac 1080 acggcggcat gacgcttgaa tccgtttgct gtgcgctgga tgagccccag ctcgcggcct 1140 cgcttgagcg ccgtttccac agcccgttcg gtgagcccgc atttccgcat gagcccttct 1200 attccaggcc gcgcgttggt gccgtccgcg tagtcggcga acgtctcaag cgccaggaga 1260 actatccgct gggccaacgt cagggccttg gccccgagaa cataatcgcg ccagtcacgg 1320 cgctgctctg gcgtcacg 1338 <210> 9 <211> 164 <212> DNA <213> Mycobacterium abscessus <400> 9 gtaagccgcc ctgtgcgtca gcaggcaatg cacggcttcg gctagcgcgc acgctggcgt 60 gcaactgggc cgcgcgatgc acgtcgcagc gcacaacagg gcgcacacca tcacgcaccg 120 tgacgcacaa ctcgtgcact cccccaggcc catcgggcag ccga 164 <210> 10 <211> 892 <212> DNA <213> Mycobacterium abscessus <400> 10 ccaacaagcc cgccgcccaa tggtgcccgt gcgcactcac gcagaggcat cgcgctccac 60 cgcgtgatga gtgcaatctg ttccgatcac aaggactcca cgacctcagc ggcggcgcgc 120 agcgcatcag tcaggcgtcg cgccgcgctc gcttccatcc agtcctcgac accattgacc 180 caacgcacgc cccactcaac cgaaccatct gcggcctgct gggtgccctc tatgagcaca 240 tgccccaagc cctcgcccac ctcgaaccgg gcgccctcta gcctgcgccc ccagtccggc 300 gattccttag agcccatgtt catccactgg tcagcatgtg aggcttgagc tgggatcggc 360 acatgcgcga accggatacc agcttgatgc gtctcgatat cgagggtgat cttgaaaagg 420 agactcaacg ctgcgttgtc ggcctgactc gtggcccgcc atggcgtgac cccagccgcc 480 gccaactcct cggcgcgctc caactgcgct acccagtcag ccggtagtcg atcaaccaag 540 tcacgccatg tccgggtgtc gtcgccaaat tcgatctgta ccatgagatt tacctacttt 600 ctgttgatgg ttggttgcag cggctcccgc ccgacgttgc cgcgtcgggg actacggggg 660 ccgttggcat agccgaactt gtgccgacga gctgaacttg tgcgcgatat tcgcgcttgg 720 ccccgtcagc gtcggtcacg gtcaccgtga tcacatcgcc ctcggcctcc acgctggccg 780 tggaattcgg aaccaccttg ccatcccgaa taatgcatgg cgacaaggga acccacggct 840 cttgcgctag ccgcgccgcg atcctgtacg cctcgatact cacgccgcgc ct 892 <210> 11 <211> 849 <212> DNA <213> Mycobacterium abscessus <400> 11 tcaagcttgg cgatgtactc gttgatctgc ctgtcagtgc tgaatcggcg cttaccaatc 60 ctcacgctgg cgagggcacc agagtgccag agctggaaca ccagcgttct gctgatacct 120 ccgagctttg cccccactgc cttgtggtcg tgcattgcgt cctcctccgt tcatggctgc 180 ttgtgcgttc aaacacgcag acatccgata agttgcgttt ctgcgactca atagatacca 240 ggcggatggc aatgaacgca agcagtgcat atcctgcgtg tcatgacgca atcagggccg 300 aaaaggccga gttggacgga acggccgccc gacagctggg cggaacgtga agcgcataga 360 ttggcgcgcg aggtttaccg gcttcgcgga aagaggtcag cgcagtggct tgcggctcgg 420 accaaggaac tcggccacga agtatcccgt tcggtgattt ccgatttgga gaatgggcga 480 cgtaggtatg tcacgaccgc tgagctagta atactcgctg ccgcactcga tacgtcccca 540 gtaacgctga tgtaccccgg cccgtattcc gattcggtgg aatttctacc tgaacgagaa 600 gttccggaat tcgatgcagc gcagtggttt tcggcaaacg ggtggtcgca agagctagcg 660 agtgcgttcg acggcgattt cggatttgct tggcgcacag atcagcttcg ccaatggcga 720 cgcctggcgg aattggaaga tgcccgcgcc cgcgtgacgg cgcgagccga acttgaccgt 780 gaccgcgatc aaatcgaaat gtacgacaga atgattcgcg aattgtggca acaaatcgag 840 ggtaacgag 849 <210> 12 <211> 25 <212> DNA <213> Artificial <220> <223> C28-f primer <400> 12 tcctcggaat cggcactgtc cgttg 25 <2(Note: There seems to be an error in the original text here. It should probably be <210> 13, but translated as is for now)> 13 <211> 27 <212> DNA <213> Artificial <220> <(Note: There seems to be an error in the original text here. It should probably be <223> C28-r primer, but translated as is for now)> 223> C28-r primer <400> 13 tacagcagct caacagtgac accgaag 27 <210> 14 <211> 27 <212> DNA <213> Artificial <220> <223> Tag <400> 14 tggcaacatt tttcactggg tttatag 27 <210> 15 <211> 27 <212> DNA It should be noted that there seem to be some errors or unclear parts in the original text, such as the inconsistent format in some tags. The translation is done as accurately as possible based on the provided text.<213> artificial <220> <223> Label <400> 15 tgcatcgagt gacagctaat gtgtgat 27 <210> 16 <211> 27 <212> DNA <213> artificial <220> <223> Label <400> 16 ctataaaccc agtgaaaaat gttgcca 27 <210> 17 <211> 27 <212> DNA <213> artificial <220> <223> Label <400> 17 atcacacatt agctgtcact cgatgca 27 <210> 18 <211> twenty two <212> DNA <213> artificial <220> <223> 1-C28-1f primer <400> 18 gcgcgatgag acaggtcacc cg 22 <210> 19 <211> 20 <212> DNA <213> artificial <220> <223> 1-C28-1r primer <400> 19 gcagtctctg tgacggtcac 20 <210> 20 <211> 20 <212> DNA <213> artificial <220> <223> 1-C28-2f primer <400> 20 gacgcagata cgatggtgca 20 <210> twenty one <211> 25 <212> DNA <213> artificial <220> <223> 1-C28-2r primer <400> twenty one tgaaaccggc tgctggtgcg atgtg 25 <210> twenty two <211> 20 <212> DNA <213> artificial <220> <223> 2-C28-1f primer <400> twenty two cttcagcggc agcttcaagc 20 <210> twenty three <211> twenty three <212> DNA <213> artificial <220> <223> 2-C28-1r primer <400> twenty three ttgcacccaa tgcgccacgg gag 23 <210> twenty four <211> twenty one <212> DNA <213> artificial <220> <223> 3-C28-1f primer <400> twenty four cgcaccgtga cgcacaactc g 21 <210> 25 <211> 20 <212> DNA <213> artificial <220> <223> 3-C28-1r primer <400> 25 tcggctgccc gatgggcctg 20 <210> 26 <211> twenty three <212> DNA <213> artificial <220> <223> 4-C28-1f primer <400> 26 tcaagcttgg cgatgtactc gtt 23 <210> 27 <211> 26 <212> DNA <213> artificial <220> <223> 4-C28-1r primer <400> 27 cgcccattct ccaaatcgga aatcac 26 <210> 28 <211> 25 <212> DNA <213> artificial <220> <223> 4-C28-2f primer <400> 28 gcattgcgtc ctcctccgtt catgg 25 <210> 29 <211> 25 <212> DNA <213> artificial <220> <223> 4-C28-2r primer <400> 29 ctcgttaccc tcgatttgtt gccac 25 <210> 30 <211> 17 <212> DNA <213> artificial <220> <223> T28-1f primer <400> 30 gatgagtgcg cccgaag 17 <210> 31 <211> 18 <212> DNA <213> artificial <220> <223> T28-1r primers <400> 31 tctactcgtc gccgcttg 18
Claims
1. A method for determining whether the 28th base of the erm(41) gene, corresponding to sequence number 1, in acid-fast bacteria belonging to the Mycobacterium abscessis complex is cytosine or thymine, the method comprising: In the genomic DNA of the acid-fast bacteria being identified, an indicator base sequence was detected. When the base in the erm(41) gene was cytosine, the indicator base sequence was present in a region of the genomic DNA outside the erm(41) gene. When the base in the erm(41) gene was thymine, the indicator base sequence was absent. The detection of the indicator base sequence indicates that the base of the erm(41) gene in the genomic DNA of the acid-fast bacteria is cytosine. The absence of detected indicator base sequence indicates that the base in the erm(41) gene of the acid-fast bacteria is thymine. The index base sequence is either the first base sequence containing more than 50 consecutive bases in the base sequence of sequence number 2, or the second base sequence complementary to the first base sequence.
2. The method according to claim 1, wherein, The first base sequence includes, in at least a portion, a sequence of 10 or more consecutive bases contained in the base sequence of sequence number 3, 5, 7, 9 or 11.
3. A primer set for detecting an indicator base sequence in which, when the 28th base of the erm(41) gene corresponding to sequence number 1 in acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine, the indicator base sequence is present in a region of the genomic DNA outside the erm(41) gene; and when the 28th base is thymine, the indicator base sequence is absent. The primer set includes a first primer and a second primer. The first primer contains a polynucleotide with a 3' end containing the base sequence f12, which is capable of hybridizing with the complementary base sequence of a partial base sequence f11 consisting of 10 or more consecutive bases contained in the indicator base sequence. The second primer contains a polynucleotide with the base sequence r12 at its 3' end, which is capable of hybridizing with a partial base sequence r11 consisting of 10 or more consecutive bases contained in the indicator base sequence and located closer to the 3' end than the partial base sequence f11. The index base sequence is the third base sequence containing more than 50 consecutive bases in the base sequence of sequence number 2.
4. The primer set according to claim 3, wherein, The third base sequence comprising at least 20 consecutive bases from the 5' end of the partial base sequence f11 to the 3' end of the partial base sequence r11 is included in a portion of the base sequences containing sequence numbers 3, 5, 7, 9, or 11.
5. The primer set according to claim 3 or 4, wherein, The partial base sequence f11 is The sequence of serial number 2 (f11-12-1) contains a sequence of 10 or more consecutive bases in the range of positions 4624 to 4668. The sequence of serial number (f11-18-1) 2 contains a sequence of 10 or more consecutive bases in the range of positions 2356 to 2397. The sequence of serial number (f11-20-1) 2 contains a sequence of 10 or more consecutive bases in the base sequence from position 2624 to 2663. The sequence of serial number (f11-22-1) 2 contains a sequence of 10 or more consecutive bases in the base sequence from position 4044 to 4083. The sequence of serial number 2 (f11-24-1) contains a sequence of more than 10 consecutive bases in the range of positions 6535 to 6575. (f11-26-1) The sequence of serial number 2 contains a sequence of 10 or more consecutive bases in the range of positions 7478 to 7520, or The sequence of serial number 2 (f11-28-1) contains a sequence of more than 10 consecutive bases in the range of positions 7629 to 7673. The partial base sequence r11 is The sequence of (r11-13-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 4694 to 4740. The sequence of serial number (r11-19-1) 2 contains a sequence of 10 or more consecutive bases in the range of positions 2672 to 2711. The sequence of (r11-21-1) serial number 2 contains a sequence of 10 or more consecutive bases in the range of positions 3539 to 3583. The sequence of (r11-23-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 5061 to 5103. The sequence of (r11-25-1) sequence number 2 contains a sequence of 10 or more consecutive bases in the range of positions 6566 to 6605. The sequence of (r11-27-1) serial number 2 contains a sequence of 10 or more consecutive bases in the range of positions 7931 to 7976, or The (r11-29-1) sequence number 2 contains a sequence of more than 10 consecutive bases in the range of positions 8302 to 8346.
6. The primer set according to any one of claims 3 to 5, wherein, One of the first primer and the second primer further includes a tag portion that can bind to the tagging substance or a tag portion that is a tagging substance, and the other further includes a binding portion that can bind to the tag that is a tagging substance.
7. A reagent kit comprising: The primer set as described in claim 6, and At least a portion of the solid carrier includes a portion capable of bonding with the said joint. The kit is used to detect an indicator base sequence. When the 28th base of the erm(41) gene corresponding to sequence number 1 in acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine, the indicator base sequence exists in a region outside the erm(41) gene in the genomic DNA. When the 28th base is thymine, the indicator base sequence does not exist.
8. A combination of a probe and primer set for detecting an indicator base sequence in which the indicator base sequence is present outside the erm(41) gene of genomic DNA when the 28th base of the sequence corresponding to sequence number 1 in the acid-fast bacteria belonging to the Mycobacterium abscess complex is cytosine, and the indicator base sequence is absent when the 28th base is thymine. The probe comprises a polynucleotide containing a base sequence capable of hybridizing with a partial base sequence p1 consisting of 10 or more consecutive bases contained in the indicator base sequence. The index base sequence is either the first base sequence containing 50 or more consecutive bases in the base sequence of sequence number 2, or the second base sequence complementary to the first base sequence. The primer set is the primer set according to any one of claims 3 to 6.
9. The probe according to claim 8, wherein, The partial base sequence p1 is at least a sequence of 10 or more consecutive bases contained in a base sequence containing sequence numbers 3, 5, 7, 9 or 11, or their complementary base sequence.
Citation Information
Patent Citations
Primer set capable of identifying nontuberculous mycobacteria 3 subspecies, and method of identifying nontuberculous mycobacteria 3 subspecies
JP2019097493A
Pneumatic tire
JP2020066277A
Amplified nucleic acid detection method and detection device
WO2012070618A1