Recombinant plasmid for expressing salt-tolerant protease, yeast engineering bacteria, fermentation medium and application thereof

By inserting recombinant plasmids with specific nucleic acid sequences into engineered yeast and optimizing the fermentation medium, the problem of decreased protease activity under high salt conditions was solved, enabling efficient expression and purification of salt-tolerant proteases suitable for protein substrate processing in high-salt environments.

CN115851808BActive Publication Date: 2026-05-29SOUTH CHINA UNIV OF TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA UNIV OF TECH
Filing Date
2022-11-22
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

In existing technologies, the activity of proteases decreases under high-salt environments, resulting in low catalytic efficiency, increased application costs, and a lack of effective methods to improve the salt tolerance of proteases.

Method used

Recombinant plasmids containing native signal peptides, native leader peptides, and enzyme functional regions were used to construct engineered yeast strains. The concentration of metal cofactors in the fermentation medium was optimized, and efficient secretion and purification of salt-tolerant proteases were achieved through heterologous expression.

Benefits of technology

It significantly improved the salt tolerance and SDS tolerance of the salt-tolerant protease expressed by engineered yeast, enabling efficient degradation of soy protein isolate under high temperature and high salt conditions, and simplifying the purification process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115851808B_ABST
    Figure CN115851808B_ABST
Patent Text Reader

Abstract

The application discloses a recombinant plasmid for expressing salt-tolerant protease, a yeast engineering bacterium, a fermentation medium thereof and application. Key elements for heterologous expression of the salt-tolerant protease are confirmed, and the recombinant plasmid for expressing the salt-tolerant protease and the yeast engineering bacterium are constructed. The long-term salt-tolerance level and SDS tolerance of the salt-tolerant protease expressed by the yeast engineering bacterium are significantly improved, and the salt-tolerant protease can effectively and significantly degrade soybean protein isolate under high-temperature and high-salt conditions, so that the salt-tolerant protease has important application value for efficient catalysis of protein substrates in traditional high-salt fermentation industry. The application also realizes efficient secretion of the salt-tolerant protease by optimizing the concentration of enzyme cofactors. Furthermore, electrophoretically pure grade recombinant salt-tolerant protease is obtained through one-step separation and purification, and the purification process is simple and efficient.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and specifically relates to a recombinant plasmid expressing a salt-tolerant protease, an engineered yeast strain, its fermentation medium, and its applications. Background Technology

[0002] Proteases have a wide range of applications in pharmaceuticals, biochemicals, food, brewing, and leather and fur processing. They can be used for the degradation, treatment, and modification of protein substrates. However, in some high-salt environments, the high salt concentration can cause a decrease or even inactivation of proteases, greatly inhibiting their catalytic activity during the treatment process. This results in prolonged reaction times, poor treatment effects, and increased application costs.

[0003] Currently, only a few studies have reported that salt tolerance of proteases can be improved by truncating their structural domains or through directed evolution. Further research on improving the salt tolerance of proteases is needed. At present, the field of salt-tolerant proteases urgently needs to explore new enzyme resources and develop new methods to improve the salt tolerance of proteases to meet market demands.

[0004] Our research group previously isolated a high-yield salt-tolerant protease-producing strain, *Pseudomonas aeruginosa* SWJSS3, from the deep-sea seabed using a high-salt enrichment method. MALDI-TOFMS identified the enzyme as pseudolysin encoded by the *lasB* gene. However, *Pseudomonas aeruginosa* is an opportunistic pathogen, posing a risk of causing various acute and chronic diseases in humans. Summary of the Invention

[0005] The primary objective of this invention is to address the shortcomings and deficiencies of existing technologies by providing a recombinant plasmid expressing a salt-tolerant protease.

[0006] Another objective of this invention is to provide a yeast strain expressing a salt-resistant protease, which contains a recombinant plasmid expressing the salt-resistant protease. This invention employs a safe biological expression system for heterologous expression of the salt-resistant protease, thereby enhancing the foundation for its industrial application.

[0007] Another object of the present invention is to provide a fermentation medium for the above-mentioned engineered yeast strain expressing salt-resistant protease.

[0008] Another object of the present invention is to provide the application of the above-mentioned engineered yeast strain expressing salt-resistant protease.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] A recombinant plasmid expressing a salt-resistant protease is created by inserting a native signal peptide, a native propeptide domain, and a mature enzyme domain into the expression plasmid.

[0011] The nucleic acid sequence of the native signal peptide is as shown in SEQ ID No. 1: ATGAAGAAGGTTTCTACGCTTGACCTGTTGTTCGTTGCGATCATGGGTGTTTCGCCGGCCGCTTTTGCC.

[0012] The nucleic acid sequence of the native propeptide domain is as shown in SEQ ID No. 2:

[0013] The nucleic acid sequence of the enzyme's mature domain is as shown in SEQ ID No. 3:

[0014] GCCGAGGCGGGCGGCCCCGGTGGCAACCAGAAGATCGGCAAGTACACCTACGGTAGCGACTACGGTCCGCTGATCGTCAACGACCGCTGCGAGATGGACGACGGCAACGTCATCACCGTCGATATGAACGGCAGCACCAACGACAGCAAGACCACGCCGTTCCGCTTCGCCTGCCCGACCAACACCTACAAGCAGGTCAACGGCGCCTATTCGCCGCTGAACGACGCGCATTTCTTCGGCGGCGTGGTGTTCAACCTGTACCGGGACTGGTTCGGCACCAGCCCGCTGACCCACAAGCTGTACATGAAGGTGCACTACGGGCGCAGCGTGGAGAACGCCTACTGGGACGGCACGGCGATGCTCTTCGGCGACGGCGCCACCATGTTCTATCCGCTGGTGTCGCTGGACGTGGCGGCCCACGAGGTCAGCCACGGCTTCACCGAGCAGAACTCCGGGCTGATCTACCGCGGGCAATCCGGCGGAATGAACGAGGCGTTCTCCGACATGGCCGGCGAGGCCGCCGAGTTCTACATGCGCGGCAAGAACGACTTCCTGATCGGCTACGACATCAAGAAGGGCAGCGGTGCGTTGCGCTACATGGACCAGCCCAGCCGCGACGGGCGATCCATCGACAACGCCTCGCAGTACTACAACGGTATCGACGTGCACCACTCCAGCGGCGTGTACAACCGTGCGTTCTACCTGCTGGCCAACTCGCCGGGCTGGGATACCCGCAAGGCCTTCGAGGTGTTCGTCGACGCCAACCGCTACTACTGGACCGCCACCAGCAACTACAACAGCGGTGCCTGTGGAGTGATTAGCTCGGCGCAGAACCGCAACTACTCGGCGGCTGACGTCACCCGGGCGTTCAGCACCGTCGGCGTGACCTGCCCGAGCGCGTTGTAA。

[0015] The preferred expression plasmids are CPOTud, p426GPD, p426TEF, p426ADH, p426CYC, p416GPD, p4216TEF, p4126ADH, p416CYC, p425GPD, p425TEF, p425ADH, p425CYC, p415GPD, p4215TEF, p4125ADH, p415CYC, p424GPD, p424TEF, p424ADH, p424CYC, p414GPD, and p42... 14TEF, p4124ADH, p414CYC, p423GPD, p423TEF, p423ADH, p423CYC, p413GPD, p4213TEF, p4123ADH, p413CYC, pSP-GM1, pRS303, pRS304, pRS305, pRS306, pRS413, pRS414, pRS415, pRS416, pRS423, pRS424, pRS425 or pRS426; more preferably CPOTud.

[0016] A yeast strain expressing salt-tolerant protease is obtained by transforming the above-mentioned recombinant plasmid into a yeast strain.

[0017] The starting yeast strain is Saccharomyces cerevisiae B184M, CEN.PK 530.1C, CEN.PK 113.5D, BY4742, BY4741, CEN.PK2-1D, CEN.PK2-1C or IMX581.

[0018] A fermentation medium suitable for the above-mentioned engineered yeast strains expressing salt-resistant proteases is YPD medium supplemented with Ca. 2+ and / or Zn 2+ ;

[0019] The Ca 2+ The concentration is 1-20 mM, preferably 5 mM;

[0020] The Zn 2+ The concentration is 0.05-0.8 mM, preferably 0.4 mM.

[0021] The application of the above-mentioned recombinant plasmids or engineered yeast strains expressing salt-resistant proteases in the production of proteases.

[0022] Furthermore, the application includes the following steps:

[0023] The above-mentioned engineered yeast strain expressing salt-tolerant protease was inoculated into the above-mentioned fermentation medium and cultured.

[0024] The culture is preferably carried out at 30-37℃ for more than 96 hours to collect salt-tolerant protease; more preferably, it is carried out at 30℃ for 96 hours.

[0025] Furthermore, the application also includes the following steps:

[0026] The fermentation broth was repeatedly filtered through an ultrafiltration tube to remove most of the pigments and proteins. Then, it was loaded onto an ion exchange column, and the permeate was collected in separate tubes to obtain electrophoretic-pure salt-tolerant protease.

[0027] The ultrafiltration tube has a molecular weight cutoff of 10 kDa, 30 kDa, or 50 kDa, preferably 30 kDa;

[0028] The ion exchange column is a Q strong anion exchange column or a DEAE weak anion exchange column, preferably a DEAE weak anion exchange column.

[0029] Application of the above-mentioned recombinant plasmids or engineered yeast strains expressing salt-tolerant proteases in the high-salt degradation of soy protein isolate.

[0030] The recombinant salt-tolerant protease produced by the yeast engineered strain of the present invention can effectively degrade soy protein isolate under high temperature and high salt levels. Therefore, the above-mentioned recombinant plasmid and yeast engineered strain can be used to produce salt-tolerant protease and degrade soy protein isolate under high salt conditions.

[0031] The present invention has the following advantages and effects compared with the prior art:

[0032] (1) This invention constructs a yeast engineered strain that expresses salt-tolerant protease and confirms the key elements of heterologous expression of salt-tolerant protease. The long-term salt tolerance level and SDS tolerance of the salt-tolerant protease expressed by this yeast engineered strain are significantly improved, and it can effectively and significantly degrade soybean protein isolate under high temperature and high salt conditions. It has important application value for the efficient catalysis of protein substrates in traditional high-salt fermentation industry.

[0033] (2) This invention achieves efficient secretion of salt-tolerant protease by optimizing the concentration of metal cofactors in the fermentation medium. Furthermore, this invention obtains electrophoretically pure recombinant salt-tolerant protease through a one-step separation and purification process, which is simple and efficient. Attached Figure Description

[0034] Figure 1 This is a diagram showing the results of multiple sequence alignment of the lasB gene from different strains.

[0035] Figure 2 This is a diagram of the lasB gene amplified from P. aeruginosa SWJSS3.

[0036] Figure 3 It is Zn 2+ and Ca2+ Graphs showing the fold increase in enzyme activity and cell density at different concentrations of enzyme added.

[0037] Figure 4 This is a schematic diagram of plasmid construction.

[0038] Figure 5 This is a graph showing the intracellular and extracellular enzyme activity results of different strains.

[0039] Figure 6 These are images showing the Western blot and protein purification results of salt-tolerant protease expressed by engineered yeast; where A is the Western blot image and B is the protein purification result image.

[0040] Figure 7 This is a graph showing the sodium chloride and SDS tolerance results of the salt-tolerant protease expressed by the purified engineered yeast.

[0041] Figure 8 This is a diagram showing the results of hydrolysis of soy protein isolate by a purified salt-tolerant protease expressed by engineered yeast under high salt conditions. Detailed Implementation

[0042] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and raw materials used in the present invention are all commercially available.

[0043] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0044] Unless otherwise specified, experimental methods in the following examples are generally performed under conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (Beijing: Science Press, 2017) and Yeast Genetics: A Laboratory Manual (Beijing: Science Press, 2016).

[0045] To better understand the content of this invention, Saccharomyces cerevisiae B184M (disclosed in PNAS, 2015, 112: E4689–E4696) was used as the starting strain, and CPOTud vector (disclosed in Biotechnology and Bioengineering, 2012, 109(5): 1259-1268; pAlphaAmyCPOT disclosed in that document was obtained by KpnI+NheI digestion) was used as the expression plasmid for further explanation of specific embodiments.

[0046] The culture media involved in the following examples are as follows:

[0047] LB medium containing 100 μg / mL ampicillin: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, sterilized and cooled to about 50°C, then add 100 μg / mL ampicillin (filtered for sterilization);

[0048] YPD medium: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose (sterilized separately and then added);

[0049] YPD modified medium: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose (added separately after sterilization), 5 mM CaCl2 and 0.4 mM ZnCl2;

[0050] Solid culture media are prepared by adding 20 g / L agar powder to the corresponding liquid culture medium.

[0051] The above culture medium was prepared using ultrapure water.

[0052] In the following examples, the relevant indicators of salt-resistant protease were determined according to the following methods:

[0053] (1) Biomass determination: Dilute the bacterial culture to an appropriate ratio and measure the absorbance at a wavelength of 600 nm, which is the OD value. 600 value.

[0054] (2) Extracellular enzyme activity: The activity of salt-tolerant protease was determined using the casein method (Meth. Enzymol., 1995, 248:242-253). Fermentation supernatant or purified sample was diluted to 200 μL with 50 mM Tris-HCl buffer (pH = 7.5). After preheating at 40 °C for 10 min, 200 μL of 20 g / L substrate was added to the enzyme solution every 15 s, and the mixture was shaken to mix. After reacting for 10 min, 400 μL of 10% trichloroacetic acid was added to terminate the reaction, and the mixture was shaken to mix. Then, the mixture was centrifuged at 14000 rpm for 2 min, and the supernatant was carefully collected and the absorbance was measured at 275 nm. Enzyme activity is defined as: one unit of enzyme activity (U) is defined as the amount of tyrosine produced per milliliter of enzyme solution per minute at 40 °C through the hydrolysis of casein.

[0055] (3) Intracellular enzyme activity: After centrifuging 500 μL of bacterial solution at 12000 rpm for 2 min, the supernatant was removed. The bacterial cells were washed with 0.01 M PBS to remove residual culture medium. Then, 500 μL of 0.01 M PBS was added to resuspend the bacterial cells. The bacterial solution was then added to a 2 mL sample tube (containing 0.7 g 0.5 mm ordinary glass beads), homogenized for 2 min (7.0 m / s, 10 ℃, with a 1 min interval in between), centrifuged at 14000 rpm for 2 min, and the supernatant was taken and diluted with the appropriate factor. Then, the intracellular enzyme activity was determined according to the method for determining extracellular enzyme activity.

[0056] (4) SDS-PAGE: The sample was diluted with 5×Sample Buffer at a ratio of 4:1, and then heated at 100℃ for 10 min. Electrophoresis was performed at 150V for 45 min until the bromophenol blue band reached the bottom of the gel. The protein bands were then visualized using Coomassie Brilliant Blue staining, and finally photographed using a gel imaging system.

[0057] (5) Western blotting: After SDS-PAGE electrophoresis, protein bands on the gel were transferred to a PVDF membrane at 200 mA for 2 hours. Then, QuickBlock was used to blot the protein bands. TM Blocking Buffer (Biyuntian) for 30 minutes, and then... TM HisTag Antibody (Genscript) was incubated at room temperature for 2 hours. PVDF membranes were then incubated for 2 hours with HRP-labeled goat anti-mouse IgG (H+L) (Beyotime). The membranes were washed three times with TBST for 10 minutes each between each step. Finally, the membranes were inspected using Pierce... TM Protein bands were detected using ECL Western Blotting Substrate (Thermo), and chemiluminescence imaging was performed using a gel imaging system.

[0058] The primer sequences involved in the following examples are shown in Table 1:

[0059] Table 1 Primer sequences

[0060]

[0061] Example 1: Obtaining the salt-tolerant protease encoding gene

[0062] Ten lasB genes were randomly selected from the Genbank database of the National Center for Biotechnology Information (NCBI) using the keywords "(lasb [Gene Name]) AND Pseudomonas aeruginosa [Organism]". Multiple sequence alignment was then performed using Clustal Omega. The results are as follows: Figure 1As shown, the lasB gene consists of 1497 bp of nucleotides, and its upstream and downstream sequences are highly conserved. Therefore, primer pairs NPlasBF2 and NPlasBR2 were designed at both ends of the conserved upstream and downstream sequences. Subsequently, using the genome of a high-yield salt-tolerant protease-tolerant strain preserved in our laboratory (Pseudomonas aeruginosa SWJSS3, accession number CGMCC NO.10973, disclosed in CN201610073533.1) as a template, PCR was performed using Phanta DNA polymerase with NplasBF2+NplasBR2 as primers. The amplification was performed independently twice to avoid DNA polymerase mismatch.

[0063] like Figure 2 As shown, two identical target bands were obtained around 1500 bp. The PCR product was recovered and double-digested with NdeI and KpnI. Simultaneously, the CPOTud framework was excised from pAlphaAmyCPOT (disclosed in the literature "Biotechnology and Bioengineering, 2012, 109:1259-1268") using KpnI and NheI, and ligated with T4 DNA ligase to obtain plasmid pCP-lasB.

[0064] The recombinant plasmid was transformed into *E. coli* DH5α, and positive transformants were identified by colony PCR. For correctly identified strains, plasmid extraction and enzyme digestion were performed, and the samples were finally sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The gene sequence and amino acid sequence are shown in SEQ ID No. 4 and SEQ ID No. 5, respectively. Sequence analysis showed that the open reading frame (ORF) of the salt-tolerant protease was 1497 bp in length (1-69 bp for the signal peptide, 70-591 bp for the leader peptide, and 592-1497 bp for the enzyme functional region), encoding 498 amino acids (1-23 AA for the signal peptide, 24-197 AA for the leader peptide, and 198-498 AA (black area represents the enzyme functional region)).

[0065] Example 2: Construction of engineered yeast strains expressing salt-tolerant protease

[0066] The salt-tolerant protease encoding gene lasB was submitted to Nanjing GenScript Biotech Co., Ltd. for codon optimization and gene synthesis, resulting in plasmid pUC57-lasB, the sequence of which is shown in SEQ ID No. 6 (where the terminal CACCACCATCATCACCAT is a histidine tag added for Western blot detection). The gene fragment lasB2 with restriction sites at both ends was obtained by double digestion with Kpn I and Nhe I.

[0067] The plasmid pAlphaAmyCPOT was double-digested with Kpn I and Nhe I to obtain a vector framework with the same restriction sites.

[0068] The gene fragment and vector framework were ligated using T4 DNA ligase to obtain plasmid plasB2, which was then transformed into E. coli DH5α competent cells using the calcium chloride method. The plasmid was then plated on LB agar plates containing 100 μg / mL ampicillin and incubated overnight at 37°C. Colonies on the plates were then identified by PCR using the primer pair CPF / lasBCYR. Correctly identified colonies were inoculated into LB liquid medium containing 100 μg / mL ampicillin and incubated for 12–16 h. Plasmid extraction was then performed according to the plasmid miniprep kit instructions, followed by restriction enzyme digestion and sequencing.

[0069] The confirmed plasmid was transformed into Saccharomyces cerevisiae B184M using the lithium acetate method and plated onto YPD solid medium plates. After incubation at 30°C, positive transformants were observed. Colony PCR was then performed using primer pairs CPF / lasBCYR or lasBCYF / CPR ​​to identify the strain B_lasB2 expressing salt-tolerant protease.

[0070] Example 3: Optimization of fermentation conditions for engineered yeast expressing salt-tolerant protease

[0071] The inventors discovered that adding metal ions (Zn) to the culture medium... 2+ and Ca 2+ This allows for the efficient secretion and expression of the enzyme.

[0072] First, 0.05 mM, 0.1 mM, 0.2 mM, 0.4 mM, 0.6 mM, and 0.8 mM Zn were added to YPD medium, respectively. 2+ (ZnCl2) and 1mM, 2.5mM, 5mM, 10mM, 15mM, 20mM Ca 2+ (CaCl2) was cultured at 30℃ and 200 rpm for 96 h. The biomass (cell density) of the fermentation broth was measured, followed by the determination of extracellular enzyme activity. Results are as follows: Figure 3 As shown, regardless of adding Zn alone 2+ Or Ca 2+ The enzyme activities of both proteases showed a regular trend of first increasing and then decreasing, and were highest at 0.2 mM Zn. 2+ and 5mM Ca 2+ It reaches its maximum value at that point.

[0073] Then, in 0.2mM Zn 2+ Add 0-20mM Ca to the base 2+ And at 5mM Ca 2+Add 0-0.8mMZn to the base 2+ The increase in enzyme activity was found to be relatively small, but still showed an increase, and at 5 mM Ca 2+ +0.4mM Zn 2+ The maximum value was found at the combination site, which was 2.41 times that of the YPD culture medium control group.

[0074] In subsequent experiments, the salt-tolerant protease-resistant engineered yeast was cultured using modified YPD medium, i.e., YPD basal medium, supplemented with 5 mM Ca. 2+ and 0.4mM Zn 2+ .

[0075] Example 4: Confirmation of key components in heterologous expression of salt-resistant protease

[0076] Construction of plasmids for key elements of heterologous expression of salt-resistant proteases, such as Figure 4 As shown. First, fusion PCR was performed using the following primers to amplify gene fragments containing different elements.

[0077] Using primer pair NF / NR1, a lasB native signal peptide (Native SP) fragment containing a homologous arm of the lasB enzyme functional region was amplified from the plasB2 plasmid; using primer pair lasBF1 / lasBR, a lasB enzyme functional region fragment containing a homologous arm of the lasB native signal peptide was amplified from the plasB2 plasmid; using primer pair NF / lasBR, the two fragments were fused together by fusion PCR to obtain fragment lasB1.

[0078] Using primer pair AF / AR2, an α-factor pre signal peptide fragment with a homologous arm of the lasB enzyme functional region was amplified from the pAlphaAmyCPOT plasmid; using primer pair lasBF2 / lasBR, a lasB enzyme functional region fragment with a homologous arm of the α-factor pre signal peptide was amplified from the plasB2 plasmid; using primer pair AF / lasBR, the two fragments were fused together by fusion PCR to obtain fragment lasB3.

[0079] Using primer pair AF / AR3, an α-factor pre signal peptide fragment with a homologous arm of the lasB leader peptide was amplified from the pAlphaAmyCPOT plasmid; using primer pair lasBF3 / lasBR, a lasB leader peptide and enzyme functional region fragment with a homologous arm of the α-factor pre signal peptide were amplified from the plasB2 plasmid; using primer pair AF / lasBR, the two fragments were fused together by fusion PCR to obtain fragment lasB4.

[0080] Using primer pair AF / AR4, an α-factor prepro signal peptide fragment with a homologous arm of the lasB enzyme functional region was amplified from the pAlphaAmyCPOT plasmid; using primer pair lasBF4 / lasBR, a lasB enzyme functional region fragment with a homologous arm of the α-factor prepro signal peptide was amplified from the plasB2 plasmid; using primer pair AF / lasBR, the two fragments were fused together by fusion PCR to obtain fragment lasB5.

[0081] Using primer pair AF / AR5, an α-factor prepro signal peptide fragment with a homologous arm of the lasB leader peptide was amplified from the pAlphaAmyCPOT plasmid; using primer pair lasBF5 / lasBR, a lasB leader peptide and enzyme functional region fragment with a homologous arm of the α-factor prepro signal peptide were amplified from the plasB2 plasmid; using primer pair AF / lasBR, the two fragments were fused together by fusion PCR to obtain fragment lasB6.

[0082] The obtained fragments lasB1, lasB3, lasB4, lasB5, and lasB6 were then integrated into the vector framework via enzyme digestion and ligation according to the procedure in Example 2, resulting in five plasmids: plasB1, plasB3, plasB4, plasB5, and plasB6. Together with plasB2 from Example 2, this yielded a total of six plasmids. These plasmids were then transformed into *Saccharomyces cerevisiae* CEN.PK530-1C and B184M, respectively, yielding strains: K_lasB1, K_lasB2, K_lasB3, K_lasB4, K_lasB5, K_lasB6 and B_lasB1, B_lasB2, B_lasB3, B_lasB4, B_lasB5, B_lasB6. Finally, they were cultured under the conditions described in Example 3, and intracellular and extracellular enzyme activities were measured.

[0083] like Figure 5 As shown, using the traditional α-factor signal peptide of *Saccharomyces cerevisiae* (K_lasB6 and B_lasB6 strains) resulted in almost undetectable enzyme activity, while using the native signal peptide of the salt-resistant protease yielded a large amount of detectable extracellular enzyme activity. The precursor peptide of the salt-resistant protease is a key element in its heterologous expression; the absence of this element or the addition of other precursor peptides at its tip leads to almost no expression of the enzyme. The strain B_lasB2, which ultimately produced the highest level of extracellular salt-resistant protease, contained the following expression elements: native signal peptide, native precursor peptide, and enzyme functional region.

[0084] Example 5: One-step protein purification of salt-tolerant protease expressed by engineered yeast

[0085] Sample pretreatment: The recombinant Saccharomyces cerevisiae strain B_lasB2, resistant to salt protease, was cultured in YPD modified medium at 30℃ and 200 rpm for 96 h to obtain fermentation broth. Then, 300 mL of the fermentation broth was centrifuged at 12000 rpm for 10 min to remove cell pellet and filtered through a 0.45 μm PES microporous membrane. The filtrate was collected and concentrated using a 30 kDa ultrafiltration centrifuge tube. The concentrate was then repeatedly ultrafiltered using Buffer A (50 mM Tris-HCl, pH = 8.0) to remove most of the pigments from the fermentation broth, finally yielding 5 mL of concentrated solution.

[0086] Protein purification: A DEAE weak anion exchange column (Hitrapcapto DEAE 1mL) was purchased from GE Healthcare. The column was first equilibrated with Buffer A. Then, 5mL of the above concentrated solution was loaded at a flow rate of 1mL / min. The target protein in the sample eluted as permeate, while the pigment protein was adsorbed onto the column. The permeate was collected in separate tubes, and then SDS-PAGE and extracellular enzyme activity assays were performed on each tube to obtain purified salt-resistant protease. The pigment protein on the column could be removed by gradient elution (100% Buffer B, 20CV) using Buffer B (50mM Tris-HCl 1M NaCl, pH=8.0). Figure 6 As shown, this method can be used to obtain electrophoretically pure salt-tolerant proteases (such as...). Figure 6 As shown in B), and the bands are consistent with protein blots (as shown in B). Figure 6 The results are consistent with those shown in Figure A.

[0087] Example 6: Salt tolerance assessment of salt-tolerant protease expressed by engineered yeast

[0088] First, purified salt-tolerant protease expressed by engineered yeast (100 μg / mL) and purified salt-tolerant protease from *P. aeruginosa* SWJSS3 (stored at -80℃) were mixed with NaCl aqueous solutions of different concentrations to achieve final NaCl concentrations of 0 M, 2 M, and 3 M. The mixtures were incubated at 4℃ for 7 days, and extracellular enzyme activity was measured every 24 hours. The residual enzyme activity was calculated by comparing the activity of the sample without NaCl treatment on day 1. Simultaneously, to assess tolerance to the denaturing agent SDS, the two purified salt-tolerant proteases were mixed with different concentrations of SDS to achieve final SDS mass percentage concentrations of 0%, 0.05%, and 0.1%, respectively. The mixtures were incubated at 4℃ for 1 hour, and the residual enzyme activity was calculated by comparing the activity of the sample without SDS treatment before incubation. The results are as follows: Figure 7As shown, the salt-tolerant protease derived from *P. aeruginosa* SWJSS3 was almost completely inactivated after 7 days in solutions containing 2M and 3M NaCl, while the salt-tolerant protease expressed by engineered yeast retained 25.79% and 15.19% of its enzyme activity, respectively. After storage in a solution containing 0.05% SDS for 1 hour, the activity of the salt-tolerant protease expressed by engineered yeast remained almost unchanged, while the salt-tolerant protease derived from *P. aeruginosa* SWJSS3 lost 62.02% of its enzyme activity.

[0089] Example 7: Hydrolysis of soy protein isolate by salt-tolerant protease expressed by engineered yeast under high temperature and high salt conditions.

[0090] First, two 10 mg / mL soy protein isolate dispersions containing 3M NaCl were prepared: low-denatured soy protein isolate (LD-SPI) and high-denatured soy protein isolate (HD-SPI). The pH of the dispersions was adjusted to 7.0, and the mixtures were stirred at room temperature for 2 hours, then incubated overnight at 4°C for complete hydration. Next, purified salt-tolerant protease expressed by engineered yeast was added to the dispersions at a dosage of 2000 U / g, and hydrolyzed at 60°C. Samples were taken at different time points, and the enzyme was inactivated by heating at 90°C for 20 minutes, followed by centrifugation at 14000 rpm for 10 minutes to collect the supernatant for later use. Figure 8 As shown, the recombinant salt-tolerant protease can significantly hydrolyze β-conglycinin of LD-SPI and glycinin subunits of HD-SPI in 3M NaCl.

[0091] The above results demonstrate that the engineered yeast strain constructed in this invention can achieve efficient secretion of salt-tolerant protease, further improving the salt tolerance of the protease. It can also hydrolyze soy protein isolate under high salt conditions, showing broad application prospects in resource processing in high-salt environments and efficient catalysis of protein substrates in traditional high-salt fermentation industries.

[0092] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A yeast strain expressing a salt-tolerant protease, characterized in that: The recombinant plasmid expressing salt-tolerant protease was transformed into a yeast strain to obtain the product. The recombinant plasmid expressing salt-resistant protease is obtained by inserting native signal peptide, native leader peptide and enzyme functional region into the expression plasmid; The nucleic acid sequence of the native signal peptide is shown in SEQ ID No. 1; The nucleic acid sequence of the native leader peptide is shown in SEQ ID No. 2; The nucleic acid sequence of the enzyme's functional region is shown in SEQ ID No. 3; The starting yeast strain is Saccharomyces cerevisiae.

2. The engineered yeast strain according to claim 1, characterized in that: The expression plasmids are CPOTud, p426GPD, p426TEF, p426ADH, p426CYC, p416GPD, p4216TEF, p4126ADH, p416CYC, p425GPD, p425TEF, p425ADH, p425CYC, p415GPD, p4215TEF, p4125ADH, p415CYC, p424GPD, p424TEF, p424ADH. p424CYC, p414GPD, p4214TEF, p4124ADH, p414CYC, p423GPD, p423TEF, p423ADH, p423CYC, p413GPD, p421 3TEF, p4123ADH, p413CYC, pSP-GM1, pRS303, pRS304, pRS305, pRS306, pRS413, pRS414, pRS415, pRS416, pRS423, pRS424, pRS425 or pRS426.

3. The engineered yeast strain according to claim 1, characterized in that: The starting yeast strain is Saccharomyces cerevisiae B184M, CEN.PK 530.1C, CEN.PK 113.5D, BY4742, BY4741, CEN.PK2-1D, CEN.PK2-1C or IMX581.

4. The use of the engineered yeast strain according to any one of claims 1-3 in the production of salt-tolerant protease.

5. The application according to claim 4, characterized in that, Includes the following steps: The engineered yeast strain according to any one of claims 1-3 is inoculated into a fermentation medium and cultured at 30-37°C for more than 96 hours. The fermentation medium mentioned is YPD medium with added Ca 2+ and / or Zn 2+ ; The Ca 2+ The concentration of Zn is 1-20 mM. 2+ The concentration is 0.05-0.8 mM.

6. The application according to claim 5, characterized in that, The Ca 2+ The concentration of Zn is 5 mM. 2+ The concentration was 0.4 mM.

7. The application according to claim 5, characterized in that, Includes the following steps: The fermentation broth of the yeast engineered strain according to any one of claims 1-3 is repeatedly filtered through an ultrafiltration tube to remove most of the pigments and proteins, and then loaded onto an ion exchange column. The permeate is collected by separate tubes to obtain electrophoretic pure salt-tolerant protease. The ultrafiltration tube has a molecular weight cutoff of 10 kDa, 30 kDa, or 50 kDa; The ion exchange column is a Q-strong anion exchange column or a DEAE-weak anion exchange column.

8. The use of the yeast engineered strain according to any one of claims 1-3 in the degradation of soy protein isolate.