Single gene detection method and application thereof

By detecting hydroxymethylcytosine in plasma using digital PCR, the challenges of screening for patients who will benefit from targeted drug therapy and predicting tumor metastasis in existing technologies have been solved, enabling rapid and accurate disease detection and treatment selection.

CN115851934BActive Publication Date: 2026-03-24PEKING UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-16
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Current technologies lack effective methods for early screening of cancer patients who will benefit from targeted drug therapy, and cannot accurately predict tumor metastasis and organ damage during treatment. Existing detection methods rely on tumor tissue samples, which are time-consuming and have poor specificity.

Method used

The number of hydroxymethylcytosine in plasma was detected by digital PCR based on target genes to identify the target region. The population that would benefit from treatment was screened by hydroxymethylation sequencing. Nucleic acid probes were used to bind to hydroxymethylcytosine for enrichment and sequencing, thus achieving rapid and accurate disease detection.

Benefits of technology

It enables rapid and accurate screening of patients who will benefit from targeted drug therapy, and can provide early warning of tumor metastasis and organ damage, thus improving the efficiency and specificity of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application relates to a single gene detection method and application thereof. Specifically, the application relates to a gene modification detection method, which comprises (S1) determining a to-be-detected region based on the number and / or presence of hydroxymethylcytosine of a positive sample and a negative sample in clinical examination of a target gene, and (S2) detecting the number and / or presence of the hydroxymethylcytosine of the to-be-detected region of a to-be-detected sample.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the biomedical field, specifically to a single-gene detection method and its application. Background Technology

[0002] Currently, there are no effective methods in clinical practice to pre-screen cancer patients who will truly benefit from targeted therapy, nor are there reliable methods to provide early warnings of tumor metastasis and organ damage during treatment. Common methods for screening patients who will benefit from targeted therapy involve using tumor tissue samples obtained through biopsy or surgery to perform immunohistochemistry (IHC) and in situ hybridization fluorescence (FISH) tests on relevant target genes to determine if the patient is suitable for targeted therapy. However, this method requires tumor tissue samples, resulting in long waiting periods for patients, and is also affected by tumor heterogeneity and metastasis, leading to poor specificity in screening for patients who will benefit from targeted therapy. DNA hydroxymethylation is an important form of epigenetic modification and, as a promising biomarker, is closely related to the occurrence and development of many human diseases. However, research on screening specific populations for DNA hydroxymethylation has not yet been developed. Therefore, there is an urgent need to develop a convenient, rapid, and accurate detection method to pre-screen patients who will benefit from treatment and to provide early warnings of tumor metastasis and organ damage. Summary of the Invention

[0003] On the one hand, this application provides an analytical method comprising (S1) determining a test region based on the quantity and / or presence of hydroxymethylcytosine in clinically positive and negative samples of a target gene, and (S2) detecting the quantity and / or presence of the hydroxymethylcytosine in the test region of the test sample.

[0004] On the other hand, this application provides a method for confirming the existence of a disease, assessing the formation or risk of disease formation, assessing the progression and / or prognosis of a disease and / or screening a population that is appropriate for treatment, comprising (S1) determining the region to be tested based on the quantity and / or presence of hydroxymethylcytosine in clinically positive and clinically negative samples of a target gene, and (S2) detecting the quantity and / or presence of hydroxymethylcytosine in the region to be tested in the sample to be tested.

[0005] On the other hand, this application provides an analytical method comprising detecting the quantity and / or presence of hydroxymethylcytosine in the test region of a single target gene in a test sample using digital PCR based on a single target gene.

[0006] On the other hand, this application provides a method for confirming the existence of a disease, assessing the formation or risk of disease formation, assessing the progression and / or prognosis of the disease, and / or screening for a population that is suitable for treatment, comprising detecting the quantity and / or presence of hydroxymethylcytosine in the test region of a test sample based on a single target gene using digital PCR.

[0007] On the other hand, this application provides a nucleic acid comprising a sequence capable of binding to the test region, or its complementary region, or the aforementioned fragments, as determined by the method described in this application.

[0008] On the other hand, this application provides a method for preparing nucleic acids, comprising determining a sequence of a test region, or its complementary region, or the aforementioned fragment, according to the method described in this application, and designing a nucleic acid capable of binding the test region, its complementary region, or the aforementioned fragment.

[0009] On the other hand, this application provides a kit containing the nucleic acid described in this application.

[0010] On the other hand, this application provides the use of the nucleic acid described in this application and / or the reagent kit described in this application in the preparation of disease detection products.

[0011] On the other hand, this application provides the use of the nucleic acid described in this application and / or the kit described in this application in the preparation of products for confirming the presence of a disease, assessing the formation or risk of disease formation, assessing the progression and / or prognosis of a disease and / or screening for a population with appropriate treatment.

[0012] On the other hand, this application provides a database containing a sequence of regions to be tested, or complementary regions thereof, or the aforementioned segments determined by the method described in this application.

[0013] On the other hand, this application provides a storage medium containing a program capable of running the methods described in this application.

[0014] On the other hand, this application provides an apparatus that includes the storage medium described in this application.

[0015] On the other hand, this application provides the device described herein, which further includes a processor coupled to the storage medium, the processor being configured to execute, based on a program stored in the storage medium, the method described herein.

[0016] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description

[0017] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and drawings described in detail below. A brief description of the drawings is as follows:

[0018] Figure 1 The data shows the copy number (ng) of the PD-L1 hydroxymethylation site (CD274) in a 5hmC library of cell-free DNA from the plasma of 49 melanoma patients; among them, there was a significant difference between the PD-L1 positive group (PD-L1+) and the PD-L1 negative group (PD-L1-) (p<0.01).

[0019] Figure 2 The data shows the copy number (ng) of the EGFR hydroxymethylation site in a 5hmC library of cell-free DNA from the plasma of 56 patients with esophageal squamous cell carcinoma; among them, there was a significant difference between the EGFR-positive group (EGFR+) and the EGFR-negative group (EGFR-) (p<0.01).

[0020] Figure 3 The data shows the copy number (ng) of the HER2 hydroxymethylation site (ERBB2) in a single gene detected in a 5hmC library of cell-free DNA from the plasma of 36 breast cancer patients; among them, there was a significant difference between the HER2-positive group (HER2+) and the HER2-negative group (HER2-) (p<0.01). Detailed Implementation

[0021] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.

[0022] Terminology Definition

[0023] In this application, the term "sample" generally refers to a material or mixture of materials, typically in liquid or other form, which may contain one or more target analytes.

[0024] In this application, the terms “determine,” “measure,” “evaluate,” “assess,” “determine,” and “analyze” are used interchangeably and generally refer to any form of measurement, including determining the presence or absence of an element. These terms can all encompass both quantitative and / or qualitative aspects. Assessments can be relative or absolute. “Assessing the presence of…” can include determining the quantity of something's presence, as well as determining whether it is present or not.

[0025] In this application, the terms "clinical test sample," "clinically positive sample," and "clinically negative sample" generally refer to samples whose positive or negative status is determined through clinical testing methods. For example, samples can be tested and confirmed using recognized clinical guideline testing methods to arrive at a conclusion that the sample is clinically positive or clinically negative. Commonly used clinical testing methods in this field may include, but are not limited to, clinical immunohistochemical detection, clinical FISH detection, gene mutation detection, gene expression level detection, and blood tests for genes and tumor markers that predict the occurrence of diseases and related symptoms.

[0026] For example, a simplified procedure for clinical immunohistochemical testing may include freezing or paraffin sectioning of clinical tissue, blocking, incubating with antibodies and staining, photographing, and grading according to signal strength. The stronger signal and higher grade are considered clinically positive samples, while the weaker signal and lower grade are considered clinically negative samples.

[0027] For example, a simplified procedure for clinical FISH testing might include FISH sample preparation, probe preparation, probe labeling, hybridization, chromosome banding, fluorescence microscopy detection, and result analysis. Clinical tissue is sectioned, then labeled and hybridized with probes. The fluorescence signal is detected and graded based on signal intensity. Samples with stronger signals and higher grades are considered clinically positive, while those with weaker signals and lower grades are considered clinically negative.

[0028] For example, a simplified procedure for gene mutation detection may include taking a sample of the patient's tumor tissue, extracting DNA, and testing it using a kit and other methods to determine whether the patient has a mutation; samples with mutations are considered positive for clinical testing; samples without mutations are considered negative for clinical testing.

[0029] For example, gene detection methods may include: polymerase chain reaction-restriction fragment length polymorphism analysis, pyrosequencing, single-strand conformational polymorphism analysis, probe amplification arrest mutation system, high performance liquid chromatography, micro digital polymerase chain reaction, and high resolution melting curve analysis.

[0030] For example, gene expression level detection can involve selecting reagent kits and other methods based on the gene and tumor characteristics to determine whether a patient has gene expression level variations; those with gene expression level variations are considered positive samples for clinical testing; and those without gene expression level variations are considered negative samples for clinical testing.

[0031] For example, genes predicting the occurrence of diseases and related symptoms can include genes associated with diseases and related symptoms obtained through existing sequencing data or sequencing of clinical patient samples (including DNA, RNA, etc.) and data analysis, as well as genes whose expression levels can predict the occurrence of diseases and related symptoms even when they have not yet occurred. Samples with a high predictive correlation to diseases and related symptoms can be used as positive samples in clinical tests, while samples with a high predictive correlation to diseases and related symptoms can be used as negative samples in clinical tests.

[0032] For example, blood tests for tumor markers can involve collecting blood to check the levels of tumor markers in the blood. Alternatively, pleural effusion or ascites can be drained and sent for tumor marker testing. Changes in tumor marker levels in the pleural or ascites fluid can be compared with changes in tumor marker levels in the patient's blood, thereby enhancing disease monitoring and diagnosis. Samples with a high predictive correlation to the disease and its related symptoms can be used as clinically positive samples, while samples with a high predictive correlation to the disease and its related symptoms can be used as clinically negative samples.

[0033] In this application, the term "sequencing" generally refers to a method by which the identity of at least 10 consecutive nucleotides of a polynucleotide can be obtained (e.g., the identity of at least 20, at least 50, at least 100, or at least 200 or more consecutive nucleotides).

[0034] In this application, the term "UDP glucose modified with a chemoselective group" generally refers to a UDP glucose that has been functionalized, possibly at the 6-hydroxyl position, to include groups capable of participating in a 1,3-cycloaddition (or "click") reaction. Such groups may include azide and alkynyl groups (e.g., cyclooctyne). For example, UDP-6-N3-Glu can be a UDP glucose modified with a chemoselective group.

[0035] In this application, the term "biotin moiety" generally refers to an affinity marker that includes biotin or biotin analogs such as desulfurized biotin, oxidized biotin, 2-iminobiotin, diaminobiotin, biotin sulfoxide, and biocytin. The biotin moiety can bind to streptavidin.

[0036] In this application, the terms "cycloaddition reaction" and "click reaction" are generally used interchangeably to describe a 1,3-cycloaddition reaction between an azide and an alkynyl group to form a five-membered heterocycle. In some embodiments, the alkynyl group may be strained (e.g., in a ring such as cyclooctyne), and the cycloaddition reaction may be carried out under copper-free conditions. Dibenzocyclooctyne (DBCO) and difluorooctyne (DIFO) are examples of alkynyls capable of participating in copper-free cycloaddition reactions.

[0037] In this application, the term "biotin-binding carrier" generally refers to a carrier (e.g., a bead, which may be magnetic) attached to streptavidin or avidin or its functional equivalent.

[0038] In this application, the term "amplification" generally refers to generating one or more copies of the target nucleic acid using the target nucleic acid as a template.

[0039] In this application, the term "copy of a fragment" generally refers to the amplified product, wherein the copy of a fragment may be the reverse complement of the fragment strand, or may have the same sequence as the fragment strand.

[0040] In this application, the term "enrichment" generally refers to the partial purification of an analyte having a certain characteristic (e.g., a nucleic acid containing hydroxymethylcytosine) from an analyte lacking that characteristic (e.g., a nucleic acid containing hydroxymethylcytosine). For example, enrichment typically increases the concentration of the analyte having that characteristic (e.g., a nucleic acid containing hydroxymethylcytosine) by at least 2, 5, or 10 times relative to the analyte lacking that characteristic. After enrichment, at least 10%, at least 20%, at least 50%, at least 80%, or at least 90% of the analyte in the sample may have the characteristic used for enrichment. For example, in the enriched composition, at least 10%, at least 20%, at least 50%, at least 80%, or at least 90% of the nucleic acid molecules may contain chains having one or more hydroxymethylcytosine molecules modified to contain a capture marker. Invention Details

[0042] On one hand, this application provides an analytical method comprising (S1) determining a test region based on the quantity and / or presence of hydroxymethylcytosine in clinically positive and negative samples of a target gene, and (S2) detecting the quantity and / or presence of the hydroxymethylcytosine in the test region of the test sample. For example, the test region may include a subregion of a region where a single target gene is located.

[0043] On the other hand, this application provides a method for confirming the presence of a disease, assessing the formation or risk of disease, evaluating disease progression and / or prognosis, and / or screening for patients who are eligible for treatment, comprising (S1) determining a test region based on the quantity and / or presence of hydroxymethylcytosine in clinically positive and negative samples of a target gene, and (S2) detecting the quantity and / or presence of the hydroxymethylcytosine in the test region of the test sample. For example, the test region may include a subregion of a region containing a single target gene.

[0044] For example, the region to be tested can be determined based on the quantity and / or presence of hydroxymethylcytosine in the clinically positive and negative samples of a single target gene.

[0045] For example, step (S1) of the method of this application may include step (S1-1): determining the clinically positive sample and the clinically negative sample of the target gene.

[0046] For example, step (S1) of the method of this application may include step (S1-2): determining the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinical test positive sample and the clinical test negative sample by means of hydroxymethylation sequencing method.

[0047] For example, step (S1) of the method of this application may include step (S1-3): determining the regions containing differentially expressed hydroxymethylcytosine in the clinical test positive sample and the clinical test negative sample as the regions to be tested.

[0048] For example, step (S2) of the method of this application may include detecting the quantity and / or presence of hydroxymethylcytosine in the test region of the test sample by sequencing.

[0049] For example, this application provides an analytical method or a method for confirming the existence of a disease, assessing the formation or risk of disease formation, assessing disease progression and / or prognosis, and / or screening for a population with appropriate treatment, comprising the steps (S1-1): identifying the clinically positive and negative samples of the target gene; step (S1-2): determining the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive and negative samples by hydroxymethylation sequencing; step (S1-3): identifying the regions containing differentially expressed hydroxymethylcytosine in the clinically positive and negative samples as the test regions; step (S2) may include detecting the quantity and / or presence of hydroxymethylcytosine in the test regions of the test sample by sequencing.

[0050] For example, this application provides an analytical method or a method for confirming the existence of a disease, assessing the formation or risk of disease, assessing disease progression and / or prognosis, and / or screening a population with appropriate treatment, comprising the steps (S1-1): identifying the clinically positive and negative samples of the target gene; step (S1-2): determining the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive and negative samples by hydroxymethylation sequencing; step (S1-3): when the absolute value of the log2-processed ratio of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive sample to that of the clinically negative sample is 0.5 or more, the region is identified as the test region; step (S2) may include detecting the quantity and / or presence of hydroxymethylcytosine in the test region of the test sample by sequencing.

[0051] For example, this application provides an analytical method or a method for confirming the existence of a disease, assessing the formation or risk of disease formation, assessing disease progression and / or prognosis, and / or screening a population with appropriate treatment, comprising the steps (S1-1): identifying the clinically positive and negative samples of the target gene; step (S1-2): determining the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive and negative samples by hydroxymethylation sequencing; step (S1-3): when the absolute value of the log2-processed ratio of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive sample to that of the clinically negative sample is 0.5 or more, and when the difference between the clinically positive and negative samples in the same region is less than 0.05, the region is identified as the test region; step (S2) may include detecting the quantity and / or presence of hydroxymethylcytosine in the test region of the test sample by sequencing.

[0052] For example, the clinically positive and negative samples of this application can be determined by the following clinical testing methods: immunohistochemical detection, clinical FISH detection, gene mutation detection, gene expression level detection, blood tests for genes predicting the occurrence of diseases and related symptoms, and tumor markers. For example, the clinically positive and negative samples of this application can be determined by immunohistochemistry and / or fluorescence in situ hybridization. For example, the method for determining whether a clinically positive or negative sample is positive can be based on diagnostic guidelines agreed upon in the art.

[0053] For example, based on the standard of antibody staining signal in immunohistochemistry, samples with an immunohistochemical staining score of 1 or higher are clinically positive samples. For example, according to immunohistochemistry, Ventana SP142 IHC (immunohistochemistry) can be used for detection; SP142 staining can show brown punctate or linear staining distributed within the tumor or surrounding stroma. For example, the judgment criteria for immunohistochemistry can be: using a stepwise scoring method, based on the percentage of stained cells, divided into four grades: 0-<1%; 1%-<5%; 5%-<10%; ≥10%. Among these, ≥1% is considered positive.

[0054] For example, based on the standard of fluorescent probe signal in fluorescence in situ hybridization (FISH), samples with a FISH ratio of 2.0 or higher are judged as positive samples for clinical testing. For example, according to FISH, in vitro fluorescently labeled DNA probes can be used. Utilizing the principle of complementary base pairing between the probe and the target gene, the probe and the target gene are hybridized after high-temperature denaturation. The result is obtained by detecting the fluorescence signal through a fluorescence microscope, thereby detecting chromosomal or gene abnormalities in cells and tissues. For example, the judgment criteria for FISH can be: (1) red fluorescent signals clustered together; (2) red fluorescent signals showing double microbody amplification; (3) red-green fluorescent signal ratio > 1.5.

[0055] For example, the hydroxymethylation sequencing method of this application may include the following steps: (S1-2a) extracting nucleic acid fragments from a sample, (S1-2b) labeling the nucleic acid fragments containing hydroxymethylcytosine, (S1-2c) enriching the nucleic acid fragments containing hydroxymethylcytosine, and (S1-2d) sequencing the enriched nucleic acid fragments containing hydroxymethylcytosine.

[0056] For example, the labeling described in this application involves contacting the nucleic acid fragment with DNA β-glucosyltransferase and UDP glucose modified with a chemically selective group. For example, the labeling in this application could involve attaching the chemically selective group to a nucleic acid fragment containing hydroxymethylcytosine in the sample.

[0057] For example, the chemoselective group described in this application may include an azide group. For example, the chemoselective group of this application may include any chemoselective group.

[0058] For example, the labeling described in this application may further involve contacting the nucleic acid fragment with a chemically selective group with biotin containing a substance capable of reacting with the chemically selective group. For example, the biotin capable of reacting with the chemically selective group may contain biotin modified with dibenzocyclooctyne. For example, the labeling may involve attaching a first label to a nucleic acid fragment containing hydroxymethylcytosine in the sample, and may further involve attaching a second label to the nucleic acid fragment with the first label attached, the second label being capable of selectively reacting with the first label.

[0059] For example, the enrichment may involve contacting the biotin-containing nucleic acid fragment with magnetic beads containing streptavidin. For example, the labeled nucleic acid fragment containing hydroxymethylcytosine may bind to magnetic beads containing streptavidin. For example, the enrichment may involve separating the magnetic beads containing the hydroxymethylcytosine-containing nucleic acid fragment by magnetic force.

[0060] For example, step (S1) may include step (S1-3): determining regions containing differentially expressed hydroxymethylcytosine in the clinically positive and negative samples as the regions to be tested.

[0061] For example, the differentiated hydroxymethylcytosine region may include areas where the number of hydroxymethylcytosine-containing nucleic acid fragments is significantly increased and / or significantly decreased in the clinically positive sample compared to the clinically negative sample. For example, the region to be tested can be determined by determining the fold difference in the number of hydroxymethylcytosine-containing nucleic acid fragments in the same region between the clinically positive sample and the clinically negative sample. For example, the fold difference may be related to the following statistical values: the difference in the number of hydroxymethylcytosine-containing nucleic acid fragments in the same region between the clinically positive sample and the clinically negative sample, the log2-processed ratio of the number of hydroxymethylcytosine-containing nucleic acid fragments in the same region between the clinically positive sample and the clinically negative sample, and / or the absolute value of the log2-processed ratio of the number of hydroxymethylcytosine-containing nucleic acid fragments in the same region between the clinically positive sample and the clinically negative sample.

[0062] For example, when the absolute value of the log2-processed ratio of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive sample compared to the clinically negative sample is 0.5 or more, the region can be identified as the region to be tested. For example, when the difference between the clinically positive sample and the clinically negative sample in the same region is less than 0.05, the region can be identified as the region to be tested. For example, when the absolute value of the log2-processed ratio of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive sample compared to the clinically negative sample is 0.5 or more, and when the difference between the clinically positive sample and the clinically negative sample in the same region is less than 0.05, the region can be identified as the region to be tested.

[0063] For example, step (S2) of this application may include detecting the quantity and / or presence of hydroxymethylcytosine in the test region of the test sample by sequencing. For example, this application may sequence the test sample by a method selected from the group consisting of digital PCR and high-throughput sequencing. For example, the sequencing method of this application may be selected from any sequencing method known in the art.

[0064] On the other hand, this application also provides an analytical method for confirming the existence of a disease, assessing the formation or risk of disease, assessing disease progression and / or prognosis, and / or screening for patients who are eligible for treatment. This method may include detecting the quantity and / or presence of hydroxymethylcytosine (HMC) in a test region of a single target gene in a test sample using digital PCR, based on a single target gene. For example, this application provides an analytical method that includes detecting the quantity and / or presence of HMC in a test region of a single target gene obtained through initial screening in a test sample using digital PCR. For example, the initial screening step may be step (S1) of any analytical method in this application. For example, the test region in this application may be determined through steps (S1-1), (S1-2), and (S1-3) of any analytical method in this application.

[0065] On the other hand, this application also provides a method for determining a test region, said test region being used for a detection method based on the quantity and / or presence of hydroxymethylcytosine. For example, the method for determining the test region of this application includes steps (S1-1), (S1-2), and (S1-3) of any analytical method of this application.

[0066] On the other hand, this application also provides a database that may contain sequences of the test regions, their complementary regions, or the aforementioned fragments determined by the methods described in this application. For example, the test region determined by PD-L1 may be chr9:5449218-5450100. For example, the test region determined by PD-L1 may be chr9:5460114-5460435. For example, the test region determined by EGFR may be chr7:55127173-55127790. The test region determined by HER2 may be chr17:37852095-37852700.

[0067] In one aspect, this application provides a nucleic acid that may comprise a sequence capable of binding to a test region, its complementary region, or the aforementioned fragment as determined by the method described in this application. For example, the nucleic acid may be a probe. In another aspect, this application provides a method for preparing a nucleic acid, which may comprise designing a nucleic acid capable of binding to the test region, its complementary region, or the aforementioned fragment, based on a sequence of a test region, its complementary region, or the aforementioned fragment determined by the method described in this application.

[0068] For example, the nucleic acid of this application can be CTGTATTGCCACATAATGTCTATA as shown in SEQ ID NO:1. For example, the nucleic acid of this application can be ATTGAGAAATTGGACTCTTCGTTG as shown in SEQ ID NO:2. For example, the nucleic acid of this application can be TTGCATGAATGCAGGAAAAA as shown in SEQ ID NO:3. For example, the nucleic acid of this application can be AGTTGGCACTGGGTCTCTGT as shown in SEQ ID NO:4. For example, the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2 can bind to chr9:5449218-5450100. For example, the sequence shown in SEQ ID NO:3 and / or SEQ ID NO:4 can bind to chr7:55127173-55127790. For example, the sequence shown in SEQ ID NO:5 and / or SEQ ID NO:6 can bind to chr17:37852095-37852700.

[0069] In one aspect, this application provides a kit that may contain the nucleic acid described in this application. For example, the kit of this application may also contain other materials required for the kit.

[0070] In one aspect, this application provides the application of the nucleic acid of this application and / or the reagent kit of this application in the preparation of disease detection products. In another aspect, this application provides the nucleic acid of this application and / or the reagent kit of this application, which can be used for disease detection. In yet another aspect, this application provides a method for disease detection, which may include providing the nucleic acid of this application and / or the reagent kit of this application.

[0071] In one aspect, this application provides the nucleic acid of this application and / or the kit of this application for use in preparing products that can confirm the presence of a disease, assess the formation or risk of disease formation, assess the progression and / or prognosis of the disease, and / or screen for patients who are eligible for treatment. In another aspect, this application provides the nucleic acid of this application and / or the kit of this application, which can be used to confirm the presence of a disease, assess the formation or risk of disease formation, assess the progression and / or prognosis of the disease, and / or screen for patients who are eligible for treatment. In another aspect, this application provides a method for confirming the presence of a disease, assessing the formation or risk of disease formation, assessing the progression and / or prognosis of the disease, and / or screening for patients who are eligible for treatment, which may include providing the nucleic acid of this application and / or the kit of this application. For example, the disease in this application may include tumors. For example, the disease in this application may include solid tumors. For example, the disease in this application may include melanoma, esophageal tumors, and / or breast tumors. For example, the disease in this application may include melanoma. For example, the disease in this application may include esophageal squamous cell carcinoma. For example, the disease in this application may include breast cancer.

[0072] For example, any one or more methods of this application may be for non-diagnostic purposes. For example, any one or more methods of this application may be for diagnostic purposes.

[0073] On the other hand, this application also provides a storage medium that can record a program capable of running the methods described in this application.

[0074] On the other hand, this application also provides an apparatus comprising the storage medium described in this application. For example, the non-volatile computer-readable storage medium may include floppy disks, flexible disks, hard disks, solid-state storage (SSS) (e.g., solid-state drives (SSDs)), solid-state cards (SSCs), solid-state modules (SSMs)), enterprise-grade flash drives, magnetic tape, or any other non-transitory magnetic media. The non-volatile computer-readable storage medium may also include punched cards, paper tape, cursor sheets (or any other physical medium with perforated patterns or other optically identifiable markings), compact disc read-only memory (CD-ROM), rewritable optical disc (CD-RW), digital versatile optical disc (DVD), Blu-ray disc (BD), and / or any other non-transitory optical media.

[0075] For example, the device described in this application further includes a processor coupled to the storage medium, the processor being configured to execute, based on a program stored in the storage medium, the methods described in this application. For example, the database system can implement various mechanisms to ensure that the methods described in this application executed on the database system produce correct results. In this application, the database system can use a disk as a persistent data storage device. In this application, the database system can provide database storage and processing services to multiple database clients. The database clients can store database data across multiple shared storage devices and / or can utilize one or more execution platforms with multiple execution nodes. The database system can be organized such that storage and computing resources can be effectively and infinitely expanded.

[0076] The method described in this application can accurately determine the hydroxymethylation site of the target gene, enabling single-gene site detection based on 5-hydroxymethylcytosine (5hmC). This method can be used for disease detection, screening of patients who will benefit from standard treatment regimens, and screening of patients who will benefit from targeted drugs. Compared with existing target gene detection methods (such as IHC, FISH, or multi-site detection), the 5-hydroxymethylcytosine (5hmC)-based detection method described in this application is more convenient, faster, and more accurate.

[0077] The embodiments described below are not intended to be limited by any theory, but are merely for illustrating the methods and uses of this application and are not intended to limit the scope of the invention.

[0078] Example

[0079] Example 1: Single Gene Detection Method Based on 5-Hydroxymethylcytosine (5hmC) (I) Construction of 5-Hydroxymethylcytosine (5hmC) Library

[0080] plasma separation

[0081] 1. Collect 8 mL of whole blood into a 10 mL Kangwei Company (CW2815M) cfDTM free nucleic acid collection tube, and store the blood at room temperature after collection;

[0082] 2. First centrifugation: 1350g, 4℃ for 12 min. Transfer the pale yellow supernatant to a 2mL DNase-free sterile centrifuge tube.

[0083] 3. Centrifuge a second time at 13500g, 4℃ for 5 minutes. Carefully remove the supernatant and transfer it to 2-3 2mL DNasefree sterile centrifuge tubes. Store at -80°C. This will yield approximately 4-6mL of clean plasma.

[0084] cfDNA extraction from plasma, urine, and saliva

[0085] 1. Using the Quick-cfDNA Serum & Plasma Kit (ZYMO, D4076), Quick-DNA Urine KIT (ZYMO, D3061), or Quick-cfDNA Serum & Plasma Kit (ZYMO, D4076), cfDNA can be extracted from plasma, urine, and saliva samples, yielding approximately 8-10 ng of cfDNA from each sample.

[0086] 2. The concentration of cfDNA was determined using Qubit3.0.

[0087] End-completing was performed on the cfDNA and ligation was performed with the sequencing adapter.

[0088] The procedure is performed according to the KAPA HyperPlus Library Preparation Kit (KK8514) instructions, and is briefly described below:

[0089] 1. Prepare a reaction mixture containing 20 μL cfDNA, 2.8 μL End Repair & A-Tailing Buffer, and 1.2 μL End Repair & A-Tailing Enzyme mix (total volume 24 μL); incubate at 20 °C for 30 minutes, then at 65 °C for 30 minutes.

[0090] 2. Prepare the following ligation reaction mixture in a 0.5 mL low-adsorption EP tube: 2 μL Nuclease-free water, 12 μL Ligation Buffer, and 4 μL DNA Ligase; add 2 μL of sequencing KAPA index (PKR2015, PKR2016, and PKR2017) to 18 μL of the ligation reaction mixture, mix, add to 24 μL of reaction sample, and heat at 20 °C for 4 hours;

[0091] 3. The reaction product was purified using the DNA Clean & Concentrator 5 (ZYMO, D4014) purification kit, and eluted with 20 μL of elution buffer to obtain the final DNA ligation sample.

[0092] 5hmC marker

[0093] 1. Prepare a 4 μL labeling reaction mixture: 1 μL 50 μM UDP-N3-Glu (hmC labeled substrate), 2.5 μL βGT enzyme (NEB), and 2.5 μL HEPES buffer (pH 8.0, final concentration 50 mM). Add 6 μL of the labeling mixture to 20 μL of DNA ligation sample. Incubate the mixture at 37°C for 1 hour.

[0094] 2. Remove the mixture and purify the reaction product using the DNA Clean & Concentrator 5 (ZYMO, D4014) purification kit to obtain 30 μL of purified DNA;

[0095] 3. Then add 1 μL of 45 uM DBCO-PEG4-Biotin (ClickChemistry Tools) to the 30 μL of purified DNA and incubate at 37°C for 1 hour;

[0096] 4. The reaction product was purified using the DNA Clean & Concentrator 5 (ZYMO, D4014) purification kit to obtain 30 μL of purified labeled product.

[0097] 5hmC enrichment

[0098] 1. Equilibrate the bound magnetic beads according to the following steps: Take 2.5 μL of Dynabeads (Invitrogen, 65306) and add 100 μL of washing buffer (5 mM Tris (pH 7.5), 1 M NaCl and 0.02% Tween 20), mix by pipetting, place on a 1.5 mL magnetic rack, wash the bound magnetic beads 3 times with 100 μL of washing buffer, and finally add 100 μL of washing buffer, mix the magnetic beads, and vortex for 30 min;

[0099] 2. After 30 min, wash the magnetic beads three times with 100 μL of washing buffer, and finally add 32 μL of binding buffer (10 mM Tris (pH 7.5), 2 M NaCl and 0.04% Tween 20) and mix well;

[0100] 3. Add the purified labeling product obtained in the above steps to the magnetic bead mixture, and mix in a rotary mixer for 30 min to ensure complete binding;

[0101] 4. Finally, wash the magnetic beads five times with 100 μL of washing buffer and add 23.8 μL of RNase-Free water.

[0102] PCR amplification

[0103] 1. Add 25 μL of 2×PCR master mix and 1.25 μL of PCR primers (total volume 50 μL) to the final system from the above steps, and perform amplification according to the temperature and conditions of the PCR reaction cycle described below:

[0104]

[0105] 2. The amplification product was purified using AmpureXP beads (KAPA, KK8001), and finally eluted with 20 μL of elution buffer to obtain the final 5 hmC library. The library concentration can be determined using Qubit 3.0.

[0106] (II) Target gene unit site screening

[0107] High-throughput sequencing was performed on the 5hmC library after quality control.

[0108] 1. The obtained 5hmC library was subjected to quality control using the Fragment Analyzer™ fully automated capillary electrophoresis system (reagent: DNF-900; software used: Fragment Analyzer instrument control software, PROSize data analysis software) to determine the size of DNA fragments in the library and whether there are any impurities (library size is about 300bp).

[0109] 2. Perform qPCR concentration determination (kit: KAPA SYBR FAST Universal qPCR Kit (KK4601)) to determine whether the sample library meets the standards for sequencing.

[0110] Specific steps:

[0111] a. Sample preparation: Prepare 5 1.5mL EP tubes, and mix 4 samples to be sequenced into each EP tube, for a total of 20 samples in 5 tubes (index cannot be repeated); for each 5hmC library sample, aspirate 5ng, and the total volume of each EP tube is 20uL, with a final concentration of 1ng / uL;

[0112] b. Sample reaction system (20uL) is as follows: 4uL of Chinese library sample is taken from each EP tube for qPCR quantification.

[0113] reactants Volume (uL) KAPA SYBR FAST qPCR Master Mix(2X) 10 Library Quantification Primer Premix(10X) 1.6 ROX Reference Dye High (50X) 0.4 RNase-Free water 4 5hmC Library 4

[0114] c. qPCR program settings:

[0115]

[0116] d. Results analysis: Analyze the results using qPCR software to determine whether the 5hmC library has degraded and whether it meets sequencing requirements;

[0117] 3. The quality-tested library (16uL) was sequenced using I1lumina NextSeq500 with a High Output Kit v2 (75 cycles). The sequencing throughput for each sample was 1.5Gb and the sequencing band size was 75bp.

[0118] raw sequencing data alignment

[0119] 1. Each raw FASTQ sequencing dataset was first trimmed for low-quality data using Trimmomatic software, and then aligned to the human genome hg19 using Bowtie2 software;

[0120] 2. Use MACS software to identify read peaks containing 5hmC with the following parameters: effective genomesize = 2.72e+09; tag size = 38; band width = 100; model fold = 10; P value cutoff = 1.00e-05. Then, call peaks and generate a counts file.

[0121] 3. Using DEseq2 software, compare the counts files from different samples to find the 5hmC peak regions with a read count greater than 50. Based on |log2FoldChange|>=0.5 and pvalue<0.05, filter out the differentially expressed biomarkers for 5hmC upregulation and downregulation.

[0122] Hydroxymethylation site screening

[0123] 1. Determine the grouping of clinical samples: Based on the results of detecting drug therapeutic targets by methods such as clinical immunohistochemistry (IHC) and in situ hybridization fluorescence (FISH), clinical samples are divided into positive and negative groups;

[0124] 2. By comparing the positive and negative groups, 5hmC differential markers were screened according to the criteria of |log2FoldChange|>=0.5 and pvalue<0.05 to find the corresponding hydroxymethylation sites of PD-L1, EGFR, HER2, etc.

[0125] 3. Synthesize primers for hydroxymethylation sites such as PD-L1, EGFR, and HER2 (Qingke Biotechnology Co., Ltd.). For example, the site corresponding to the following PD-L1 primers can be chr9:5449218-5450100; the site corresponding to the following EGFR primers can be chr7:55127173-55127790; and the site corresponding to the following HER2 primers can be chr17:37852095-37852700.

[0126]

[0127] (III) Gene detection based on cfDNA hydroxymethylation unit sites

[0128] Sample system preparation (20 μL)

[0129] 1. The amount of 5hmC library added to the sample was 10ng, the primer standard concentration was 10uM, and the dye method premix solution was (Yongnuo, S0200020301);

[0130]

[0131]

[0132] Droplet generation

[0133] 1. Use Yongnuo sample preparation universal consumables (S0100010101) to prepare the chip. Add 50uL of droplet generation oil to the first row of 8 wells of the chip, add 20uL of sample system to the second row of 8 wells of the chip, and then add 5uL of sealant to the second row of sample wells.

[0134] reactants Volume (μL) Chip location Oil generated from microdroplets 50 First row Sample system 20 Second row sealant 5 Second row

[0135] 2. Droplet generation was performed using the Yongnuo MicroDrop-100 digital PCR system;

[0136] sealing film

[0137] 1. Transfer the prepared droplets (50 μL) into a 96-well PCR plate (S0100030101) and attach the membrane.

[0138] 2. Use the Yongnuo MicroDrop-100 digital PCR system to seal the membrane at 190℃;

[0139] PCR amplification

[0140] 1. PCR amplification procedure:

[0141]

[0142] 2. Perform PCR amplification on the samples;

[0143] Digital PCR testing

[0144] 1. The PCR products were detected and analyzed using the Yongnuo MicroDrop-100 digital PCR system.

[0145] Example 2: Clinical sample test results of melanoma

[0146] 1. Sample collection and 5hmC-Seal sequencing:

[0147] Blood samples were collected from 49 melanoma patients, including 14 PD-L1 positive patients and 35 PD-L1 negative patients. Peripheral blood samples (8-10 mL) were collected from these 49 melanoma patients, and plasma (4-5 mL) was separated. cfDNA was extracted from the plasma and subjected to 5hmC-Seal high-throughput sequencing. The sequencing throughput of each sample was 1.5 Gb, and the sequencing band size was 75 bp.

[0148] 2. Screening for differentially expressed biomarkers of hydroxymethylation:

[0149] Based on the results of PD-L1 detection by clinical immunohistochemistry (IHC), clinical samples were divided into PD-L1 positive and negative groups. Through comparative analysis between the positive and negative groups, 5 hmC differential markers were screened according to the selection criteria of |log2FoldChange|>=0.5 and pvalue<0.01 to find the hydroxymethylation site (CD274) corresponding to the PD-L1 gene.

[0150] 3. Synthesize CD274 (PD-L1) hydroxymethylation site primers (Qingke Biotechnology Co., Ltd.). For example, the site corresponding to the following PD-L1 primers can be chr9:5449218-5450100.

[0151]

[0152] 4. Digital PCR single-gene detection based on CD274 hydroxymethylation site

[0153] For each melanoma patient, 10 ng of 5hmC library was loaded. Four experimental cohorts were designed: a blank control group, a negative control group, a PD-L1 positive group (PD-L1+), and a PD-L1 negative group (PD-L1-). The blank control group received RNase-free water at a loading volume of 9.2 μL. The negative control group received melanoma cfDNA samples (without 5hmC enrichment) at a loading volume of 10 ng.

[0154] 5. Result, Figure 1 The data shows the copy number (ng) of the PD-L1 hydroxymethylation site (CD274) in a 5hmC library of cell-free DNA from the plasma of 49 melanoma patients; among them, there was a significant difference between the PD-L1 positive group (PD-L1+) and the PD-L1 negative group (PD-L1-) (p<0.01).

[0155] Example 3: Clinical sample test results of esophageal squamous cell carcinoma

[0156] 1. Sample collection and 5hmC-Seal sequencing:

[0157] Blood samples were collected from 56 patients with esophageal squamous cell carcinoma, including 34 EGFR-positive patients and 22 EGFR-negative patients. Peripheral blood samples (8-10 mL) were collected from these 56 patients, and plasma (4-5 mL) was separated. cfDNA was extracted from the plasma and subjected to 5hmC-Seal high-throughput sequencing. The sequencing throughput of each sample was 1.5 Gb, and the sequencing band size was 75 bp.

[0158] 2. Screening for differentially expressed biomarkers of hydroxymethylation:

[0159] Based on the results of EGFR detection using clinical immunohistochemistry (IHC), clinical samples were divided into EGFR-positive and EGFR-negative groups. Through comparative analysis between the positive and negative groups, 5 hmC differential markers were screened according to the criteria of |log2FoldChange|>=0.5 and pvalue<0.01 to find the hydroxymethylation sites corresponding to the EGFR gene.

[0160] 3. Synthesize EGFR hydroxymethylation site primers (Qingke Biotechnology Co., Ltd.). For example, the site corresponding to the following EGFR primers can be chr7:55127173-55127790.

[0161]

[0162] 4. Digital PCR single-gene detection based on EGFR hydroxymethylation sites

[0163] For each esophageal squamous cell carcinoma patient, 10 ng of 5hmC library was loaded. Four experimental cohorts were designed: a blank control group, a negative control group, an EGFR-positive group (EGFR+), and an EGFR-negative group (EGFR-). The blank control group received RNase-free water at a loading volume of 9.2 μL. The negative control group received esophageal squamous cell carcinoma cfDNA samples (without 5hmC enrichment) at a loading volume of 10 ng.

[0164] 5. Result, Figure 2 The data shows the copy number (ng) of the EGFR hydroxymethylation site in a 5hmC library of cell-free DNA from the plasma of 56 patients with esophageal squamous cell carcinoma; among them, there was a significant difference between the EGFR-positive group (EGFR+) and the EGFR-negative group (EGFR-) (p<0.01).

[0165] Example 4: Clinical Sample Test Results for Breast Cancer

[0166] 1. Sample collection and 5hmC-Seal sequencing:

[0167] Blood samples were collected from 36 breast cancer patients, including 16 HER2 (ERBB2) positive patients and 20 HER2 (ERBB2) negative patients. Peripheral blood samples (8-10 mL) were collected from these 36 breast cancer patients, and plasma (4-5 mL) was separated. cfDNA was extracted from the plasma for 5hmC-Seal high-throughput sequencing. The sequencing throughput for each sample was 1.5 Gb, using a paired-end 75 bp sequencing strategy.

[0168] 2. Screening for differentially expressed biomarkers of hydroxymethylation:

[0169] Based on the results of HER2 detection by clinical immunohistochemistry (IHC), clinical samples were divided into HER2 positive and negative groups. Through comparative analysis between the positive and negative groups, 5 hmC differential markers were screened according to the screening criteria of |log2FoldChange|>=0.5 and pvalue<0.01 to find the hydroxymethylation site (ERBB2) corresponding to HER2.

[0170] 3. Synthesize ERBB2 hydroxymethylation site primers (Qingke Biotechnology Co., Ltd.). For example, the site corresponding to the following ERBB2 primers can be chr17:37852095-37852700.

[0171]

[0172] 4. Digital PCR single-gene detection based on ERBB2 hydroxymethylation sites

[0173] The 5hmC library loading for each breast cancer patient was 10 ng. Four experimental cohorts were designed: a blank control group, a negative control group, a HER2-positive group (HER2+), and a HER2-negative group (HER2-). The blank control group consisted of RNase-free water with a loading volume of 9.2 uL. The negative control group consisted of breast cancer cfDNA samples (without 5hmC enrichment) with a loading volume of 10 ng.

[0174] 5. Result, Figure 3 The data shows the copy number (ng) of the HER2 hydroxymethylation site (ERBB2) in a single gene detected in a 5hmC library of cell-free DNA from the plasma of 36 breast cancer patients; among them, there was a significant difference between the HER2-positive group (HER2+) and the HER2-negative group (HER2-) (p<0.01).

[0175] The foregoing detailed description is provided by way of explanation and example and is not intended to limit the scope of the appended claims. Various variations of the embodiments listed herein will be apparent to those skilled in the art and are reserved within the scope of the appended claims and their equivalents.

Claims

1. A storage medium having a procedure thereon for performing the following methods: a method for confirming the presence of a disease, assessing the formation or risk of disease, assessing disease progression and / or prognosis, and / or screening a population responsive to treatment, the method comprising: (S1) determining a test region based on the quantity and / or presence of hydroxymethylcytosine in clinically positive and negative samples of a single target gene, and (S2) detecting the quantity and / or presence of the hydroxymethylcytosine in the test region of the test sample by digital PCR, wherein, The disease is melanoma, the single gene is PD-L1, and the region to be tested for PD-L1 is chr9:5449218-5450100, or... The disease is esophageal squamous cell carcinoma, the single gene is EGFR, and the region to be tested for EGFR is chr7:55127173-55127790, or... The disease is breast cancer, the single gene is HER2, and the region to be tested for HER2 is chr17:37852095-37852700. The regions to be tested were located based on the human genome reference sequence hg19.

2. The storage medium of claim 1, wherein step (S1) of the method comprises step (S1-1): determining the clinically positive sample and the clinically negative sample of the target gene.

3. The storage medium as described in claim 1, wherein the clinically positive sample and the clinically negative sample are determined by immunohistochemistry and / or fluorescence in situ hybridization.

4. The storage medium as described in claim 3, wherein the immunohistochemical staining score is determined based on the standard of antibody staining signal.

5. The storage medium as described in claim 3, wherein the fluorescence in situ hybridization ratio is calculated based on the standard of the fluorescence probe signal.

6. The storage medium of claim 1, wherein step (S1) of the method comprises step (S1-2): determining the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive sample and the clinically negative sample by means of a hydroxymethylation sequencing method.

7. The storage medium of claim 6, wherein the hydroxymethylation sequencing method comprises the following steps: (S1-2a) extracting nucleic acid fragments from a sample, (S1-2b) labeling the nucleic acid fragments containing hydroxymethylcytosine, (S1-2c) enriching the nucleic acid fragments containing hydroxymethylcytosine, and (S1-2d) sequencing the enriched nucleic acid fragments containing hydroxymethylcytosine.

8. The storage medium of claim 7, wherein the label comprises contacting the nucleic acid fragment with DNA β-glucosyltransferase and UDP glucose modified with chemically selective groups.

9. The storage medium of claim 8, wherein the chemically selective group comprises an azide group.

10. The storage medium of claim 7, wherein the labeling further comprises contacting the nucleic acid fragment with a chemically selective group with biotin containing a substance capable of reacting with the chemically selective group.

11. The storage medium of claim 10, wherein the biotin capable of reacting with the chemically selective group comprises dibenzocyclooctyne-modified biotin.

12. The storage medium of claim 7, wherein the enrichment comprises contacting the biotin-containing nucleic acid fragment with magnetic beads containing streptavidin.

13. The storage medium of claim 7, wherein the enrichment comprises separating the nucleic acid fragments carrying the hydroxymethylcytosine by magnetic force.

14. The storage medium of claim 1, wherein step (S1) of the method comprises step (S1-3): determining regions in the clinically positive and clinically negative samples containing differentially expressed hydroxymethylcytosine as the regions to be tested.

15. The storage medium of claim 14, wherein the region of differentiated hydroxymethylcytosine comprises, in the clinically positive sample, a region in which the number of hydroxymethylcytosine nucleic acid fragments is significantly increased and / or significantly decreased compared to the clinically negative sample.

16. The storage medium of claim 14, wherein the region to be tested is determined by determining the fold difference in the number of nucleic acid fragments containing hydroxymethylcytosine in the same region between the clinically positive sample and the clinically negative sample.

17. The storage medium of claim 16, wherein the difference factor is related to the following statistical value: the difference in the number of nucleic acid fragments containing hydroxymethylcytosine in the same region between the clinically positive sample and the clinically negative sample.

18. The storage medium of claim 16, wherein the difference factor is related to the following statistical value: the log2 ratio of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region in the clinically positive sample compared to the number of nucleic acid fragments containing hydroxymethylcytosine in the clinically negative sample.

19. The storage medium of claim 16, wherein the difference factor is related to the following statistical value: the absolute value of log2 of the ratio of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive sample to that of the clinically negative sample.

20. The storage medium of claim 14, wherein the region is determined to be the region to be tested when the absolute value of the log2-processed ratio of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinically positive sample to that of the clinically negative sample is 0.5 or more.

21. The storage medium of claim 14, wherein when the difference between the clinically positive sample and the clinically negative sample in the same region is less than 0.05, the region is determined to be the region to be tested.

22. The storage medium of claim 21, wherein the significance of the difference is determined by a T-test.

23. An apparatus comprising the storage medium according to any one of claims 1-22.

24. The apparatus of claim 23, further comprising a processor coupled to the storage medium, the processor being configured to execute, based on a program stored in the storage medium, the method in the storage medium of any one of claims 1-22.

25. The application of nucleic acids capable of detecting the quantity and / or presence of hydroxymethylcytosine in the test region of a single target gene in a test sample in the preparation of a product, said product being used to confirm the presence of solid tumors, assess the formation or risk of solid tumor formation, assess the progression and / or prognosis of solid tumors, and / or screen for patients responding to treatment; wherein, The region to be tested is the region containing differentially expressed hydroxymethylcytosine in clinically positive and negative samples, and the quantity and / or presence of hydroxymethylcytosine is detected by digital PCR. The disease is melanoma, the single gene is PD-L1, and the region to be tested for PD-L1 is chr9:5449218-5450100, or... The disease is esophageal squamous cell carcinoma, the single gene is EGFR, and the region to be tested for EGFR is chr7:55127173-55127790, or... The disease is breast cancer, the single gene is HER2, and the region to be tested for HER2 is chr17:37852095-37852700. The aforementioned regions were located based on the human genome reference sequence hg19.

Citation Information

Patent Citations

  • Test kit for detecting content of 5-hydroxymethyl cytosine and application thereof

    CN111961729A

  • Methods and kits for detection of 5-hydroxymethylcytosine

    US20130323728A1