Breeding methods for superior populations of bream
By using specific PCR primers and cluster phylogenetic tree analysis to determine the kinship of bream, the most distantly related individuals were selected for pairing and breeding. Through multiple generations of selection, the problem of genetic diversity degradation in bream was solved, a stable and superior population was cultivated, and the growth rate and economic benefits of bream were improved.
Patent Information
- Application Number
- CN202211458063.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-16
- Publication Date
- 2026-04-03
- Estimated Expiration
- 2042-11-16
AI Technical Summary
The degradation of genetic diversity in bream has led to a decrease in desirable traits, slower growth, earlier sexual maturity, and smaller individual size, thus affecting farmers' income.
Specific PCR primers were used to identify bream, and kinship was determined by PCR amplification and cluster phylogenetic tree analysis. Individuals with the most distant kinship were selected for pairing and breeding to form a superior population. Multiple generations of selection were repeated to stabilize the superior traits.
This method has enabled bream offspring to possess stable and superior traits, increased farmers' income, and achieved rapid and stable breeding results for superior populations.
Smart Images

Figure CN115851981B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of animal molecular genetics and relates to a method for breeding fish populations, particularly a method for breeding superior populations of bream. Background Technology
[0002] Bream are herbivorous fish. Both juveniles and adults primarily feed on aquatic vascular plants such as *Vallisneria natans*, *Hydrilla verticillata*, and *Potamogeton crispus*. They also enjoy terrestrial grasses and leafy vegetables, and consume some lakebed plant debris and small amounts of zooplankton, thus exhibiting a wide range of diets. Feeding begins in April and continues until November, with peak consumption from June to October. Bream are medium-sized fish with relatively rapid growth, peaking at 1-2 years of age. Under conditions of abundant aquatic vegetation, young bream typically reach 100-200 grams in weight, while two-year-old bream can reach 300-500 grams. Growth gradually slows thereafter, with the largest individuals reaching 3-5 kilograms.
[0003] With the expansion of artificial breeding of bream, the genetic diversity of bream has deteriorated sharply. Inbreeding has become rampant, leading to a decline in desirable traits, slower growth, earlier sexual maturity, and smaller individual size. These factors restrict the income of farmers. Therefore, there is an urgent need for a method to improve the breeding of superior bream populations. Summary of the Invention
[0004] In order to solve the above-mentioned technical problems in the background art, the present invention provides a method for breeding superior populations of bream that can be quickly cultivated, have stable excellent traits, and have great promotional value.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] A PCR primer for identifying bream, characterized in that: the PCR primer for identifying bream comprises 5 sets, each set comprising two pairs of primer sequences;
[0007] Group A includes primer pair A1 and primer pair A2. For primer pair A1, the forward primer F is ATTGACTTGTTATCGTTTGT and the reverse primer R is GTTCCGACATGAGGCT. For primer pair A2, the forward primer F is TACTGATACATGCAGAA and the reverse primer R is GAAAGCAAATTTAGGAG.
[0008] Group B includes primer pair B1 and primer pair B2. For primer pair B1, the forward primer F is GTGCGACAAGGAGTCAA and the reverse primer R is CCTGCTGTCCGTGAGT. For primer pair B2, the forward primer F is AGAATAACTACTACCAAGT and the reverse primer R is GATTATCAGCCGAACAA.
[0009] Group C includes primer pairs C1 and C2. For primer pair C1, the forward primer F is GTTAGTTTCGTGCGCAT and the reverse primer R is CGTTCTCGCGTCCAT. For primer pair C2, the forward primer F is GTATCTGCACTTTCAAATAA and the reverse primer R is GTGAACTTCAGCCTGTG.
[0010] Group D includes primer pair D1 and primer pair D2. For primer pair D1, the forward primer F is TGTGCGCGAGTGAATG and the reverse primer R is TCCAGACGGAACAATCC. For primer pair D2, the forward primer F is ATTCATAAGGTACGTGA and the reverse primer R is ATTCATAGACCATCATCT.
[0011] Group E includes primer pair E1 and primer pair E2. For primer pair E1, the forward primer F is GTGGCTGTGACCATCTG and the reverse primer R is TACATTATGGCGTGCTG. For primer pair E2, the forward primer F is CTGAGCACTGATACTTC and the reverse primer R is AAAGTTCATTTCTGTTC.
[0012] The application of PCR primers for identifying bream, as described above, in the identification of bream.
[0013] The previously described PCR primers for identifying bream are used in identifying and distinguishing different bream families.
[0014] A method for selecting a superior population of bream based on the PCR primers for identifying bream as described above, characterized in that: the method for selecting a superior population of bream includes the following steps:
[0015] 1) Select several individual bream;
[0016] 2) Extract DNA from the bream individuals selected in step 1), use the DNA as a template and the PCR primers used for bream identification as primers for PCR amplification, and obtain the kinship of each bream individual in step 1) based on the amplification results.
[0017] 3) Select bream individuals with the most distant kinship for pairing and breeding, forming M families. Obtain first-generation bream from each family and raise each individual of the first-generation bream separately. When each individual of the first-generation bream reaches sexual maturity, measure the biological traits of each individual of the first-generation bream. Select the first-generation bream individual with the best biological traits from each of the M families as candidate parents.
[0018] 4) Extract DNA from the candidate parents respectively, and repeat step 2) using the DNA as a template to obtain the kinship of each first-generation bream individual in the candidate parents;
[0019] 5) Select the bream individuals with the most distant kinship for pairing and breeding, and continue to pair to form M families. Obtain second-generation bream from each family, and raise each individual of the second-generation bream separately. When each individual of the second-generation bream reaches sexual maturity, measure the biological traits of each individual of the second-generation bream. Select the second-generation bream individuals with the best biological traits from each of the M families as candidate parents.
[0020] 6) Repeat steps 4) to 5) until a superior population of bream is obtained.
[0021] Preferably, in step 2) of this invention, the method for obtaining kinship is as follows:
[0022] 2.1) Obtain fin samples from individual bream;
[0023] 2.2) Extract DNA from fin rays of individual bream;
[0024] 2.3) Using DNA as a template, PCR amplification was performed using PCR primers for identifying bream to obtain the PCR amplification product;
[0025] 2.4) Separate the PCR amplification products by electrophoresis on a 10% polyacrylamide gel, and count the genotypes of the PCR amplification products based on the separation results;
[0026] 2.5) Based on the genotype of the PCR products, use mega5.0 software and population software to construct a cluster development tree, and identify the kinship between individuals based on the cluster analysis diagram.
[0027] Preferably, in step 2.3) of the present invention, the PCR reaction system is 25ul: 3ul of 10×PCR Buffer, 2ul of 2.5mmol / L dNTP, 3ul of 2mmol / L MgCl2, 1ul each of PCR primers for identifying bream, 0.5ul of 5U / μL Taq enzyme, 2ul of DNA template, and 10.5ul of ultrapure water.
[0028] Preferably, in step 2.3) of the present invention, the PCR reaction program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃.
[0029] As a preferred embodiment, the specific implementation of step 1) of the present invention is as follows: collect bream in natural waters, measure the biological characteristics of the bream, and select the bream with the best biological traits as the bream individuals.
[0030] Preferably, the individual rearing method used in this invention involves hatching and raising seedlings under the same conditions, and feeding them with a uniform bream feed, which is given four times a day, with each feeding amount being 2% of the fish's body weight.
[0031] Compared with the prior art, the present invention has the following advantages:
[0032] This invention provides a method for selecting superior bream populations. This method can effectively cultivate stable bream populations with superior traits. Traditional methods for cultivating superior traits in fish simply involve pairing males and females with good morphology. This traditional pairing method ignores the role of heredity in reproduction, because many traits can become prominent due to environmental factors. However, the superior traits of a single individual cannot be passed on to the next generation, resulting in a significant waste of time and resources for fish farmers. This method combines heredity and superior traits, ensuring that the offspring of bream possess stable superior traits, thereby increasing the income of bream farmers. Compared with traditional methods for cultivating superior traits, this invention offers rapid and stable results and has significant potential for widespread application. Attached Figure Description
[0033] Figure 1 This is the result of the kinship of the 9 bream individuals in Example 3;
[0034] Figure 2 This is the result of the kinship of 30 bream individuals in Example 4. Detailed Implementation
[0035] Example 1: Extraction of bream DNA
[0036] Genomic DNA was extracted using the standard phenol / chloroform method. Approximately 50 mg of fin tissue was excised and placed in a 1.5 ml EP tube. Lysis buffer (50 mmol / L NaCl, 30 mmol / L Tris-HCl (pH 8.0), 200 mmol / L EDTA (ethylenediaminetetraacetic acid) (pH 8.0), 1% SDS (sodium dodecyl sulfate)) was added, followed by proteinase K. K)(200ug / mL), gently shake to mix, lyse in a 56℃ water bath until clear, then extract twice with an equal volume of saturated phenol:chloroform:isoamyl alcohol (25:24:1) (centrifuge, collect supernatant), then add 2 volumes of pre-cooled anhydrous ethanol to precipitate DNA (centrifuge, discard supernatant), invert the tube, dry the DNA at room temperature until clear, add 100uL of double-distilled water to dissolve the DNA, vortex twice, incubate overnight at 4℃, detect DNA concentration with UV spectrophotometer, detect DNA purity with agarose gel electrophoresis, dilute the DNA concentration to 50ng / uL with sterile double-distilled water, and store in a -20℃ refrigerator.
[0037] Example 2: PCR amplification of bream samples using microsatellite loci
[0038] All bream fin samples to be measured were collected, and DNA was extracted from the samples using a DNA extraction kit produced by Tiangen Biotech (Beijing) Co., Ltd. PCR amplification of the bream DNA was performed using microsatellite loci. The PCR amplification products were separated by electrophoresis on a 10% polyacrylamide gel. The genotypes of the PCR amplification products were determined based on the separation results. The PCR reaction system consisted of 25 μL: 3 μL 10×PCR Buffer, 2 μL 2.5 mmol / L dNTPs, 3 μL 2 mmol / L MgCl2, 1 μL each of the forward and reverse primers as described in Table 1, 0.5 μL 5 U / μL Taq enzyme, 2 μL DNA template, and 10.5 μL ultrapure water. The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min; and storage at 4℃.
[0039] Table 1
[0040]
[0041] Example 3
[0042] Nine sexually mature bream individuals were collected from the Pearl River area, and their kinship was measured.
[0043] Fin samples were taken from these nine bream individuals using the method disclosed in Example 1, and DNA was extracted. The DNA of these nine bream individuals was amplified using the PCR method provided in Example 2. Based on the amplification results, a clustering phylogenetic tree was constructed using Mega 5.0 and Population software. The phylogenetic relationships between the individuals were identified based on the cluster analysis diagram, and the degree of phylogenetic relationship among these nine bream individuals was measured. The phylogenetic relationship results of these nine bream individuals are as follows: Figure 1 As shown, individuals 7 and 4 are closely related, as are individuals 2 and 5. Furthermore, the branches formed by individuals 4 and 7 and those formed by individuals 2 and 5 are far apart, indicating a more distant kinship between the individuals in these two branches. Therefore, it is recommended that individuals 7 and 5, individuals 2 and 4, and individuals 1 and 6 be paired for breeding. This method will yield F1 generation bream with superior traits.
[0044] Example 4
[0045] Eleven sexually mature bream were collected from the Pearl River region (referred to as the Pearl River bream population), ten from the Yellow River region (referred to as the Yellow River bream population), and nine from the Yangtze River region (referred to as the Yangtze River bream population). The phylogenetic relationships of these 30 bream individuals were measured.
[0046] Fin samples were taken from 30 bream individuals using the method described in Example 1, and DNA was extracted. The DNA from these 30 bream individuals was amplified using the PCR method provided in Example 2. Based on the amplification results, a clustering phylogenetic tree was constructed using Mega 5.0 and Population software. The phylogenetic relationships between the individuals were identified based on the cluster analysis diagram, and the degree of phylogenetic relationship among these 30 bream individuals was measured. The phylogenetic relationship results of these 30 bream individuals are as follows: Figure 2 As shown, these three groups (Pearl River bream, Yellow River bream, and Yangtze River bream) can be distinguished based on the cluster analysis diagram. The Pearl River bream and Yangtze River bream groups are more closely related than the Yellow River bream group. Based on this cluster analysis diagram, it is recommended that individuals 2 and 15 be paired for breeding; individuals 8 and 16 be paired for breeding; individuals 13 and 5 be paired for breeding; individuals 14 and 6 be paired for breeding; individuals 7 and 12 be paired for breeding; individuals 10 and 21 be paired for breeding; individuals 20 and 29 be paired for breeding; individuals 22 and 17 be paired for breeding; and individuals 18 and 23 be paired for breeding. These nine pairs of male and female individuals form nine families. From the F1 generation of these nine families, ten individuals with superior traits are selected as replacement broodstock for breeding the F2 generation, using the pairing method described above. After 3-5 generations of selection, a bream population with stable inheritance of superior traits can be obtained.
Claims
1. A PCR primer for identifying bream, characterized in that: The PCR primers used to identify bream consist of 5 sets, each set containing two pairs of primer sequences; Group A includes primer pair A1 and primer pair A2. For primer pair A1, the forward primer F is ATTGACTTGTTATCGTTTGT and the reverse primer R is GTTCCGACATGAGGCT. For primer pair A2, the forward primer F is TACTGATACATGCAGAA and the reverse primer R is GAAAGCAAATTTAGGAG. Group B includes primer pair B1 and primer pair B2. For primer pair B1, the forward primer F is GTGCGACAAGGAGTCAA and the reverse primer R is CCTGCTGTCCGTGAGT. For primer pair B2, the forward primer F is AGAATAACTACTACCAAGT and the reverse primer R is GATTATCAGCCGAACAA. Group C includes primer pairs C1 and C2. For primer pair C1, the forward primer F is GTTAGTTTCGTGCGCAT and the reverse primer R is CGTTCTCGCGTCCAT. For primer pair C2, the forward primer F is GTATCTGCACTTTCAAATAA and the reverse primer R is GTGAACTTCAGCCTGTG. Group D includes primer pair D1 and primer pair D2. For primer pair D1, the forward primer F is TGTGCGCGAGTGAATG and the reverse primer R is TCCAGACGGAACAATCC. For primer pair D2, the forward primer F is ATTCATAAGGTACGTGA and the reverse primer R is ATTCATAGACCATCATCT. Group E includes primer pair E1 and primer pair E2. For primer pair E1, the forward primer F is GTGGCTGTGACCATCTG and the reverse primer R is TACATTATGGCGTGCTG. For primer pair E2, the forward primer F is CTGAGCACTGATACTTC and the reverse primer R is AAAGTTCATTTCTGTTC.
2. The application of the PCR primers for identifying bream as described in claim 1 in identifying and distinguishing different bream families.
3. A method for selecting superior populations of bream based on the PCR primers for identifying bream as described in claim 1, characterized in that: The method for selecting superior populations of bream includes the following steps: 1) Select several individual bream; 2) Extract DNA from the selected bream individuals in step 1), and perform PCR amplification using the DNA as a template and the PCR primers for bream identification as described in claim 1. Obtain the phylogenetic relationship of each bream individual in step 1) based on the amplification results; specifically: 2.1) Obtain fin samples from individual bream; 2.2) Extract DNA from fin rays of individual bream; 2.3) Using DNA as a template, PCR amplification is performed using the PCR primers for identifying bream as described in claim 1 to obtain PCR amplification products; 2.4) Separate the PCR amplification products by electrophoresis on a 10% polyacrylamide gel, and count the genotypes of the PCR amplification products based on the separation results; 2.5) Based on the genotypes of the PCR products, use mega5.0 software and population software to construct a clustering phylogenetic tree, and identify the kinship between individuals based on the clustering analysis diagram; 3) Select bream individuals with the most distant kinship for pairing and breeding, forming M families. Obtain first-generation bream from each family and raise each individual of the first-generation bream separately. When each individual of the first-generation bream reaches sexual maturity, measure the biological traits of each individual of the first-generation bream. Select the first-generation bream individual with the best biological traits from each of the M families as candidate parents. 4) Extract DNA from the candidate parents respectively, and repeat step 2) using the DNA as a template to obtain the kinship of each first-generation bream individual in the candidate parents; 5) Select the most distantly related first-generation bream individuals for pairing and breeding, and continue to pair them to form M families. Obtain second-generation bream from each family, and raise each second-generation bream individual separately. When each second-generation bream individual reaches sexual maturity, measure the biological traits of each second-generation bream individual. Select the second-generation bream individual with the best biological traits from each of the M families as candidate parents. 6) Repeat steps 4) to 5) until a superior population of bream is obtained.
4. The method for selecting superior populations of bream according to claim 3, characterized in that: In step 2.3), the PCR reaction system is 25 μL: 10×PCR Buffer 3 μL, 2.5 mmol / L dNTP 2 μL, 2 mmol / L MgCl2 3 μL, PCR primers for identifying bream as described in claim 1, PCR primers 1 μL each, 5 U / μL Taq enzyme 0.5 μL, DNA template 2 μL, and ultrapure water 10.5 μL.
5. The method for selecting superior populations of bream according to claim 4, characterized in that: In step 2.3), the PCR reaction program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃.
6. The method for selecting superior populations of bream according to any one of claims 3-5, characterized in that: The specific implementation method of step 1) is as follows: collect bream in natural waters, measure the biological characteristics of the bream, and select the bream with the best biological traits as the bream individuals.
7. The method for selecting superior populations of bream according to claim 6, characterized in that: The solitary rearing refers to hatching and raising seedlings under the same conditions, and feeding them with the same bream compound feed, four times a day, with each feeding amount being 2% of the fish's body weight.
Citation Information
Patent Citations
Breeding method for keeping excellent characters of Chinese sturgeons
CN108728551A