Pathogen-specific nucleic acid genes and detection methods for staphylococcus epidermidis

By using real-time quantitative PCR technology and designing primers and probes based on the species-specific nucleotide sequences of Staphylococcus epidermidis, the problems of long detection time and poor accuracy of Staphylococcus epidermidis have been solved, enabling rapid and accurate pathogen identification and supporting rapid clinical drug use.

CN115852004BActive Publication Date: 2025-12-12NANJING UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310075125.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-07
Publication Date
2025-12-12
Estimated Expiration
2043-02-07

AI Technical Summary

Technical Problem

Existing technologies for detecting Staphylococcus epidermidis are time-consuming and have poor accuracy, making it difficult to meet the clinical needs for rapid and accurate diagnosis and treatment.

Method used

Real-time quantitative PCR technology using specific nucleic acid genes was employed, and primers and TaqMan probes were designed based on the species-specific nucleotide sequences of Staphylococcus epidermidis to achieve rapid and specific detection.

Benefits of technology

It enables rapid and accurate detection of Staphylococcus epidermidis, shortens the detection time, improves the detection rate, and supports rapid and precise clinical medication.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115852004B_ABST
    Figure CN115852004B_ABST
Patent Text Reader

Abstract

The application discloses a pathogen-specific nucleic acid gene of Staphylococcus epidermidis and a detection method, and the nucleotide sequence is at least a part of any sequence in the sequence table Seq ID No:4-Seq ID No:10 or a complementary sequence thereof. Total DNA is extracted from a clinical sample, wherein the total DNA contains genomic DNA of Staphylococcus epidermidis; the extracted DNA is used as a template to combine with specific primers and specific probes to obtain a mixed solution, and the forward primer in the amplification primer is SEQ ID NO:1; the reverse primer used in the amplification primer is SEQ ID NO:2; the specific probe is SEQ ID NO:3; the mixed solution is subjected to a qPCR reaction, and the result is determined according to a Ct value. The application is used for rapidly identifying Staphylococcus epidermidis, has a high detection rate and short detection time.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a pathogen-specific nucleic acid gene of Staphylococcus epidermidis and a detection method, and belongs to the technical field of genetic engineering. BACKGROUND

[0002] For many years, pathogen infection has seriously harmed human health and has attracted extensive attention from scientists and clinical experts. So far, the use of antibiotics is still the most important treatment for pathogenic bacteria in the clinic. The identification of pathogenic bacteria is of great significance for the use of antibiotics. Early studies have shown that the use of appropriate antibiotics early can significantly reduce patient mortality. The most traditional detection method in the clinic is to culture the patient's sample and identify the bacterial species according to the culture results. However, in actual operation, the bacterial culture procedure is complicated and time-consuming, usually taking 2-5 days; the process requires a high environment to avoid sample contamination by other bacteria; at the same time, during the culture process, some bacteria may be inhibited due to improper culture, resulting in missed detection. Therefore, it is urgent to improve the detection speed and accuracy of pathogens.

[0003] Staphylococcus epidermidis is a gram-positive bacterium that grows on the surface of the body and is named because it appears in a grape cluster. It is a conditional pathogenic bacterium and usually occurs in hospital infections. In recent years, more and more studies have found that Staphylococcus epidermidis is often associated with the use of a large number of medical devices and is the main pathogenic bacterium causing implant-related infections such as catheters and artificial valves. Staphylococcus epidermidis infection is usually subacute or chronic and can cause folliculitis, furuncles, and other infections of the epidermal soft tissue; it can also cause otitis media, pneumonia, pericarditis, and other internal organ infections; and it can even cause pyogenic infection, eventually leading to sepsis and developing into a life-threatening condition. For clinicians, it is urgent to quickly and accurately obtain pathogenic information to develop timely and reasonable antibacterial therapy, especially for patients developing into severe cases. Targeted antibiotic therapy can effectively improve the clinical manifestations of patients and increase the cure rate. However, the current clinical traditional culture method still cannot meet the needs of clinical diagnosis and treatment. SUMMARY

[0004] The present application provides a pathogen-specific nucleic acid gene of Staphylococcus epidermidis and a detection method, which improves the accuracy of Staphylococcus epidermidis detection and greatly shortens the detection time of Staphylococcus epidermidis, providing technical support for rapid and accurate drug use in the clinic.

[0005] Technical scheme: In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is:

[0006] A pathogen-specific nucleic acid gene of Staphylococcus epidermidis, whose nucleotide sequence is at least part of any one of the sequences in the sequence listing Seq ID No: 4-Seq ID No: 10, or a complementary sequence thereof.

[0007] Preferably, the primers for amplification are located inside the specific nucleic acid fragment, including the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0008] Preferably, at least part of the sequence of the amplification product is used as a specific probe when performing qPCR amplification, which includes the sequence shown in SEQ ID NO: 3.

[0009] A method for detecting a pathogen-specific nucleic acid gene of Staphylococcus epidermidis, comprising the following steps:

[0010] Step 1, extracting total DNA from a clinical sample, wherein the genomic DNA of Staphylococcus epidermidis is contained;

[0011] Step 2, using the DNA obtained in step 1 as a template, combining with specific primers and specific probes to obtain a mixed solution, wherein the forward primer in the amplification primer is SEQ ID NO: 1; the reverse primer in the amplification primer used is SEQ ID NO: 2; and the specific probe is SEQ ID NO: 3;

[0012] Step 3, performing qPCR reaction on the mixed solution of step 2, and determining the result according to the Ct value.

[0013] A method for detecting a pathogen-specific nucleic acid fragment primer of Staphylococcus epidermidis, comprising the following steps:

[0014] 1) Specific detection of primers: using the primers to perform PCR amplification on the genomic DNA of Staphylococcus epidermidis and the DNA of closely related species. The forward primer in the amplification primer used is SEQ ID NO: 1; and the reverse primer in the amplification primer used is SEQ ID NO: 2.

[0015] 2) The PCR reaction product is subjected to agarose gel electrophoresis, and the effect of the primers is determined according to whether the target band and the non-specific band exist.

[0016] A kit for detecting a pathogen-specific nucleic acid gene of Staphylococcus epidermidis, comprising specific amplification primers, wherein the forward primer is SEQ ID NO: 1; the reverse primer is SEQ ID NO: 2; and the specific nucleic acid probe has a fluorescent group and a quencher group at the 5' and 3' ends, respectively, and is SEQ ID NO: 3.

[0017] Compared with the prior art, the present application has the following beneficial effects:

[0018] The pathogen-specific nucleic acid fragment provided by the application can be used for rapid identification of Staphylococcus epidermidis, has high detection rate and short detection time. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 A schematic diagram for determining the Staphylococcus epidermidis-specific nucleic acid fragment according to a probe method.

[0020] Figure 2 A test for determining the availability of the Staphylococcus epidermidis primer. After PCR amplification of the DNA templates of various pathogens commonly seen in clinic by using the Staphylococcus epidermidis primer on SEQ ID NO: 1 and SEQ ID NO: 2, the electrophoresis results of the products are shown in the figure, wherein 1 is Acinetobacter baumannii, 2 is Escherichia coli, 3 is Klebsiella pneumoniae, 4 is Staphylococcus aureus, 5 is Pseudomonas aeruginosa, 6 is Staphylococcus epidermidis, 7 is Stenotrophomonas maltophilia, and 8 is water. DETAILED DESCRIPTION

[0021] The application will be further illustrated below in combination with the drawings and specific examples. It should be understood that these examples are only used to illustrate the application and are not used to limit the scope of the application. After reading the application, those skilled in the art can make various equivalent modifications of the application, which all fall within the scope defined by the appended claims.

[0022] Staphylococcus epidermidis-specific nucleic acid fragment

[0023] Generally refers to the DNA or RNA sequence specific to Staphylococcus epidermidis, which can be accurately identified to the species. It has the following characteristics: it is a sequence that exists in all strains of Staphylococcus epidermidis in biological classification, but does not exist in the genomes of other species of pathogenic bacteria, i.e., an intraspecific common and interspecific specific DNA sequence.

[0024] A screening method for a Staphylococcus epidermidis pathogen-specific nucleic acid gene, comprising the following steps:

[0025] 1) Search public databases and download the whole genome data of hundreds of clinically common pathogenic microorganisms from websites such as NCBI to construct a local database;

[0026] 2) Perform alignment analysis on all strains of Staphylococcus epidermidis to obtain sequences that exist in all strains of the species, i.e., intraspecific common sequences.

[0027] 3) Align the intraspecific common sequences of Staphylococcus epidermidis with the reference genome sequences of other pathogen species and humans to obtain specific sequences, i.e., intraspecific common and interspecific specific sequences of Staphylococcus epidermidis. Remove the repeated parts.

[0028] According to the above process, we obtain the specific nucleotide sequence of Staphylococcus epidermidis, which is shown in SEQ ID NO: 4-10, respectively.

[0029] According to the above-mentioned Staphylococcus epidermidis-specific nucleotide sequence, it can be effectively applied to rapidly identify whether Staphylococcus epidermidis species exists in various clinical samples. For example, according to whether the Staphylococcus epidermidis-specific nucleic acid fragment exists in the detection result, it can be judged whether the patient is infected with Staphylococcus epidermidis. In the detection process, the full length or part of the specific nucleic acid fragment can be detected.

[0030] Real-time fluorescent quantitative PCR technology

[0031] The early culture method is the traditional method for identifying microbial pathogens, and is also the gold standard for identification. With the advent of nucleic acid amplification technology, the diagnosis of microbial pathogens has changed, entering the era of molecular diagnosis. In particular, the discovery and application of DNA polymerase with high temperature resistance make PCR technology one of the most commonly used methods for the diagnosis of microbial pathogens. It uses the target fragment as a template and specific primers for amplification, and obtains a large amount of target fragment for subsequent species identification through multiple cycles. This technology is simple to operate, highly sensitive, and can make up for the defects of easy missed detection and misdiagnosis in traditional culture method, which is crucial for detecting pathogenic microorganisms with long growth cycle, harsh culture conditions or atypical biochemical reaction characteristics.

[0032] Real-time fluorescent quantitative PCR technology (Quantitative Real-time PCR, qPCR) can quantitatively determine the DNA or RNA in the sample. In the amplification reaction, the fluorescence signal intensity of each cycle is measured, and the number of templates, i.e. the content of target DNA or RNA, is deduced according to the final product. The qPCR detection method includes SYBR Green method and TaqMan probe method. The principle of SYBR Green method is that SYBR Green is a fluorescent dye that can specifically insert into DNA double strands, so that the number of double strands and the fluorescence signal intensity are positively correlated during the PCR amplification process, thereby inferring the initial nucleic acid quantity. This method is simple to operate, but has lower specificity and is easily affected by primer dimers. The TaqMan probe method is to synthesize a short sequence that is specific to the reverse complement of the target sequence, with a fluorescent group and a quencher group at its 5' and 3' ends, respectively. The probe binds to the target sequence, and with the PCR amplification process, the exonuclease activity of DNA polymerase will cut the probe, and the free fluorescein will excite fluorescence in the system. At this time, the fluorescence intensity is positively correlated with the DNA quantity. The probe method has higher specificity than SYBR Green and is not affected by primer dimers. Therefore, the TaqMan probe method is used to detect the specific nucleic acid fragment of Staphylococcus epidermidis.

[0033] In the present application, we screened the intraspecific specific DNA sequences of Staphylococcus epidermidis by bioinformatics method. According to these sequences, we designed and synthesized primers and TaqMan probe for specific recognition of Staphylococcus epidermidis. Finally, based on the detection tool of specific primers and probes, rapid detection of Staphylococcus epidermidis can be realized without the cumbersome clinical culture process. The present application can solve the demand of rapid identification of pathogenic bacteria in clinic, and is expected to improve the level of diagnosis and treatment.

[0034] In some embodiments herein, TaqMan probe method is used to detect pathogen-specific nucleic acid fragments, which further increases the specificity of detection due to the need for primer and target DNA complementary pairing and probe and target DNA complementary pairing.

[0035] The nucleic acid sequences mentioned in the present application are as follows:

[0036] SEQ ID NO: 1 forward primer

[0037] TTCTTGTATCAATTCTTCTGGGCTT

[0038] SEQ ID NO: 2 reverse primer

[0039] TCCGTGTATTGGTAGCTTTCTTAAT

[0040] SEQ ID NO: 3 probe sequence

[0041] TCCGTCAGGTGGAGCTGTGAGAGGCAC

[0042] SEQ ID NO: 4 Staphylococcus epidermidis specific fragment

[0043] GTACTTTTGTCAATGACAATTAGTGTTTTTCCAACGATTTTTTGTAGTGTATTTTTATATCTTTCCCATATTCTTGTATCAATTCTTCTGGGCTTAAATAAATCTTTTCTAAATATAATCCGTCAGGTGGAGCTGTGAGAGGCACATTATTTCTATTTTTGTCCTCTAAGAGCTTAGGGACGTCATTAGGTTCACGCTTTCCTTTTCCTACTTCAATTAAGAAAGCTACCAATACACGGACCATATTATAAAGGAATCCAGAACCTGTTACGACATAATCAAACCCTTCTTTAGTAGCAACA

[0044] SEQ ID NO: 5 Staphylococcus epidermidis specific fragment

[0045] AATCAACATTCTCCTTTGCTATATAACGTTGGCTCTTTTAGTATAGCATGAAAATGAGAAGAATGAATAAGAACAAATGTTCTTATAAATATTGAAATAGAACACGTGTTCTTATATAATGTTTTTGTAAGGGAGGATCAGTTATGTATGATTACA

[0046] SEQ ID NO: 6 Staphylococcus epidermidis specific fragment

[0047] AGGATTGGACCCATTAACAACTAAACTAGCAGTTGTAGCAGATACGAAAAGGCAAGGTTCGGTCGTTCTAGCAGCAACTCCAAAGTTAAAAGAATTAGGTATTAAAACGGGATCAAGACTT

[0048] SEQ ID NO: 7 Staphylococcus epidermidis specific fragment

[0049] ATTCAAAGTCATTAATTATTTTGCAAATCGTCTGTGTGACAAAAAAGCATTGTATAGAACGTTAAGTGTATCGTTAACTCAGTTTATTAAAGAAAGCGATCGACAACTCAACTTATTCATTGATGAATATGAACGTAAGAAAGATGTAAAACTT

[0050] SEQ ID NO: 8 Staphylococcus epidermidis specific fragment

[0051] GATATACAAAGAGAGTCCCCCTCGTCGTGCAACATATAGAAGCGAAAAGATAACGACTTGAAGGGGATTTATTTAATAATAAGTATCAAAATTTGCGAGGGCTTTTATAGCATTCTCTCGATCTTCGGGAC

[0052] SEQ ID NO: 9 Staphylococcus epidermidis specific fragment

[0053] GATATTGCACCGTGTTGTTTAACAGGAAGTTGATCACGATAATCTTTAGCTTTAACGAAGAAATCGTAAATACTATTACTATTTTGTTCTCGTATCAAATTTTCAATACCAGTAATTTGTTCTTTAATCTCGTTAAGTAAAGATAAAATATGATTTTGATTATTTAAA

[0054] SEQ ID NO: 10 Staphylococcus epidermidis specific fragment

[0055] TAATTTTTCGATTAAAGAATGGTCTTTGACATGATTAGCACTTAGATGAACTAAAATTGAAGCGATGATATGTGGAACATGACTCACTATACCGGTTACGAAATCATGTTCATTTGCATGAGTAACGATAAATTTTGCTAACGTAGGTTTAAGTAATTTCTTTAAATATGTCGCGGCTTCATTATTTTCGATTTCATTAAATACAAGAATG

[0056] The present application is further illustrated by specific examples below.

[0057] Example 1 Specificity verification of Staphylococcus epidermidis detection method based on probe method

[0058] The pathogenic bacteria used for detection were all from Gulou Hospital, isolated and cultured from clinical samples.

[0059] 1. Primer specificity test

[0060] In order to prove the specificity and reliability of the pathogenic bacteria detection method based on probe method, we carried out cross detection experiment on the amplification primer.

[0061] 1.1 Primer specificity test

[0062] In order to clarify the specificity of the amplification primer, the amplification primer for Staphylococcus epidermidis was used as a template for the cross PCR reaction with the genomic DNA extracted from Staphylococcus epidermidis and other several pathogenic bacteria commonly seen in clinic.

[0063] The forward and reverse primers used in the amplification primer are as follows:

[0064] SEQ ID NO: 1 and 2, used for amplification of Staphylococcus epidermidis genomic DNA;

[0065] The Staphylococcus epidermidis pathogen-specific nucleic acid fragment, and the designed amplification primer, probe thereof are shown as follows. The sequences corresponding to the upstream primer and the downstream primer (SEQ ID NO: 1 and 2) are underlined, and the probe sequence (SEQ ID NO: 3) in Example 2 is marked with a gray background.

[0066]

[0067] According to I-5 TM PCR was performed according to the instructions of the Master Mix (TsingKe),

[0068] The reaction system was prepared as follows

[0069]

[0070] The amplification was performed according to the following procedure: 98°C for 2 min, (98°C for 10 s, 52°C for 10 s, 72°C for 15 s) for 30-35 cycles, and 72°C for 5 min. In order to rule out the problems in the PCR amplification process, the corresponding positive and negative controls were set, and the genomic DNA of Staphylococcus epidermidis and water were used as the amplification templates, respectively.

[0071] After the PCR reaction, an agarose gel was prepared. The PCR product was subjected to agarose gel electrophoresis, and according to the fact that the target band could be amplified in Staphylococcus epidermidis, the effectiveness of the primer was indicated; and according to the fact that the target band did not exist in other pathogenic species, the specificity of the primer was indicated.

[0072] 2. Experimental results

[0073] As shown in Figure 2 , when the genomic DNA of Staphylococcus epidermidis was used as the template for PCR amplification, there was a band with the length of the target product, indicating that the specific primer (SEQ ID NO: 1 and 2) could effectively amplify the Staphylococcus epidermidis-specific nucleic acid fragment (SEQ ID NO: 4). When other pathogen species were used as the template for PCR amplification, no product appeared, indicating that the specific primer (SEQ ID NO: 1 and 2) would not cause non-specific amplification and false positive results. At the same time, in the negative control with water as the template, no non-specific band appeared. Based on this, it can be known that the amplification primer (SEQ ID NO: 1 and 2) is effective and specific, which provides support for specifically amplifying the Staphylococcus epidermidis nucleic acid fragment from clinical samples.

[0074] Example 2: Detection of clinical samples by probe method

[0075] 1. Experimental operation

[0076] 2 clinical patients, 19 clinical samples were collected from Gulou Hospital at different time points, and compared with the pathogen types determined by traditional culture separation detection method of Microbiological Laboratory of Gulou Hospital.

[0077] 1.1 Extraction of DNA from clinical samples

[0078] Extraction of DNA from clinical samples was completely in accordance with the instructions of Quick-DNA / RNA TM Pathogen Miniprep Kit(ZYMORESEARCH) were completed, and the process was as follows:

[0079] a) 800 μl of DNA / RNA Shield reagent was added to 50-200 μl of sample. Shake for 1 min to mix, and centrifuge at 16,000 x g for 1 min, and take the supernatant.

[0080] b) 2 μl of Proteinase K was added to the product of a), and mixed.

[0081] c) 1 ml of Pathogen DNA / RNA buffer reagent was added to the product of b), and mixed. After standing at room temperature for 5 min, the product was transferred to a DNA binding column. If the volume exceeds the column volume, it can be transferred in multiple times.

[0082] d) 16,000 x g, 30 s, discard the filtrate.

[0083] e) 500 μl of Wash buffer was added, 16,000 x g, 30 s, the filtrate was discarded, and the process was repeated once.

[0084] f) 500 μl of ethanol (95-100%) was added, 16,000 x g, 1 min, and the DNA binding column was transferred to a new 1.5 ml centrifuge tube.

[0085] g) 50 μl of 65℃ DNase-free water was added to the middle of the centrifugal column, and stood at room temperature for 2-5 min, 16,000 x g, 1 min, and the eluate was collected.

[0086] 1.2 Detection of Staphylococcus epidermidis in clinical samples by probe method

[0087] The total DNA extracted from the clinical samples was used as a template, and 1 pair of primers (SEQ ID NO: 1 and 2) and a probe (SEQ ID NO: 3) described in Example 1 were used for probe qPCR amplification reaction. The detection system was as follows:

[0088]

[0089] qPCR reaction parameters are as follows

[0090]

[0091] Note: select the appropriate fluorescence signal according to the probe design when on the machine

[0092] 2. Experimental results

[0093] Using a pair of amplification primers (SEQ ID NO: 1 and 2), a probe (SEQ ID NO: 3) is used to amplify the total DNA of 19 clinical samples by probe qPCR. Based on the Ct value, the positive condition is determined, and the detection results are shown in Tables 1 and 2, and compared with the traditional culture method.

[0094] Table 1 Comparison of Staphylococcus epidermidis detection results in case 1 samples. (+) positive, (-) negative.

[0095]

[0096] From Table 1, by clinical culture method, Staphylococcus epidermidis was detected in the lead sample of case 1. According to the detection results by the probe method, except that the preoperative blood cells and intraoperative blood cells were negative, Staphylococcus epidermidis was detected in other samples.

[0097] Table 2 Comparison of Staphylococcus epidermidis detection results in case 2 samples. (+) positive, (-) negative.

[0098]

[0099]

[0100] From Table 2, it can be seen that Staphylococcus epidermidis exists in the lead and lead adhesion tissue samples of the patient measured by the probe method. The results are consistent with the culture results. Based on the results of 19 samples from 2 cases, it can be known that the probe method can effectively detect the presence of Staphylococcus epidermidis.

[0101] The detection process of the present application is to extract the genomic DNA of the clinical sample, use the primers corresponding to the specific nucleic acid fragments, and use the specific probes to perform real-time fluorescent quantitative PCR. The presence of Staphylococcus epidermidis in the clinical sample is identified by fluorescence signal and Ct value. The pathogen-specific detection method provided by the present application can be used for rapid and accurate identification of Staphylococcus epidermidis, thereby shortening the clinical diagnosis time, realizing accurate drug use for patients, and ensuring the safety of patients' lives.

[0102] In summary, compared with the traditional detection method relying on pathogenic bacteria isolation and culture, the method described in the application shows good detection effect, has the characteristics of high efficiency and rapidness, and can still be detected in the case of low bacterial load, which is expected to help clinicians achieve the goal of efficient pathogenic bacteria diagnosis.

[0103] The above only describes the preferred embodiments of the present application, and it should be pointed out that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A kit for detecting a pathogen-specific nucleic acid gene of Staphylococcus epidermidis, characterized by, The nucleotide sequence of the pathogen-specific nucleic acid gene of Staphylococcus epidermidis is shown in the sequence table Seq ID No: 5, comprising specific amplification primers, the forward primer is SEQ ID NO: 1; the reverse primer is SEQ ID NO: 2; the specific nucleic acid probe is provided with a fluorescent group and a quencher group at the 5' and 3' ends respectively, and the nucleotide sequence of the specific nucleic acid probe is shown in the sequence table SEQ ID NO: 3.

Citation Information

Patent Citations

  • Pathogen specific nucleic acid fragment and application thereof

    WO2022057854A1