Anti-GARP antibodies

Abstract

The present invention relates to anti-GARP antibodies. The present invention relates to antibodies that bind to GARP and can be used as therapeutic agents for tumors, and methods for treating tumors using the above antibodies. The purpose of the present invention is to provide antibodies that inhibit Treg function in tumors and are thus used as pharmaceutical products with therapeutic effects, methods for treating tumors using the above antibodies, and the like. Anti-GARP antibodies that bind to GARP and show inhibitory activity on Treg function and ADCC activity are obtained, and pharmaceutical compositions containing the above antibodies and the like for use in tumor treatment are obtained.

Description

[0001] This application is a divisional application of the invention patent application entitled “Anti-GARP Antibody” which entered China with international application number 201680056149.9 and international application date PCT / JP2016 / 078067 on September 23, 2016. Technical Field

[0002] The present invention relates to an antibody that binds to GARP and is useful as a therapeutic agent for tumors, and a method for treating tumors using the antibody. Background Art

[0003] Regulatory T cells (Tregs) are the main causative cells that induce immune tolerance, which is observed in tumor areas of cancer patients. That is, in cancer patients, the immune cell population that essentially acts to kill tumors is made immunosuppressive by activated Tregs in tumors, and this leads to malignant progression of tumors [Non-patent Document 1].

[0004] Glycoprotein-A Repetitions Predominant (GARP) is a protein with a single transmembrane structure [Non-Patent Document 2], and this protein is expressed on the cell surface of activated Tregs and forms a complex with latent TGF-β (a precursor of TGF-β, an important molecule for inducing immune tolerance) [Non-Patent Document 3].

[0005] Due to the intercellular interaction between Treg and the target cells to which Treg induces immunosuppression, TGF-β is matured from latent TGF-β through GARP on the cell surface of Treg and secreted from Treg, and the immunosuppressive signal of TGF-β is directly transmitted to the target cell [Non-patent Documents 4, 5]. It has been confirmed that membrane-bound GARP expressed on the cell surface is necessary for this maturation of TGF-β [Non-patent Document 5]. On the other hand, it has also been confirmed that when it is directly added to cell culture, soluble GARP lacking a transmembrane region suppresses the proliferation of CD4-positive T cells [Non-patent Document 6]. Therefore, the immunosuppressive mechanism of GARP that does not require TGF-β maturation on the cell membrane cannot be ruled out.

[0006] GARP is expressed not only by Tregs in peripheral blood when they become activated, but also by tumor-infiltrating T cells at tumor sites in cancer patients in clinical settings [Non-Patent Document 7], by Tregs present in ascites [Non-Patent Document 8], and by Tregs circulating in the peripheral blood of cancer patients [Non-Patent Document 9].

[0007] In a report investigating the effect of suppression of GARP expression on Treg function, siRNA targeting GARP suppressed the immunosuppressive function of Treg on the proliferative response of helper T cells, but such suppressive effect was partial [Non-Patent Document 10].

[0008] In another report, anti-GARP antibodies (MHG-8 and LHG-10) that have been obtained for their ability to inhibit TGF-β maturation inhibited the inhibitory function of A1 cells, which are Treg cell lines established from hemochromatosis patients [Non-patent Document 11], on the proliferative response of helper T cells [Patent Document 1 and Non-patent Document 12]. However, it is not known whether the above antibodies effectively show such an inhibitory effect on Treg in the tumor microenvironment, and to date, no anti-GARP antibodies having such an effect have been reported. Antibodies that recognize both GARP and TGF-β are also known [Patent Document 2].

[0009] It has been demonstrated that the excessive presence and activation of Tregs in patients with malaria and HIV infection show correlation with the disease state [Non-patent Documents 13 and 14], and that the removal of Tregs leads to the alleviation of the disease state in mouse models of the disease [Non-patent Documents 15 and 16].

[0010] Reference List

[0011] Patent Literature

[0012] Patent Document 1: WO2015 / 015003

[0013] Patent Document 2: WO2016 / 125017

[0014] Non-patent literature

[0015] Non-patent literature: 1: Int J Cancer. 2010 Aug 15; 127(4): 759-67.

[0016] Non-patent literature: 2: PLoS One. 2008; 3(7): e2705.

[0017] Non-patent literature: 3: Proc Natl Acad Sci USA. 2009; 106(32): 13445-50.

[0018] Non-patent literature: 4: Eur J Immunol. 2009; 39(12): 3315-22.

[0019] Non-patent literature: 5: Mol Biol Cell. 2012; 23 (6): 1129-39.

[0020] Non-patent literature: 6: Blood. 2013; 122(7): 1182-91.

[0021] Non-patent literature: 7: Eur J Immunol. 2012 Jul;42(7):1876-85.

[0022] Non-patent literature: 8: Clin Immunol. 2013 Oct;149(1):97-110.

[0023] Non-patent literature: 9: Cancer Res. 2013;73:2435.

[0024] Non-patent literature: 10: Proc Natl Acad Sci USA. 2009 Aug 11; 106(32): 13445-50.

[0025] Non-patent literature: 11: Eur J Immunol. 2009; 39(12): 869-82.

[0026] Non-patent literature: 12: Sci Transl Med. 2015 Apr 22; 7 (284)

[0027] Non-patent literature: 13: PLoS One. 2008 Apr 30;3(4):e2027.

[0028] Non-patent literature: 14: Clin Exp Immunol. 2014 Jun; 176 (3): 401-9.

[0029] Non-patent literature: 15: J Immunol. 2012 Jun 1; 188(11): 5467-77.

[0030] Non-patent literature: 16: PLoS Pathog. 2013;9(12):e1003798. Summary of the invention

[0031] Technical issues

[0032] An object of the present invention is to provide an antibody that inhibits Treg function in tumors and is thereby useful as a pharmaceutical product having a therapeutic effect, a method for treating tumors using the above antibody, and the like.

[0033] Solutions to the problem

[0034] The present inventors have conducted intensive research related to achieving the above-mentioned purpose. Therefore, the inventors have found antibodies that specifically bind to GARP and show activity of inhibiting Treg function via antibody-dependent cellular cytotoxicity, thereby completing the present invention. Specifically, the present invention includes the following inventive aspects.

[0035] (1) Antibodies having the following properties:

[0036] (a) Specific binding to glycoprotein A repeat dominant sequence (GARP);

[0037] (b) has inhibitory activity on the immunosuppressive function of regulatory T cells;

[0038] (c) having antibody-dependent cellular cytotoxicity (ADCC) activity; and

[0039] (d) Possess antitumor activity in vivo.

[0040] (2) The antibody according to (1) above, wherein GARP is a molecule consisting of the amino acid sequence shown in SEQ ID NO: 1.

[0041] (3) The antibody according to (1) or (2) above, which binds:

[0042] (a) the amino acid sequence portion at amino acid positions 366 to 377, 407 to 445 and 456 to 470 shown in SEQ ID NO: 1,

[0043] (b) the amino acid sequence portion at amino acid positions 54-112 and 366-392 shown in SEQ ID NO: 1,

[0044] (c) the amino acid sequence portion at amino acid positions 352 to 392 shown in SEQ ID NO: 1, or

[0045] (d) The amino acid sequence portion at amino acid positions 18 to 112 shown in SEQ ID NO:1.

[0046] (4) The antibody according to any one of (1) to (3) above, which has competitive inhibitory activity against the binding of an antibody having:

[0047] (a) a heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 2 and a light chain consisting of the amino acid sequence shown in SEQ ID NO: 3,

[0048] (b) a heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 4 and a light chain consisting of the amino acid sequence shown in SEQ ID NO: 5,

[0049] (c) a heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 25 and a light chain consisting of the amino acid sequence shown in SEQ ID NO: 27, or

[0050] (d) a heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 29 and a light chain consisting of the amino acid sequence shown in SEQ ID NO: 31.

[0051] (5) The antibody according to any one of (1) to (4) above, wherein the tumor is cancer.

[0052] (6) The antibody according to (5) above, wherein the cancer is lung cancer, kidney cancer, urothelial carcinoma, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, esophageal cancer or blood cancer.

[0053] (7) The antibody according to any one of (1) to (6) above, which has:

[0054] (a) CDRH1 consisting of the amino acid sequence at amino acid positions 26 to 35 as set forth in SEQ ID NO:2, CDRH2 consisting of the amino acid sequence at amino acid positions 50 to 66 as set forth in SEQ ID NO:2, and CDRH3 consisting of the amino acid sequence at amino acid positions 99 to 107 as set forth in SEQ ID NO:2, and CDRL1 consisting of the amino acid sequence at amino acid positions 23 to 36 as set forth in SEQ ID NO:3, CDRL2 consisting of the amino acid sequence at amino acid positions 52 to 58 as set forth in SEQ ID NO:3, and CDRL3 consisting of the amino acid sequence at amino acid positions 91 to 101 as set forth in SEQ ID NO:3,

[0055] (b) CDRH1 consisting of the amino acid sequence at amino acid positions 26 to 35 as set forth in SEQ ID NO:4, CDRH2 consisting of the amino acid sequence at amino acid positions 50 to 66 as set forth in SEQ ID NO:4, and CDRH3 consisting of the amino acid sequence at amino acid positions 99 to 112 as set forth in SEQ ID NO:4, and CDRL1 consisting of the amino acid sequence at amino acid positions 23 to 36 as set forth in SEQ ID NO:5, CDRL2 consisting of the amino acid sequence at amino acid positions 52 to 58 as set forth in SEQ ID NO:5, and CDRL3 consisting of the amino acid sequence at amino acid positions 91 to 100 as set forth in SEQ ID NO:5,

[0056] (c) CDRH1 consisting of the amino acid sequence at amino acid positions 45 to 54 as set forth in SEQ ID NO:25, CDRH2 consisting of the amino acid sequence at amino acid positions 69 to 78 as set forth in SEQ ID NO:25, and CDRH3 consisting of the amino acid sequence at amino acid positions 118 to 125 as set forth in SEQ ID NO:25, and CDRL1 consisting of the amino acid sequence at amino acid positions 44 to 54 as set forth in SEQ ID NO:27, CDRL2 consisting of the amino acid sequence at amino acid positions 70 to 76 as set forth in SEQ ID NO:27, and CDRL3 consisting of the amino acid sequence at amino acid positions 109 to 117 as set forth in SEQ ID NO:27, or

[0057] (d) CDRH1 consisting of the amino acid sequence at amino acid positions 45 to 54 as shown in SEQ ID NO:29, CDRH2 consisting of the amino acid sequence at amino acid positions 69 to 77 as shown in SEQ ID NO:29, and CDRH3 consisting of the amino acid sequence at amino acid positions 117 to 128 as shown in SEQ ID NO:29, and CDRL1 consisting of the amino acid sequence at amino acid positions 44 to 54 as shown in SEQ ID NO:31, CDRL2 consisting of the amino acid sequence at amino acid positions 70 to 76 as shown in SEQ ID NO:31, and CDRL3 consisting of the amino acid sequence at amino acid positions 109 to 117 as shown in SEQ ID NO:31.

[0058] (8) The antibody according to any one of (1) to (7) above, which has:

[0059] (a) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 1 to 118 set forth in SEQ ID NO:2, and a light chain variable region consisting of the amino acid sequence at amino acid positions 1 to 112 set forth in SEQ ID NO:3,

[0060] (b) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 1 to 123 as shown in SEQ ID NO:4, and a light chain variable region consisting of the amino acid sequence at amino acid positions 1 to 111 as shown in SEQ ID NO:5,

[0061] (c) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 136 as shown in SEQ ID NO:25, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 as shown in SEQ ID NO:27, or

[0062] (d) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 139 shown in SEQ ID NO:29, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 shown in SEQ ID NO:31.

[0063] (9) The antibody according to any one of (1) to (8) above, wherein the constant region is a human-derived constant region.

[0064] (10) The antibody according to any one of (1) to (9) above, which has:

[0065] (a) a heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 2 and a light chain consisting of the amino acid sequence shown in SEQ ID NO: 3,

[0066] (b) a heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 4 and a light chain consisting of the amino acid sequence shown in SEQ ID NO: 5,

[0067] (c) a heavy chain consisting of the amino acid sequence at amino acid positions 20 to 466 as shown in SEQ ID NO:25, and a light chain consisting of the amino acid sequence at amino acid positions 21 to 234 as shown in SEQ ID NO:27, or

[0068] (d) a heavy chain consisting of the amino acid sequence at amino acid positions 20 to 469 shown in SEQ ID NO:29, and a light chain consisting of the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO:31.

[0069] (11) The antibody according to any one of (1) to (10) above, which is humanized.

[0070] (12) The antibody according to (11) above, which has:

[0071] A heavy chain variable region consisting of an amino acid sequence selected from the group consisting of:

[0072] (a) the amino acid sequence at amino acid positions 20 to 136 shown in SEQ ID NO: 33,

[0073] (b) the amino acid sequence at amino acid positions 20 to 136 shown in SEQ ID NO: 35,

[0074] (c) the amino acid sequence at amino acid positions 20 to 139 shown in SEQ ID NO: 41,

[0075] (d) an amino acid sequence having at least 95% or more homology with the framework region sequence excluding each CDR sequence in the sequences of (a) to (c), and

[0076] (e) an amino acid sequence comprising one or more amino acids deleted, substituted or added in the framework region sequence other than each CDR sequence in the sequences of (a) to (c), and

[0077] A light chain variable region consisting of an amino acid sequence selected from the group consisting of:

[0078] (f) the amino acid sequence at amino acid positions 21 to 129 shown in SEQ ID NO: 37,

[0079] (g) the amino acid sequence at amino acid positions 21 to 129 shown in SEQ ID NO: 39,

[0080] (h) the amino acid sequence at amino acid positions 21 to 129 shown in SEQ ID NO: 43,

[0081] (i) an amino acid sequence having at least 95% or more homology with the framework region sequence excluding each CDR sequence in the sequences of (f) to (h), and

[0082] (j) an amino acid sequence comprising one or more amino acids deleted, substituted or added in the framework region sequence excluding each CDR sequence in the sequences of (f) to (h).

[0083] (13) The antibody according to (11) or (12) above, which has:

[0084] (a) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 136 as set forth in SEQ ID NO:33, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 as set forth in SEQ ID NO:37,

[0085] (b) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 136 as shown in SEQ ID NO:35, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 as shown in SEQ ID NO:39, or

[0086] (c) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 139 shown in SEQ ID NO:41, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 shown in SEQ ID NO:43.

[0087] (14) The antibody according to any one of (11) to (13) above, which has:

[0088] (a) a heavy chain selected from the group consisting of a heavy chain having the amino acid sequence at amino acid positions 20 to 466 shown in SEQ ID NO:33, a heavy chain having the amino acid sequence at amino acid positions 20 to 466 shown in SEQ ID NO:35, and a heavy chain having the amino acid sequence at amino acid positions 20 to 469 shown in SEQ ID NO:41, and

[0089] (b) a light chain selected from the group consisting of a light chain having the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO:37, a light chain having the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO:39, and a light chain having the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO:43.

[0090] (15) The antibody according to any one of (11) to (14) above, which has:

[0091] (a) a heavy chain having the amino acid sequence at amino acid positions 20 to 466 shown in SEQ ID NO:33, and a light chain having the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO:37,

[0092] (b) a heavy chain having the amino acid sequence at amino acid positions 20 to 466 shown in SEQ ID NO:35, and a light chain having the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO:39, or

[0093] (c) a heavy chain having the amino acid sequence at amino acid positions 20 to 469 shown in SEQ ID NO:41, and a light chain having the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO:43.

[0094] (16) A polynucleotide encoding the antibody according to any one of (1) to (15) above.

[0095] (17) The polynucleotide according to (16) above, which has:

[0096] (a) a polynucleotide of CDRH1 consisting of the nucleotide sequence at nucleotide positions 76 to 105 as shown in SEQ ID NO:6, a polynucleotide of CDRH2 consisting of the nucleotide sequence at nucleotide positions 148 to 198 as shown in SEQ ID NO:6, and a polynucleotide of CDRH3 consisting of the nucleotide sequence at nucleotide positions 295 to 321 as shown in SEQ ID NO:6, and a polynucleotide of CDRL1 consisting of the nucleotide sequence at nucleotide positions 67 to 108 as shown in SEQ ID NO:7, a polynucleotide of CDRL2 consisting of the nucleotide sequence at nucleotide positions 154 to 174 as shown in SEQ ID NO:7, and a polynucleotide of CDRL3 consisting of the nucleotide sequence at nucleotide positions 271 to 303 as shown in SEQ ID NO:7,

[0097] (b) a polynucleotide encoding a CDRH1 consisting of the nucleotide sequence at nucleotide positions 76 to 105 as shown in SEQ ID NO:8, a polynucleotide encoding a CDRH2 consisting of the nucleotide sequence at nucleotide positions 148 to 198 as shown in SEQ ID NO:8, and a polynucleotide encoding a CDRH3 consisting of the nucleotide sequence at nucleotide positions 295 to 336 as shown in SEQ ID NO:8, and a polynucleotide encoding a CDRL1 consisting of the nucleotide sequence at nucleotide positions 67 to 108 as shown in SEQ ID NO:9, a polynucleotide encoding a CDRL2 consisting of the nucleotide sequence at nucleotide positions 154 to 174 as shown in SEQ ID NO:9, and a polynucleotide encoding a CDRL3 consisting of the nucleotide sequence at nucleotide positions 271 to 300 as shown in SEQ ID NO:9,

[0098] (c) a polynucleotide of CDRH1 consisting of the nucleotide sequence at nucleotide positions 133 to 162 as shown in SEQ ID NO:24, a polynucleotide of CDRH2 consisting of the nucleotide sequence at nucleotide positions 205 to 234 as shown in SEQ ID NO:24, and a polynucleotide of CDRH3 consisting of the nucleotide sequence at nucleotide positions 352 to 375 as shown in SEQ ID NO:24, and a polynucleotide of CDRL1 consisting of the nucleotide sequence at nucleotide positions 130 to 162 as shown in SEQ ID NO:26, a polynucleotide of CDRL2 consisting of the nucleotide sequence at nucleotide positions 208 to 228 as shown in SEQ ID NO:26, and a polynucleotide of CDRL3 consisting of the nucleotide sequence at nucleotide positions 325 to 351 as shown in SEQ ID NO:26, or

[0099] (d) a polynucleotide of CDRH1 consisting of the nucleotide sequence at nucleotide positions 133 to 162 as shown in SEQ ID NO:28, a polynucleotide of CDRH2 consisting of the nucleotide sequence at nucleotide positions 205 to 231 as shown in SEQ ID NO:28, and a polynucleotide of CDRH3 consisting of the nucleotide sequence at nucleotide positions 349 to 384 as shown in SEQ ID NO:28, and a polynucleotide of CDRL1 consisting of the nucleotide sequence at nucleotide positions 130 to 162 as shown in SEQ ID NO:30, a polynucleotide of CDRL2 consisting of the nucleotide sequence at nucleotide positions 208 to 228 as shown in SEQ ID NO:30, and a polynucleotide of CDRL3 consisting of the nucleotide sequence at nucleotide positions 325 to 351 as shown in SEQ ID NO:30.

[0100] (18) The polynucleotide according to (16) or (17) above, which has:

[0101] (a) a polynucleotide of a heavy chain variable region consisting of the nucleotide sequence at nucleotide positions 1 to 354 shown in SEQ ID NO: 6, and a polynucleotide of a light chain variable region consisting of the nucleotide sequence at nucleotide positions 1 to 336 shown in SEQ ID NO: 7,

[0102] (b) a polynucleotide of a heavy chain variable region consisting of the nucleotide sequence at nucleotide positions 1 to 369 shown in SEQ ID NO: 8, and a polynucleotide of a light chain variable region consisting of the nucleotide sequence at nucleotide positions 1 to 333 shown in SEQ ID NO: 9,

[0103] (c) a polynucleotide of a heavy chain variable region consisting of the nucleotide sequence at nucleotide positions 58 to 408 shown in SEQ ID NO: 24, and a polynucleotide of a light chain variable region consisting of the nucleotide sequence at nucleotide positions 61 to 387 shown in SEQ ID NO: 26, or

[0104] (d) a polynucleotide of a heavy chain variable region consisting of the nucleotide sequence at nucleotide positions 58 to 417 shown in SEQ ID NO: 28, and a polynucleotide of a light chain variable region consisting of the nucleotide sequence at nucleotide positions 61 to 387 shown in SEQ ID NO: 30.

[0105] (19) The polynucleotide according to any one of (16) to (18) above, which has:

[0106] (a) a heavy chain polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 6, and a light chain polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 7,

[0107] (b) a heavy chain polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 8, and a light chain polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 9,

[0108] (c) a polynucleotide of a heavy chain consisting of the nucleotide sequence at nucleotide positions 58 to 1398 shown in SEQ ID NO: 24, and a polynucleotide of a light chain consisting of the nucleotide sequence at nucleotide positions 61 to 702 shown in SEQ ID NO: 26, or

[0109] (d) a polynucleotide of the heavy chain consisting of the nucleotide sequence at nucleotide positions 58 to 1407 shown in SEQ ID NO: 28, and a polynucleotide of the light chain consisting of the nucleotide sequence at nucleotide positions 61 to 702 shown in SEQ ID NO: 30.

[0110] (20) The polynucleotide according to (16) or (17) above, which has:

[0111] (a) a heavy chain variable region polynucleotide selected from the group consisting of a heavy chain variable region polynucleotide consisting of the nucleotide sequence at nucleotide positions 58 to 408 shown in SEQ ID NO:32, a heavy chain variable region polynucleotide consisting of the nucleotide sequence at nucleotide positions 58 to 408 shown in SEQ ID NO:34, and a heavy chain variable region polynucleotide consisting of the nucleotide sequence at nucleotide positions 58 to 417 shown in SEQ ID NO:40, and

[0112] (b) a light chain variable region polynucleotide selected from the group consisting of a light chain variable region polynucleotide consisting of the nucleotide sequence at nucleotide positions 61 to 387 shown in SEQ ID NO:36, a light chain variable region polynucleotide consisting of the nucleotide sequence at nucleotide positions 61 to 387 shown in SEQ ID NO:38, and a light chain variable region polynucleotide consisting of the nucleotide sequence at nucleotide positions 61 to 387 shown in SEQ ID NO:42.

[0113] (21) The polynucleotide according to (16), (17) or (20) above, which has:

[0114] (a) a polynucleotide of a heavy chain variable region consisting of the nucleotide sequence at nucleotide positions 58 to 408 shown in SEQ ID NO: 32, and a polynucleotide of a light chain variable region consisting of the nucleotide sequence at nucleotide positions 61 to 387 shown in SEQ ID NO: 36,

[0115] (b) a polynucleotide of a heavy chain variable region consisting of the nucleotide sequence at nucleotide positions 58 to 408 shown in SEQ ID NO: 34, and a polynucleotide of a light chain variable region consisting of the nucleotide sequence at nucleotide positions 61 to 387 shown in SEQ ID NO: 38, or

[0116] (c) a polynucleotide of a heavy chain variable region consisting of the nucleotide sequence at nucleotide positions 58 to 417 shown in SEQ ID NO:40, and a polynucleotide of a light chain variable region consisting of the nucleotide sequence at nucleotide positions 61 to 387 shown in SEQ ID NO:42.

[0117] (22) The polynucleotide according to (16), (17), (20) or (21) above, which has:

[0118] (a) a heavy chain polynucleotide selected from the group consisting of a heavy chain polynucleotide consisting of the nucleotide sequence at nucleotide positions 58 to 1398 shown in SEQ ID NO:32, a heavy chain polynucleotide consisting of the nucleotide sequence at nucleotide positions 58 to 1398 shown in SEQ ID NO:34, and a heavy chain polynucleotide consisting of the nucleotide sequence at nucleotide positions 58 to 1407 shown in SEQ ID NO:40, and

[0119] (b) a light chain polynucleotide selected from the group consisting of a light chain polynucleotide consisting of the nucleotide sequence at nucleotide positions 61 to 702 shown in SEQ ID NO:36, a light chain polynucleotide consisting of the nucleotide sequence at nucleotide positions 61 to 702 shown in SEQ ID NO:38, and a light chain polynucleotide consisting of the nucleotide sequence at nucleotide positions 61 to 702 shown in SEQ ID NO:42.

[0120] (23) The polynucleotide according to any one of (16), (17) and (20) to (22) above, which has:

[0121] (a) a polynucleotide of a heavy chain consisting of the nucleotide sequence at nucleotide positions 58 to 1398 shown in SEQ ID NO: 32, and a polynucleotide of a light chain consisting of the nucleotide sequence at nucleotide positions 61 to 702 shown in SEQ ID NO: 36,

[0122] (b) a polynucleotide of a heavy chain consisting of the nucleotide sequence at nucleotide positions 58 to 1398 shown in SEQ ID NO: 34, and a polynucleotide of a light chain consisting of the nucleotide sequence at nucleotide positions 61 to 702 shown in SEQ ID NO: 38, or

[0123] (c) a polynucleotide of the heavy chain consisting of the nucleotide sequence at nucleotide positions 58 to 1407 shown in SEQ ID NO:40, and a polynucleotide of the light chain consisting of the nucleotide sequence at nucleotide positions 61 to 702 shown in SEQ ID NO:42.

[0124] (24) An expression vector comprising the polynucleotide according to any one of (16) to (23) above.

[0125] (25) A host cell transformed with the expression vector according to (24) above.

[0126] (26) A method for producing an antibody of interest or a fragment thereof, comprising the step of culturing the host cell according to (25) above, and the step of collecting the antibody of interest from the culture obtained by the aforementioned step.

[0127] (27) An antibody obtained by the production method according to (26) above.

[0128] (28) An antibody according to any one of (1) to (15) and (27) above, comprising two or more modifications selected from the group consisting of N-linked glycosylation, O-linked glycosylation, N-terminal processing, C-terminal processing, deamidation, isomerization of aspartic acid, oxidation of methionine, addition of methionine residues to the N-terminus, amidation of proline residues, and a heavy chain comprising a deletion of one or two amino acids at the carboxyl terminus.

[0129] (29) The antibody according to (28) above, wherein one or two amino acids are deleted at the carboxyl terminus of its heavy chain.

[0130] (30) The antibody according to (29) above, wherein one amino acid is deleted at each carboxyl terminus of its two heavy chains.

[0131] (31) The antibody according to any one of (28) to (30) above, wherein the proline residue at the carboxyl terminus of the heavy chain thereof is further amidated.

[0132] (32) The antibody according to any one of (1) to (15) and (27) to (31) above, wherein sugar chain modification is regulated so as to enhance antibody-dependent cellular cytotoxicity.

[0133] (33) A pharmaceutical composition comprising at least one of the antibodies according to (1) to (15) and (27) to (32) above.

[0134] (34) The pharmaceutical composition according to (33) above, which is used for tumor treatment.

[0135] (35) The pharmaceutical composition according to (34) above, wherein the tumor is cancer.

[0136] (36) The pharmaceutical composition according to (35) above, wherein the cancer is lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, esophageal cancer or blood cancer.

[0137] (37) A method for treating a tumor, comprising administering at least one of the antibodies according to (1) to (15) and (27) to (32) above to an individual.

[0138] (38) The method according to (37) above, wherein the tumor is cancer.

[0139] (39) The method according to (38) above, wherein the cancer is lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, esophageal cancer or blood cancer.

[0140] Advantageous Effects of the Invention

[0141] According to the present invention, a therapeutic agent for cancer comprising an antibody can be obtained, the antibody being bound to GARP and having anti-tumor activity caused by Treg inhibition mediated by ADCC. In addition, the excessive presence and activation of Treg in patients with malaria and HIV infection show correlation with the disease state, and the removal of Treg induces the alleviation of the disease state in a mouse model of the disease. Accordingly, it can be expected that effective inhibition of Treg function will also have a therapeutic effect on refractory infectious diseases such as those caused by malaria and HIV. BRIEF DESCRIPTION OF THE DRAWINGS

[0142] [ Figure 1 ] shows the amino acid sequence of GARP (SEQ ID NO: 1).

[0143] [ Figure 2 ] Figure 2 The amino acid sequence of the 105F antibody heavy chain is shown (SEQ ID NO: 2).

[0144] [ Figure 3 ] Figure 3The amino acid sequence of the 105F antibody light chain is shown (SEQ ID NO: 3).

[0145] [ Figure 4 ] Figure 4 The amino acid sequence of the 110F antibody heavy chain is shown (SEQ ID NO: 4).

[0146] [ Figure 5 ] Figure 5 The amino acid sequence of the 110F antibody light chain is shown (SEQ ID NO: 5).

[0147] [ Figure 6 ] Figure 6 The nucleotide sequence of the 105F antibody heavy chain is shown (SEQ ID NO: 6).

[0148] [ Figure 7 ] Figure 7 The nucleotide sequence of the 105F antibody light chain is shown (SEQ ID NO: 7).

[0149] [ Figure 8 ] Figure 8 The nucleotide sequence of the 110F antibody heavy chain is shown (SEQ ID NO: 8).

[0150] [ Fig. 9 ] Fig. 9 The nucleotide sequence of the 110F antibody light chain is shown (SEQ ID NO: 9).

[0151] [ Fig.10 ] Fig.10 The antibodies showed binding to GARP. According to the ELISA method, the 105F antibody and the 110F antibody showed binding to GARP.

[0152] [ Fig.11 ] Fig.11 The antibody specifically binds to GARP. The 105F antibody did not bind to HEK293T cells into which an empty vector was introduced, and was shown to bind to HEK293T cells in which GARP had been transiently expressed.

[0153] [ Fig.12 ] Fig.12 The antibody specifically binds to GARP. The 105F antibody exhibits binding activity to L428 cells that endogenously express GARP.

[0154] [ Fig.13 ] Fig.13 The antibody showed specific binding to GARP. The 105F antibody showed binding activity to activated Treg.

[0155] [ Fig.14 ] Fig.14 The ADCC activity of the antibodies is shown. When targeting L428 cells that endogenously express GARP, an increase in ADCC activity was found in a 105F antibody concentration-dependent manner.

[0156] [ Fig.15 ] Fig.15 The inhibitory activity of the antibody on Treg function was shown. 105F antibody (50 μg / mL) inhibited the proliferation inhibitory function of Treg against helper T cells.

[0157] [ Fig.16 ] Fig.16 The antibodies showed their inhibitory activity on Treg function. 105F antibody (10 μg / mL) inhibited the proliferation inhibitory function of Treg against helper T cells. On the other hand, MHG-8 and LHG-10 antibodies did not show any effect on the proliferation inhibitory function of Treg against helper T cells.

[0158] [ Fig.17 ] Fig.17 The amino acid sequence of the heavy chain of the c151D antibody is shown (SEQ ID NO: 25).

[0159] [ Fig.18 ] Fig.18 The amino acid sequence of the c151D antibody light chain is shown (SEQ ID NO: 27).

[0160] [ Fig.19 ] Fig.19 The amino acid sequence of the heavy chain of the c198D antibody is shown (SEQ ID NO: 29).

[0161] [ Fig. 20 ] Fig. 20 The amino acid sequence of the c198D antibody light chain is shown (SEQ ID NO: 31).

[0162] [ Fig.21 ] Fig.21 The amino acid sequence of the h151D-H1 heavy chain is shown (SEQ ID NO: 33).

[0163] [ Fig. 22 ] Fig. 22 The amino acid sequence of the h151D-L1 light chain is shown (SEQ ID NO: 37).

[0164] [ Fig.23 ] Fig.23 The amino acid sequence of the h151D-H4 heavy chain is shown (SEQ ID NO: 35).

[0165] [ Fig.24 ] Fig.24 The amino acid sequence of the h151D-L4 light chain is shown (SEQ ID NO: 39).

[0166] [ Fig.25 ] Fig.25 The amino acid sequence of the h198D-H3 heavy chain is shown (SEQ ID NO: 41).

[0167] [ Fig.26 ] Fig.26 The amino acid sequence of the h198D-L4 light chain is shown (SEQ ID NO: 43).

[0168] [ Fig. 27 ] Fig. 27 The nucleotide sequence of the heavy chain of the c151D antibody is shown (SEQ ID NO: 24).

[0169] [ Fig.28 ] Fig.28 The nucleotide sequence of the c151D antibody light chain is shown (SEQ ID NO: 26).

[0170] [ Fig.29 ] Fig.29 The nucleotide sequence of the c198D antibody heavy chain is shown (SEQ ID NO: 28).

[0171] [ Fig.30 ] Fig.30 The nucleotide sequence of the c198D antibody light chain is shown (SEQ ID NO: 30).

[0172] [ Fig.31 ] Fig.31 The nucleotide sequence of the h151D-H1 antibody heavy chain is shown (SEQ ID NO: 32).

[0173] [ Fig.32 ] Fig.32 The nucleotide sequence of the h151D-L1 antibody heavy chain is shown (SEQ ID NO: 36).

[0174] [ Fig.33 ] Fig.33 The nucleotide sequence of the h151D-H4 heavy chain is shown (SEQ ID NO: 34).

[0175] [ Fig.34 ] Fig.34 The nucleotide sequence of the h151D-L4 light chain is shown (SEQ ID NO: 38).

[0176] [ Fig.35 ] Fig.35The nucleotide sequence of the h198D-H3 heavy chain is shown (SEQ ID NO: 40).

[0177] [ Fig.36 ] Fig.36 The nucleotide sequence of the h198D-L4 light chain is shown (SEQ ID NO: 42).

[0178] [ Fig.37 ] Fig.37 The binding activity of each antibody to cells expressing GARP is shown. h151D-H1L1, h151D-H4L4, and h198D-H3L4 showed specific binding activity to GARP.

[0179] [ Fig.38 ] Fig.38 The binding activity of each antibody to GARP-TGF β1 co-expressing cells is shown. Individual antibodies 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 bind to both GARP and GARP mutants co-expressed with TGF β1, and according to the known antibodies MHG8 and LHG10, these antibodies show binding activity to different regions in GARP.

[0180] [ Fig.39 ] Fig.39 The binding activity of each antibody to L428 cells is shown. Individual antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 showed binding activity to endogenously expressed GARP.

[0181] [ Fig.40 ] Fig.40 The binding activity of each antibody to Treg is shown. Individual antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 showed binding activity to FoxP3-positive Treg.

[0182] [ Fig.41 ] Fig.41 The ADCC activity of each antibody is shown. Individual antibodies h151D-H1L1, h151D-H4L4 and h198D-H3L4 showed ADCC activity.

[0183] [ Fig.42 ] Fig.42 The inhibitory activity of each antibody on Treg function is shown. Individual antibodies h151D-H1L1, h151D-H4L4 and h198D-H3L4 showed inhibitory activity on Treg function.

[0184] [ Fig.43 ] Fig.43The results show that Tregs suppress the target cell lytic activity of CTLs.

[0185] [ Fig.44 ] Fig.44 An increase in the anti-tumor activity of each antibody is shown. The individual antibodies 105F, h151D-H1L1, h151D-H4L4 and h198D-H3L4 inhibited the suppressive function of Tregs on the cytolytic activity of CTLs.

[0186] [ Fig.45 ] Fig.45 The in vivo anti-tumor activity of each antibody is shown. Individual antibodies 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 showed anti-tumor activity in in vivo models. DETAILED DESCRIPTION

[0187] In this specification, the term "cancer" is used to have the same meaning as that of the term "tumor".

[0188] In the present specification, the term "gene" is used to include not only DNA but also mRNA and cDNA thereof as well as cRNA thereof.

[0189] In the present specification, the term "polynucleotide" is used to have the same meaning as that of nucleic acid, and it includes DNA, RNA, probes, oligonucleotides, and primers.

[0190] In the present specification, the term "polypeptide" is used such that it is not distinguished from the term "protein".

[0191] In the present specification, the term "cell" includes cells in individual animals and cultured cells.

[0192] In the present specification, the term "GARP" is used to have the same meaning as that of the GARP protein.

[0193] In this specification, the term "cytotoxicity" is used to mean pathological changes caused to cells in any given way. This means not only direct trauma, but also all types of structural or functional damage caused to cells, such as DNA cleavage, formation of base dimers, chromosome cleavage, damage to the cell mitotic apparatus, and reduction in the activity of various types of enzymes.

[0194] In the present specification, the term "cytotoxic activity" is used to mean an activity that causes the above-mentioned cytotoxicity.

[0195] In the present specification, the term “antibody-dependent cellular cytotoxicity” is used to mean “antibody-dependent cellular cytotoxicity (ADCC) activity”, and this activity means an effect or activity of damaging target cells such as tumor cells via NK cells mediated by antibodies.

[0196] In this specification, the term "epitope" is used to refer to a partial peptide or partial three-dimensional structure of GARP to which a specific anti-GARP antibody binds. This epitope, which is a partial peptide of the above-mentioned GARP, can be determined by methods well known to those skilled in the art, such as immunoassays, for example, by the following method. First, various partial structures of the antigen are produced. Regarding the production of such partial structures, known oligopeptide synthesis techniques can be applied. For example, a series of peptides are produced by genetic recombination techniques well known to those skilled in the art, in which the antigen has been successively truncated from its C-terminus or N-terminus with an appropriate length, and thereafter, the reactivity of the antibody to such a polypeptide is studied, and the recognition site is roughly determined. Thereafter, further shorter peptides are synthesized, and then their reactivity with the above-mentioned peptides is studied to determine the epitope. In addition, the epitope of the partial three-dimensional structure of the antigen that is bound to the specific antibody can be determined by specifying the amino acid residues of the antigen adjacent to the above-mentioned antibody via X-ray structural analysis.

[0197] In this specification, the phrase "antibodies that bind to the same epitope" is used to mean different antibodies that bind to a common epitope. If the second antibody binds to a partial peptide or a partial three-dimensional structure to which the first antibody binds, it can be determined that the first antibody and the second antibody bind to the same epitope. In addition, by confirming that the second antibody competes with the first antibody for binding to the antigen (i.e., the second antibody interferes with the binding of the first antibody to the antigen), it can be determined that the first antibody and the second antibody bind to the same epitope, even if the specific sequence or structure of the epitope has not yet been determined. In addition, when the first antibody and the second antibody bind to the same epitope, and the first antibody has a special effect such as anti-tumor activity, the second antibody can be expected to have the same activity as that of the first antibody. Accordingly, if the second anti-GARP antibody binds to a partial peptide to which the first anti-GARP antibody binds, it can be determined that the first antibody and the second antibody bind to the same epitope of GARP. In addition, by confirming that the second anti-GARP antibody competes with the first anti-GARP antibody for binding of the first anti-GARP antibody to GARP, it can be determined that the first antibody and the second antibody are antibodies that bind to the same epitope of GARP.

[0198] In this specification, the term "CDR" is used to refer to the complementary determining region. The heavy chain and light chain of known antibody molecules each have three CDRs. Such CDRs are also referred to as hypervariable domains and are located in the variable regions of the heavy and light chains of the antibody. These regions have a particularly highly variable primary structure and are divided into three sites on the primary structure of the polypeptide chains of the heavy and light chains respectively. In this specification, with respect to the CDR of an antibody, the CDR of the heavy chain is referred to as CDRH1, CDRH2 and CDRH3 from the amino terminal side of the amino acid sequence of the heavy chain, and the CDR of the light chain is referred to as CDRL1, CDRL2 and CDRL3 from the amino terminal side of the amino acid sequence of the light chain. These sites are located close to each other in the three-dimensional structure and determine the specificity of the antibody to the antigen to which the antibody binds.

[0199] In the present invention, the phrase "hybridizes under stringent conditions" is used to mean that hybridization is performed in a commercially available hybridization solution ExpressHyb Hybridization Solution (manufactured by Clontech) at 68°C, or hybridization is performed under conditions wherein hybridization is performed at 68°C in the presence of 0.7-1.0 M NaCl using a DNA immobilized filter and the resultant is then washed with a 0.1 to 2-fold concentrated SSC solution (wherein 1×SSC consists of 150 mM NaCl and 15 mM sodium citrate) at 68°C for identification, or conditions equivalent thereto.

[0200] 1. GARP

[0201] GARP used in the present invention can be directly purified from GARP-expressing cells of humans or non-human mammals (e.g., rats, mice, etc.) and then used, or the cell membrane fraction of the aforementioned cells can be prepared and used as the GARP. Alternatively, GARP can also be obtained by synthesizing GARP in vitro, or by allowing host cells to produce GARP through genetic manipulation. According to such genetic manipulation, specifically, GARP protein can be obtained by incorporating GARP cDNA into an expression vector capable of expressing GARP cDNA, and then synthesizing GARP in a solution containing enzymes, substrates, and energy materials necessary for transcription and translation, or transforming host cells of other prokaryotes or eukaryotes so as to allow them to express GARP.

[0202] The amino acid sequence of human GARP is shown in SEQ ID NO: 1 in the sequence listing. Figure 1 middle.

[0203] In addition, proteins consisting of an amino acid sequence comprising one or more amino acid substitutions, deletions and / or additions in the above amino acid sequence of GARP and having biological activities equivalent to that of the GARP protein are also included in GARP.

[0204] The mature human GARP from which the signal sequence has been removed corresponds to an amino acid sequence consisting of amino acid residues at positions 20 to 662 of the amino acid sequence shown in SEQ ID NO:1.

[0205] In addition, GARP also includes proteins that consist of an amino acid sequence comprising one or more amino acid substitutions, deletions and / or additions in the amino acid sequence shown in SEQ ID NO: 1, or the amino acid sequence shown in SEQ ID NO: 1 from which the signal sequence has been removed, and have biological activities equivalent to that of GARP. In addition, GARP also includes proteins that consist of the following amino acid sequence and have biological activities equivalent to that of GARP, the amino acid sequence being encoded by a splice variant transcribed from the human GARP locus, or comprising one or more amino acid substitutions, deletions and / or additions in the above amino acid sequence.

[0206] 2. Production of anti-GARP antibodies

[0207] An example of the anti-GARP antibody of the present invention may be an anti-GARP human antibody.Anti-GARP human antibody means a human antibody having only the gene sequence of the antibody derived from a human chromosome.

[0208] Anti-GARP human antibodies can be obtained by a method of producing human antibodies using mice having human chromosome fragments containing heavy and light chain genes of human antibodies (see Tomizuka, K. et al. Nature Genetics (1997) 16, pp. 133-143; Kuroiwa, Y. et al. Nucl. Acids Res. (1998) 26, pp. 3447-3448; Yoshida, H. et al. Animal Cell Technology: Basic and Applied Aspects Vol. 10, pp. 69-73 (Kitagawa, Y., Matsuda, T. and Iijima, S. eds.), Kluwer Academic Publishers, 1999; Tomizuka, K. et al. Proc. Natl. Acad. Sci. USA (2000) 97, pp. 722-727, etc.).

[0209] Such human antibody-producing mice can be specifically produced by using genetically modified animals whose endogenous immunoglobulin heavy and light chain loci have been destroyed and, instead, human immunoglobulin heavy and light chain loci have then been introduced using yeast artificial chromosome (YAC) vectors or the like, then producing knockout animals and transgenic animals from such genetically modified animals, and then mating these animals with each other.

[0210] In addition, anti-GARP human antibodies can also be obtained by transforming eukaryotic cells with cDNA encoding the heavy and light chains of such human antibodies, or preferably with a vector containing the cDNA, according to genetic recombination technology, and then culturing the transformed cells producing genetically modified human monoclonal antibodies so that the antibodies can be obtained from the culture supernatant. As host cells, for example, eukaryotic cells can be used, and preferably mammalian cells, such as CHO cells, lymphocytes or myeloma cells, can be used.

[0211] Alternatively, the antibody can also be obtained by a method of obtaining a phage display-derived human antibody selected from a human antibody library (see Wormstone, IM et al. Investigative Ophthalmology & Visual Science. (2002) 43 (7), pp. 2301-2308; Carmen, S. et al. Briefings in Functional Genomics and Proteomics (2002), 1 (2), pp. 189-203; Siriwardena, D. et al. Ophthalmology (2002) 109 (3), pp. 427-431, etc.). For example, a phage display method can be applied, which includes allowing the variable region of a human antibody to be expressed as a single chain antibody (scFv) on the surface of a phage and then selecting a phage that binds to an antigen (Nature Biotechnology (2005), 23, (9), pp. 1105-1116).

[0212] By analyzing the phage genes that have been selected for their ability to bind to antigens, the DNA sequence encoding the variable region of the human antibody that binds to the antigen can be determined. Once the DNA sequence of the scFv that binds to the antigen is determined, the DNA sequence of the antibody constant region is allowed to bind to it to produce an IgG expression vector having the above sequence, and the resulting expression vector is then introduced into a suitable host cell and allowed to be expressed therein, thereby obtaining human antibodies (WO92 / 01047, WO92 / 20791, WO93 / 06213, WO93 / 11236, WO93 / 19172, WO95 / 01438, WO95 / 15388, Annu. Rev. Immunol (1994) 12, pp. 433-455, Nature Biotechnology (2005) 23 (9), pp. 1105-1116).

[0213] In addition, the antibody against GARP of the present invention can be obtained by immunizing an animal with GARP or any given polypeptide selected from the amino acid sequence of GARP, and then collecting and purifying the antibodies produced in the living body. The biological species of GARP used as an antigen is not limited to humans, and therefore, animals can also be immunized with GARP derived from animals other than humans, such as mice or rats. In this case, by examining the cross-reactivity of the obtained antibody that binds to heterologous GARP with human GARP, antibodies that can be applied to human diseases can be selected.

[0214] Furthermore, according to known methods (e.g., Kohler and Milstein, Nature (1975) 256, pp. 495-497, Kennet, R. ed., Monoclonal Antibodies, pp. 365-367, Plenum Press, NY (1980)), antibody-producing cells producing antibodies against GARP are fused with myeloma cells to establish hybridomas in order to obtain monoclonal antibodies.

[0215] It should be noted that GARP used as an antigen can be obtained by allowing host cells to produce the GARP gene according to genetic manipulation.

[0216] Specifically, a vector capable of expressing the GARP gene is produced, and then the vector is introduced into a host cell so that the gene is expressed therein, and the expressed GARP can be purified thereafter. The method of obtaining an antibody against GARP will be specifically described below.

[0217] (1) Preparation of antigen

[0218] Examples of antigens for producing anti-GARP antibodies may include GARP, polypeptides consisting of at least 6 consecutive partial amino acid sequences thereof, and derivatives prepared by adding any given amino acid sequence or carrier to such GARP or its polypeptide.

[0219] GARP can be directly purified from human tumor tissue or tumor cells and then used. Alternatively, GARP can also be obtained by synthesizing it in vitro or allowing host cells to produce it through genetic manipulation.

[0220] According to such genetic manipulation, specifically, the antigen can be obtained by introducing GARP cDNA into an expression vector capable of expressing GARP cDNA, and then synthesizing GARP in a solution containing enzymes, substrates, and energy materials necessary for transcription and translation, or transforming other prokaryotic or eukaryotic host cells to allow them to express GARP.

[0221] The antigen can also be obtained as a secretory protein by allowing a fusion protein formed by linking DNA encoding the extracellular region of GARP, which is a membrane protein, with DNA encoding the constant region of an antibody to be expressed in an appropriate host and / or vector system.

[0222] GARP cDNA can be obtained by the so-called PCR method, which includes, for example, using a cDNA library expressing GARP cDNA as a template, and also using primers for specifically amplifying GARP cDNA to perform a polymerase chain reaction (hereinafter referred to as "PCR") (see Saiki, RK, et al. Science (1988) 239, pp. 487-489).

[0223] An example of in vitro synthesis of polypeptides may be Rapid Translation System (RTS) manufactured by Roche Diagnostics, but is not limited thereto.

[0224] Examples of prokaryotic cells used as host cells may include Escherichia coli ( Escherichia coli ) and Bacillus subtilis ( Bacillus subtilis ). In order to transform the host cell with the target gene, the host cell is transformed with a plasmid vector containing a replicon derived from a species compatible with the host, i.e., a replication origin and a regulatory sequence. As a vector, a vector having a sequence capable of imparting phenotypic selectivity to the cell to be transformed is preferred.

[0225] Examples of eukaryotic cells used as host cells may include cells of vertebrates, insects, and yeast. Examples of vertebrate cells that can be frequently used include COS cells (Gluzman, Y., Cell (1981) 23, pp. 175-182, ATCC CRL-1650), mouse fibroblasts NIH3T3 (ATCC numbering CRL-1658), and dihydrofolate reductase-deficient cell lines of Chinese hamster ovary cells (CHO cells, ATCC CCL-61) (Urlaub, G. and Chasin, LA Proc. Natl. Acad. Sci. USA (1980) 77, pp. 4126-4220), which are monkey cells, but are not limited thereto.

[0226] The transformant thus obtained can be cultured according to ordinary methods, and the polypeptide of interest can be produced inside or outside the cultured cells.

[0227] As the culture medium used in the culture, various types of common culture mediums can be selected when appropriate, depending on the type of host cell used. If the host cell is Escherichia coli, antibiotics such as ampicillin or IPMG can be added to the LB culture medium if necessary, and the resulting culture medium can then be used.

[0228] As a result of the above-mentioned culture, the recombinant protein produced inside or outside the cells of the transformant can be isolated and / or purified by various known separation methods utilizing the physical or chemical properties of the protein.

[0229] Specific examples of the method may include treatment with a common protein precipitating agent, ultrafiltration, various types of liquid chromatography such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography or affinity chromatography, dialysis methods, and combinations thereof.

[0230] In addition, by attaching a histidine tag consisting of 6 residues to the recombinant protein to be expressed, the protein can be efficiently purified using a nickel affinity column. In another method, by connecting the Fc region of IgG to the recombinant protein to be expressed, the protein can be efficiently purified using a protein A column.

[0231] By combining the above methods with each other, the polypeptide of interest can be produced on a large scale with high yield and high purity.

[0232] (2) Production of anti-GARP monoclonal antibodies

[0233] An example of an antibody that specifically binds to GARP may be a monoclonal antibody that specifically binds to GARP. A method for obtaining such a monoclonal antibody is as follows.

[0234] For the production of monoclonal antibodies, the following workup steps are generally necessary.

[0235] Specifically, the necessary work steps include:

[0236] (a) Purification of biopolymers used as antigens,

[0237] (b) a step of immunizing an animal with an antigen by injection, collecting blood from the animal, examining the antibody titer to determine the period at which the spleen is removed from the animal, and then preparing antibody-producing cells,

[0238] (c) preparation of myeloma cells (hereinafter referred to as "myeloma"),

[0239] (d) cell fusion between antibody-producing cells and myeloma cells,

[0240] (e) selecting a group of hybridomas producing target antibodies,

[0241] (f) division into single-cell clones (clones),

[0242] (g) optionally, for the cultivation of hybridomas for mass production of monoclonal antibodies, or the breeding of animals into which hybridomas are transplanted, and

[0243] (h) Analysis of the physiological activity and binding specificity of the monoclonal antibody thus produced, or examination of the properties of the antibody as a labeling reagent.

[0244] The method for producing a monoclonal antibody will be described in detail below together with the above steps. However, the method for producing the above antibody is not limited thereto, and, for example, antibody-producing cells other than spleen cells and myeloma may also be used.

[0245] (a) Antigen purification

[0246] As the antigen, GARP prepared by the above method or a portion thereof can be used.

[0247] Alternatively, a membrane fraction prepared from a recombinant cell expressing GARP, or such a recombinant cell expressing GARP itself, or further a partial peptide of the protein of the present invention chemically synthesized according to a method well known to those skilled in the art can also be used as an antigen.

[0248] (b) Preparation of antibody-producing cells

[0249] The antigen obtained in step (a) is mixed with an auxiliary agent such as Freund's complete adjuvant or incomplete adjuvant, or potassium alum to prepare an immunogen, and thereafter an experimental animal is immunized with the immunogen. As such an experimental animal, there is no doubt that animals used in known methods for producing hybridomas can be used. Specific examples of such animals that can be used herein include mice, rats, goats, sheep, cattle and horses. From the viewpoint of the availability of myeloma cells to be fused with excised antibody-producing cells, etc., it is preferred to use mice or rats as animals to be immunized.

[0250] The strains of mice and rats actually used are not particularly limited. In the case of mice, examples of strains that can be used herein include A, AKR, BALB / c, BDP, BA, CE, C3H, 57BL, C57BL, C57L, DBA, FL, HTH, HT1, LP, NZB, NZW, RF, R III, SJL, SWR, WB, and 129. On the other hand, in the case of rats, examples of strains that can be used herein include Wistar, Low, Lewis, Sprague, Dawley, ACI, BN, and Fischer.

[0251] These mice and rats are available from laboratory animal breeders and distributors, such as CLEA Japan, Inc. and CHARLES RIVER LABORATORIES JAPAN, INC.

[0252] Among them, the BALB / c strain in the case of mice and the Wistar and Low strains in the case of rats are particularly preferred as animals to be immunized in view of fusion compatibility with myeloma cells described below.

[0253] Furthermore, considering the homology of antigens between humans and mice, it is also preferable to use mice whose biological mechanism for removing autoantibodies has been reduced, that is, autoimmune disease mice.

[0254] The age of these mice or rats at the time of immunization is preferably 5 to 12 weeks of age, and more preferably 6 to 8 weeks of age.

[0255] To immunize animals with GARP or its recombinant, known methods can be applied, for example, the method described in detail in Weir, DM, Handbook of Experimental Immunology, Vol. I. II. III., Blackwell Scientific Publications, Oxford (1987), Kabat, EA and Mayer, MM, Experimental Immunochemistry, Charles C Thomas Publisher Springfield, Illinois (1964), etc.

[0256] Among these immunization methods, the method preferably applied to the present invention is specifically, for example, the following method.

[0257] That is, first, a membrane protein fraction used as an antigen or cells in which the antigen has been expressed is intradermally or intraperitoneally administered to an animal.

[0258] In order to enhance the immunization efficiency, the combined use thereof is preferred. If intradermal administration is performed in the first half of the administration regimen and intraperitoneal administration is performed in the second half thereof or only in the final administration case, the immunization efficiency can be particularly enhanced.

[0259] The administration schedule of the antigen varies depending on the type of animal to be immunized, individual differences, etc. In general, 3 to 6 antigen doses and a dosing interval of 2 to 6 weeks are preferred, and 3 or 4 antigen doses and a dosing interval of 2 to 4 weeks are more preferred.

[0260] The dosage of the antigen to be used varies depending on the type of animal to be immunized, individual differences, etc. It is generally 0.05 to 5 mg, and preferably about 0.1 to 0.5 mg.

[0261] The boost is performed 1 to 6 weeks, preferably 2 to 4 weeks, and more preferably 2 to 3 weeks after the above-mentioned antigen administration.

[0262] When boosting is performed, the applied dose of the antigen differs depending on the type of animal, its size, etc. For example, in the case of mice, the applied dose of the antigen is generally 0.05 to 5 mg, preferably 0.1 to 0.5 mg, and more preferably about 0.1 to 0.2 mg.

[0263] 1 to 10 days, preferably 2 to 5 days, and more preferably 2 or 3 days after completing the above-mentioned boosting, the spleen cells or lymphocytes containing antibody-producing cells are aseptically removed from the immunized animal. The antibody titer is then measured. The animal in which the antibody titer has been sufficiently increased is used as a supply source of antibody-producing cells, so that the efficiency of subsequent operations can be enhanced.

[0264] Examples of the method for measuring the antibody titer used herein may include the RIA method and the ELISA method, but are not limited thereto.

[0265] Regarding the measurement of the antibody titer in the present invention, for example, the ELISA method can be performed according to the following procedure.

[0266] First, a purified or partially purified antigen is adsorbed on a solid phase such as a surface of a 96-well plate for ELISA, and another solid surface on which the antigen is not adsorbed is covered with a protein unrelated to the antigen such as bovine serum albumin (hereinafter referred to as "BSA"). The surface is washed and then allowed to contact with a serially diluted sample (e.g., mouse serum) used as a primary antibody, so that the antibody in the sample is allowed to bind to the above antigen.

[0267] Thereafter, an enzyme-labeled antibody against mouse antibody is added as a secondary antibody, so that it is allowed to bind to the mouse antibody, followed by washing. After this, a substrate for the enzyme is added thereto, and then changes in absorbance due to color development based on substrate decomposition, etc. are measured to calculate the antibody titer.

[0268] Antibody-producing cells can be isolated from spleen cells or lymphocytes of immunized animals according to known methods (e.g., Kohler et al. Nature (1975) 256, p. 495; Kohler et al. Eur. J. Immunol. (1977) 6, p. 511; Milstein et al. Nature (1977), 266, p. 550; Walsh, Nature, (1977) 266, p. 495). For example, in the case of spleen cells, a common method can be used, which includes mincing the spleen, filtering the cells through a stainless steel mesh, and then suspending the filtrate in Eagle's minimum essential medium (MEM) to isolate antibody-producing cells.

[0269] (c) Preparation of myeloma cells (hereinafter referred to as "myeloma")

[0270] Myeloma cells used for cell fusion are not particularly limited, and when appropriate, cells can be selected from known cell lines and then used. Considering the convenience of selecting hybridomas from fused cells, it is preferred to use an HGPRT (hypoxanthine-ornithine phosphoribosyltransferase)-deficient cell line whose selection procedure has been established.

[0271] That is, examples of such HGPRT-deficient cell lines include mouse-derived X63-Ag8 (X63), NS1-ANS / 1 (NS1), P3X63-Ag8. U1 (P3U1), X63-Ag8.653 (X63.653), SP2 / 0-Ag14 (SP2 / 0), MPC11-45.6TG1.7 (45.6TG), FO, S149 / 5XXO and BU. 1; rat-derived 210. RSY3. Ag. 1. 2.3 (Y3); and human-derived U266AR (SKO-007), GM1500•GTG-A12 (GM1500), UC729-6, LICR-LOW-HMy2 (HMy2) and 8226AR / NIP4-1 (NP41). These HGPRT-deficient cell lines are available, for example, from the American Type Culture Collection (ATCC).

[0272] These cell lines are subcultured in an appropriate medium, such as 8-azaguanine medium [a medium prepared by adding 8-azaguanine to RPMI-1640 medium containing glutamine, 2-mercaptoethanol, gentamicin and fetal calf serum (hereinafter referred to as "FCS")], Iscove's modified Dulbecco's medium (hereinafter referred to as "IMDM"), or Dulbecco's modified Eagle's medium (hereinafter referred to as "DMEM"). Three or four days before cell fusion, the cells are subcultured in a normal medium [e.g., ASF104 medium containing 10% FCS (manufactured by Ajinomoto Co., Inc.)] to ensure that the number of cells is not less than 2×10 on the day of cell fusion. 7 cells.

[0273] (d) Cell fusion

[0274] When appropriate, antibody-producing cells can be fused with myeloma cells according to known methods (Weir, DM, Handbook of Experimental Immunology, Vol. I. II. III., Blackwell Scientific Publications, Oxford (1987), Kabat, EA and Mayer, MM, Experimental Immunochemistry, Charles C Thomas Publisher Springfield, Illinois (1964) etc.) under conditions in which the survival rate of the cells is not extremely reduced.

[0275] Examples of such methods that can be used herein include chemical methods, which include mixing antibody-producing cells with myeloma cells in a high concentration polymer solution such as polyethylene glycol, and physical methods using electrical stimulation. Among these methods, specific examples of the above-mentioned chemical methods are as follows.

[0276] That is, when polyethylene glycol is used as a high concentration polymer solution, antibody-producing cells are mixed with myeloma cells in a polyethylene glycol solution having a molecular weight of 1,500 to 6,000, preferably 2,000 to 4,000, at a temperature of 30° C. to 40° C., preferably 35° C. to 38° C., for 1 to 10 minutes, preferably 5 to 8 minutes.

[0277] (e) Selection of hybridoma groups

[0278] The method for selecting hybridomas obtained by the above cell fusion is not particularly limited. Generally, the HAT (hypoxanthine-aminopterin-thymidine) selection method is used (Kohler et al. Nature (1975) 256, p. 495; Milstein et al. Nature (1977) 266, p. 550).

[0279] This method is effective when hybridomas are obtained using myeloma cells of an HGPRT-deficient cell line that cannot survive aminopterin.

[0280] Specifically, unfused cells and hybridomas are cultured in HAT medium so that only hybridomas resistant to aminopterin are allowed to selectively remain and grow.

[0281] (f) Division into single-cell clones (cloning)

[0282] As a hybridoma cloning method, for example, known methods such as the methylcellulose method, the soft agarose method or the limiting dilution method can be applied (see, for example, Barbara, BM and Stanley, MS: Selected Methods in Cellular Immunology, WH Freeman and Company, San Francisco (1980)). Among these methods, three-dimensional culture methods such as the methylcellulose method are particularly preferred. For example, the hybridoma group formed by cell fusion is suspended in a methylcellulose culture medium such as ClonaCell-HY Selection Medium D (manufactured by StemCell Technologies, #03804) and then cultured. Thereafter, the formed hybridoma colonies are harvested so that monoclonal hybridomas can be obtained. The harvested hybridoma colonies are each cultured, and the obtained hybridoma culture supernatant in which a stable antibody titer is observed is selected as a GARP monoclonal antibody producing hybridoma strain.

[0283] Examples of the hybridoma strain thus established may include GARP hybridomas 151D and 198D. In this specification, antibodies produced by GARP hybridomas 151D and 198D are referred to as "151D antibodies" or "198D antibodies", or they are simply referred to as "151D" or "198D".

[0284] The heavy chain variable region of the 151D antibody has the amino acid sequence shown in SEQ ID NO: 15 in the sequence listing. In addition, the light chain variable region of the 151D antibody has the amino acid sequence shown in SEQ ID NO: 17 in the sequence listing. It should be noted that the amino acid sequence of the heavy chain variable region shown in SEQ ID NO: 15 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 14 in the sequence listing. It should also be noted that the amino acid sequence of the light chain variable region shown in SEQ ID NO: 17 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 16 in the sequence listing.

[0285] The heavy chain variable region of the 198D antibody has the amino acid sequence shown in SEQ ID NO: 19 in the sequence listing. In addition, the light chain variable region of the 198D antibody has the amino acid sequence shown in SEQ ID NO: 21 in the sequence listing. It should be noted that the amino acid sequence of the heavy chain variable region shown in SEQ ID NO: 19 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 18 in the sequence listing. It should also be noted that the amino acid sequence of the light chain variable region shown in SEQ ID NO: 21 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 20 in the sequence listing.

[0286] (g) Preparation of monoclonal antibodies by culturing hybridomas

[0287] Cultivating the hybridoma thus selected allows the monoclonal antibody to be efficiently obtained. Before performing the cultivation, it is necessary to screen the hybridoma that produces the monoclonal antibody of interest.

[0288] For this screening, known methods can be employed.

[0289] The antibody titer can be measured in the present invention, for example, by the ELISA method described in the above section (b).

[0290] The hybridoma obtained by the above method can be stored in liquid nitrogen or in a frozen state in a freezer at -80°C or lower.

[0291] After cloning is completed, the hybridomas are cultured while replacing the HT medium with a normal medium.

[0292] The large-scale culture is performed by rotary culture or spin culture using a large culture flask. The supernatant obtained from the large-scale culture is purified according to methods well known to those skilled in the art, such as gel filtration, to obtain a monoclonal antibody that specifically binds to the protein of the present invention.

[0293] Furthermore, the hybridoma is injected into the peritoneal cavity of mice of the same strain (eg, the above-mentioned BALB / c) or Nu / Nu mice, and the hybridoma is allowed to grow therein, so as to obtain ascites containing a large amount of the monoclonal antibody of the present invention.

[0294] When hybridomas are administered into the peritoneal cavity of such mice, a larger amount of ascites can be obtained if mineral oil such as 2,6,10,14-tetramethylpentadecane (pristane) has been pre-administered to the mice (3 to 7 days before hybridoma administration).

[0295] For example, suppose that an immunosuppressant has been previously administered intraperitoneally to mice of the same strain as the hybridoma, causing T cell inactivation. 6 Up to 10 7 The hybridoma and / or cloned cells are suspended in a serum-free culture medium (0.5 ml), and the suspension is then administered into the peritoneal cavity. When the normal abdomen is swollen and ascites has accumulated, ascites is collected from the mouse. According to this method, a monoclonal antibody having a concentration of about 100 times or more that in the culture solution can be obtained.

[0296] The monoclonal antibody obtained by the above method can be purified, for example, by the method described in Weir, DM: Handbook of Experimental Immunology, Vol. I, II, III, Blackwell Scientific Publications, Oxford (1978).

[0297] The monoclonal antibody thus obtained has high antigenic specificity for GARP.

[0298] (h) Determination of monoclonal antibodies

[0299] The isotype and subtype of the obtained monoclonal antibody can be determined as follows.

[0300] First, examples of the assay method may include the ouchterlony method, the ELISA method, and the RIA method.

[0301] The Oteronucleic acid method is simple, but requires a concentration procedure when the concentration of the monoclonal antibody is low.

[0302] On the other hand, when the ELISA method or the RIA method is used, the culture supernatant is directly reacted with an antigen-adsorbed solid phase, and antibodies corresponding to various immunoglobulin isotypes or subclasses are used as secondary antibodies, so that the isotype and subtype of the monoclonal antibody can be identified.

[0303] As a simpler method, a commercially available identification kit (eg, Mouse Typer Kit; manufactured by BioRad) or the like can also be utilized.

[0304] In addition, protein quantification can be performed by the Folin Lowry method and calculation of the value based on the absorbance at 280 nm [1.4 (OD 280) = 1 mg / ml immunoglobulin].

[0305] Furthermore, also in the case where steps (a) to (h) in (2) above are performed again and monoclonal antibodies are obtained separately and independently, antibodies having properties equivalent to those of the 105F antibody, the 110F antibody, the 151D-derived antibody (humanized 151D antibody), and the 198D-derived antibody (humanized 198D antibody) can be obtained. Examples of such antibodies may be antibodies that bind to the same epitope to which each of the above antibodies binds. The 105F antibody recognizes and binds to the amino acid sequence portion at amino acid positions 366 to 377, 407 to 445, and 456 to 470 in the amino acid sequence of GARP (SEQ ID NO: 1), the 110F antibody recognizes and binds to the amino acid sequence portion at amino acid positions 54 to 112 and 366 to 392 in the amino acid sequence of GARP (SEQ ID NO: 1); the 151D-derived antibody (humanized 151D antibody) recognizes and binds to the amino acid sequence at amino acid positions 352 to 392 in the amino acid sequence of GARP (SEQ ID NO: 1); and the 198D-derived antibody (humanized 198D antibody) recognizes and binds to the amino acid sequence at amino acid positions 18 to 112 in the amino acid sequence of GARP (SEQ ID NO: 1). Accordingly, specific examples of the above-mentioned epitopes may include the above-mentioned regions in the amino acid sequence of GARP.

[0306] If a newly prepared monoclonal antibody binds to a portion of the peptide or a portion of the three-dimensional structure to which the above-mentioned 105F antibody or the like binds, it can be determined that the monoclonal antibody binds to the same epitope to which the above-mentioned 105F antibody or the like binds. In addition, by confirming that the monoclonal antibody competes with the above-mentioned antibodies, such as the 105F antibody, in the binding of the antibody to GARP (i.e., the monoclonal antibody interferes with the binding of the above-mentioned antibodies, such as the 105F antibody, to GARP), it can be determined that the monoclonal antibody binds to the same epitope to which the above-mentioned 105F antibody or the like binds, even if the specific sequence or structure of the epitope has not yet been determined. When it is confirmed that the monoclonal antibody binds to the same epitope to which the 105F antibody or the like binds, it is strongly expected that the monoclonal antibody should have properties equivalent to those of the above-mentioned antibodies, such as the 105F antibody.

[0307] (3) Other antibodies

[0308] The antibodies of the present invention also include genetically recombinant antibodies that have been artificially modified for the purpose of reducing heterologous antigenicity to humans, such as chimeric antibodies, humanized antibodies and the above-mentioned human antibodies, as well as the above-mentioned monoclonal antibodies against GARP. These antibodies can be produced by known methods.

[0309] The obtained antibody can be purified to a homogeneous state. In order to separate and purify the antibody, separation and purification methods for common proteins can be used. For example, column chromatography, filtration, ultrafiltration, salting out, dialysis, preparative polyacrylamide gel electrophoresis, isoelectric focusing, etc. are appropriately selected and combined with each other so that the antibody can be separated and purified (Strategies for Protein Purification and Characterization: A Laboratory Course Manual, Daniel R. Marshak et al., ed., Cold Spring Harbor Laboratory Press (1996); Antibodies: A Laboratory Manual. Edited by Harlow and David Lane, Cold Spring Harbor Laboratory (1988)), but examples of separation and purification methods are not limited to these.

[0310] Examples of chromatography may include affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration chromatography, reverse phase chromatography, and adsorption chromatography.

[0311] These chromatographic techniques can be performed using liquid chromatography such as HPLC or FPLC.

[0312] Examples of the column used in affinity chromatography may include a protein A column and a protein G column. Examples of the column involving the use of protein A may include Hyper D, POROS, and Sepharose FF (Pharmacia).

[0313] In addition, antibodies can be purified by using an antigen-immobilized carrier and utilizing the binding activity of antibodies to antigens.

[0314] The obtained antibodies are evaluated in terms of their binding activity to the antigen according to the methods described in the Examples and the like described below, so that a preferred antibody can be selected.

[0315] The stability of antibodies can be used as an indicator for comparing antibody properties. Differential scanning calorimeter (DSC) is a device that can quickly and accurately measure the midpoint of thermal denaturation (Tm), which is a good indicator of the relative structural stability of proteins. By using DSC to measure the Tm value and making a comparison about the obtained value, the difference in thermal stability can be compared. It is known that the storage stability of antibodies has a certain correlation with the thermal stability of antibodies (Lori Burton, et al. Pharmaceutical Development and Technology (2007) 12, pp. 265-273), and therefore, preferred antibodies can be selected using thermal stability as an indicator. Examples of other indicators for selecting antibodies can include high yields in suitable host cells and low aggregation in aqueous solutions. For example, because the antibody with the highest yield does not always show the highest thermal stability, it is necessary to select the most suitable antibody for application to humans based on the above-mentioned indicator by comprehensively measuring it.

[0316] Examples of the anti-GARP human antibody of the present invention may be anti-GARP human antibodies obtained by the above-mentioned phage display method, and preferred examples of the anti-GARP human antibody herein may include 105F antibody and 110F antibody, each of which has the following structure.

[0317] The heavy chain of the 105F antibody has the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing. In the heavy chain amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, the amino acid sequence consisting of the amino acid residues at positions 1 to 118 is the variable region, and the amino acid sequence consisting of the amino acid residues at positions 119 to 448 is the constant region. In SEQ ID NO: 2 in the sequence listing, the variable region has CDRH1 consisting of the amino acid sequence at amino acid positions 26 to 35, CDRH2 consisting of the amino acid sequence at amino acid positions 50 to 66, and CDRH3 consisting of the amino acid sequence at amino acid positions 99 to 107. In addition, the sequence of SEQ ID NO: 2 is shown in Figure 2 middle.

[0318] The light chain of the 105F antibody has the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing. In the light chain amino acid sequence shown in SEQ ID NO: 3 in the sequence listing, the amino acid sequence consisting of the amino acid residues at positions 1 to 112 is the variable region, and the amino acid sequence consisting of the amino acid residues at positions 113 to 217 is the constant region. In SEQ ID NO: 3 in the sequence listing, the variable region has CDRL1 consisting of the amino acid sequence at amino acid positions 23 to 36, CDRL2 consisting of the amino acid sequence at amino acid positions 52 to 58, and CDRL3 consisting of the amino acid sequence at amino acid positions 91 to 101. In addition, the sequence of SEQ ID NO: 3 is shown in Figure 3 middle.

[0319] The heavy chain of the 110F antibody has the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing. In the heavy chain amino acid sequence shown in SEQ ID NO: 4 in the sequence listing, the amino acid sequence consisting of the amino acid residues at positions 1 to 123 is the variable region, and the amino acid sequence consisting of the amino acid residues at positions 124 to 453 is the constant region. In SEQ ID NO: 4 in the sequence listing, the variable region has CDRH1 consisting of the amino acid sequence at amino acid positions 26 to 35, CDRH2 consisting of the amino acid sequence at amino acid positions 50 to 66, and CDRH3 consisting of the amino acid sequence at amino acid positions 99 to 112. In addition, the sequence of SEQ ID NO: 4 is shown in Figure 4 middle.

[0320] The light chain of the 110F antibody has the amino acid sequence shown in SEQ ID NO: 5 in the sequence listing. In the light chain amino acid sequence shown in SEQ ID NO: 5 in the sequence listing, the amino acid sequence consisting of the amino acid residues at positions 1 to 111 is the variable region, and the amino acid sequence consisting of the amino acid residues at positions 112 to 216 is the constant region. In SEQ ID NO: 5 in the sequence listing, the variable region has CDRL1 consisting of the amino acid sequence at amino acid positions 23 to 36, CDRL2 consisting of the amino acid sequence at amino acid positions 52 to 58, and CDRL3 consisting of the amino acid sequence at amino acid positions 91 to 100. In addition, the sequence of SEQ ID NO: 5 is shown in Figure 5 middle.

[0321] The amino acid sequence of the heavy chain of the 105F antibody shown in SEQ ID NO: 2 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 6 in the sequence listing. The nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 354 of the nucleotide sequence shown in SEQ ID NO: 6 in the sequence listing encodes the heavy chain variable region of the 105F antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 355 to 1344 encodes the heavy chain constant region of the 105F antibody. As shown in SEQ ID NO: 6, the nucleotide sequence encoding the variable region has a polynucleotide consisting of a nucleotide sequence at nucleotide positions 76 to 105 encoding CDRH1, a polynucleotide consisting of a nucleotide sequence at nucleotide positions 148 to 198 encoding CDRH2, and a polynucleotide consisting of a nucleotide sequence at nucleotide positions 295 to 321 encoding CDRH3. In addition, the sequence of SEQ ID NO: 6 is shown in Figure 6 middle.

[0322] The amino acid sequence of the light chain of the 105F antibody shown in SEQ ID NO: 3 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 7 in the sequence listing. The nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 336 of the nucleotide sequence shown in SEQ ID NO: 7 in the sequence listing encodes the light chain variable region of the 105F antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 337 to 651 encodes the light chain constant region of the 105F antibody. As shown in SEQ ID NO: 7, the nucleotide sequence encoding the variable region has a polynucleotide consisting of a nucleotide sequence at nucleotide positions 67 to 108 encoding CDRL1, a polynucleotide consisting of a nucleotide sequence at nucleotide positions 154 to 174 encoding CDRL2, and a polynucleotide consisting of a nucleotide sequence at nucleotide positions 271 to 303 encoding CDRL3. In addition, the sequence of SEQ ID NO: 7 is shown in Figure 7 middle.

[0323] The amino acid sequence of the heavy chain of the 110F antibody shown in SEQ ID NO: 4 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 8 in the sequence listing. The nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 369 of the nucleotide sequence shown in SEQ ID NO: 8 in the sequence listing encodes the heavy chain variable region of the 110F antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 370 to 1359 encodes the heavy chain constant region of the 110F antibody. As shown in SEQ ID NO: 8, the nucleotide sequence encoding the variable region has a polynucleotide consisting of a nucleotide sequence at nucleotide positions 76 to 105 encoding CDRH1, a polynucleotide consisting of a nucleotide sequence at nucleotide positions 148 to 198 encoding CDRH2, and a polynucleotide consisting of a nucleotide sequence at nucleotide positions 295 to 336 encoding CDRH3. In addition, the sequence of SEQ ID NO: 8 is shown in Figure 8 middle.

[0324] The amino acid sequence of the light chain of the 110F antibody shown in SEQ ID NO: 5 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 9 in the sequence listing. The nucleotide sequence consisting of the nucleotides at nucleotide positions 1 to 333 of the nucleotide sequence shown in SEQ ID NO: 9 in the sequence listing encodes the light chain variable region of the 110F antibody, and the nucleotide sequence consisting of the nucleotides at nucleotide positions 334 to 648 encodes the light chain constant region of the 110F antibody. As shown in SEQ ID NO: 9, the nucleotide sequence encoding the variable region has a polynucleotide consisting of a nucleotide sequence at nucleotide positions 67 to 108 encoding CDRL1, a polynucleotide consisting of a nucleotide sequence at nucleotide positions 154 to 174 encoding CDRL2, and a polynucleotide consisting of a nucleotide sequence at nucleotide positions 271 to 300 encoding CDRL3. In addition, the sequence of SEQ ID NO: 9 is shown in Fig. 9 middle.

[0325] Regarding the antibody of the present invention, in addition to the above-mentioned anti-GARP human antibody, even in the case where the antibody is separately and independently obtained according to a method other than the above-mentioned method for obtaining the antibody, an antibody having cytotoxicity equivalent to that of the 105F antibody or the 110F antibody can be obtained. An example of such an antibody may be an antibody that binds to the same epitope to which the 105F antibody or the 110F antibody binds.

[0326] If a newly generated human antibody binds to a portion of a peptide or a portion of a three-dimensional structure to which the 105F antibody or 110F antibody binds, it can be determined that the generated antibody binds to the same epitope to which the 105F antibody or 110F antibody binds. In addition, by confirming that the antibody in question competes with the 105F antibody or 110F antibody for its binding to GARP (i.e., the antibody in question interferes with the binding of the 105F antibody or 110F antibody to GARP), it can be determined that the antibody in question binds to the same epitope to which the 105F antibody or 110F antibody binds, even if the specific sequence or structure of the epitope has not yet been determined. If it is confirmed that the antibody in question binds to the same epitope to which the 105F antibody or 110F antibody binds, it is strongly expected that the antibody in question should have cytotoxicity equivalent to that of the 105F antibody or 110F antibody.

[0327] In addition, the antibodies of the present invention include artificially modified genetic recombinant antibodies. These antibodies can be produced using known methods. The antibody involved is preferably an antibody that has at least 6 CDRs identical to the heavy and light chains of the above-mentioned 105F antibody or 110F antibody, and also has ADCC activity and inhibitory activity against the immunosuppressive function of Treg. The antibody involved is not limited to a specific antibody, as long as it has the above-mentioned properties. The antibody is more preferably an antibody having the heavy chain variable region and light chain variable region of the above-mentioned 105F antibody or 110F antibody.

[0328] In addition, by combining sequences that show high homology to the heavy chain amino acid sequence and light chain amino acid sequence of the 105F antibody or the 110F antibody with each other, an antibody having an activity equivalent to that of the above-mentioned antibody can be selected. This homology is generally 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 99% or more (however, each CDR is the same as that of each of the above-mentioned antibodies). In addition, by incorporating an amino acid sequence containing substitution, deletion or addition of one or several amino acid residues into the amino acid sequence of the above-mentioned heavy chain or light chain (excluding each CDR site), an antibody having an activity equivalent to that of each of the above-mentioned antibodies can also be selected.

[0329] Still further, examples of the anti-GARP antibody according to the present invention may include the following chimeric antibodies and humanized antibodies.

[0330] Examples of chimeric antibodies may include antibodies in which the variable region and the constant region are heterologous to each other, such as chimeric antibodies formed by conjugating the variable region of a mouse- or rat-derived antibody to a human-derived constant region (see Proc. Natl. Acad. Sci. USA, 81, 6851-6855, (1984)).

[0331] The chimeric antibody derived from rat anti-human GARP antibody 151D is an antibody consisting of a heavy chain comprising a heavy chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 1 to 117 shown in SEQ ID NO: 15, and a light chain comprising a light chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 1 to 109 shown in SEQ ID NO: 17, and the chimeric antibody may have a constant region derived from any given human.

[0332] Furthermore, the chimeric antibody derived from rat anti-human GARP antibody 198D is an antibody consisting of a heavy chain comprising a heavy chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 1 to 120 shown in SEQ ID NO: 19, and a light chain comprising a light chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 1 to 109 shown in SEQ ID NO: 21, and the chimeric antibody may have a constant region derived from any given human.

[0333] Examples of such chimeric antibodies may include: an antibody consisting of a heavy chain having an amino acid sequence consisting of the amino acid residues at positions 20 to 466 shown in SEQ ID NO: 25 in the sequence listing, and a light chain having an amino acid sequence consisting of the amino acid residues at positions 21 to 234 shown in SEQ ID NO: 27 therein; and an antibody consisting of a heavy chain having an amino acid sequence consisting of the amino acid residues at positions 20 to 469 shown in SEQ ID NO: 29 in the sequence listing, and a light chain having an amino acid sequence consisting of the amino acid residues at positions 21 to 234 shown in SEQ ID NO: 31 therein.

[0334] It should be noted that in the heavy chain sequence shown in SEQ ID NO: 25 in the sequence listing, the amino acid sequence consisting of amino acid residues at positions 1 to 19 is the signal sequence, the amino acid sequence consisting of amino acid residues at positions 20 to 136 is the variable region, and the amino acid sequence consisting of amino acid residues at positions 137 to 466 is the constant region.

[0335] It should also be noted that in the light chain sequence shown in SEQ ID NO: 27 in the sequence listing, the amino acid sequence consisting of the amino acid residues at positions 1 to 20 is the signal sequence, the amino acid sequence consisting of the amino acid residues at positions 21 to 129 is the variable region, and the amino acid sequence consisting of the amino acid residues at positions 130 to 234 is the constant region.

[0336] It should be further noted that in the heavy chain sequence shown in SEQ ID NO: 29 in the sequence listing, the amino acid sequence consisting of amino acid residues at positions 1 to 19 is the signal sequence, the amino acid sequence consisting of amino acid residues at positions 20 to 139 is the variable region, and the amino acid sequence consisting of amino acid residues at positions 140 to 469 is the constant region.

[0337] It should be further noted that in the light chain sequence shown in SEQ ID NO: 31 in the sequence listing, the amino acid sequence consisting of amino acid residues at positions 1 to 20 is the signal sequence, the amino acid sequence consisting of amino acid residues at positions 21 to 129 is the variable region, and the amino acid sequence consisting of amino acid residues at positions 130 to 234 is the constant region.

[0338] The amino acid sequence of the heavy chain of the c151D antibody shown in SEQ ID NO: 25 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 24 in the sequence listing. The nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 57 of the nucleotide sequence shown in SEQ ID NO: 24 in the sequence listing encodes the heavy chain signal sequence of the c151D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 408 therein encodes the heavy chain variable region of the c151D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 409 to 1398 therein encodes the heavy chain constant region of the c151D antibody.

[0339] In addition, the amino acid sequence of the light chain of the c151D antibody shown in SEQ ID NO: 27 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 26 in the sequence listing. The nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 60 of the nucleotide sequence shown in SEQ ID NO: 26 in the sequence listing encodes the light chain signal sequence of the c151D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387 therein encodes the light chain variable region of the c151D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702 therein encodes the light chain constant region of the c151D antibody.

[0340] In addition, the amino acid sequence of the heavy chain of the c198D antibody shown in SEQ ID NO: 29 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 28 in the sequence listing. The nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 57 of the nucleotide sequence shown in SEQ ID NO: 28 in the sequence listing encodes the heavy chain signal sequence of the c198D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 417 therein encodes the heavy chain variable region of the c198D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 418 to 1407 therein encodes the heavy chain constant region of the c198D antibody.

[0341] Further, the amino acid sequence of the light chain of the c198D antibody shown in SEQ ID NO: 31 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 30 in the sequence listing. The nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 60 of the nucleotide sequence shown in SEQ ID NO: 30 in the sequence listing encodes the light chain signal sequence of the c198D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387 therein encodes the light chain variable region of the c198D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702 therein encodes the light chain constant region of the c198D antibody.

[0342] Examples of humanized antibodies include humanized antibodies formed by incorporating only the complementarity determining region (CDR) into a human-derived antibody (see Nature (1986) 321, pp. 522-525), and humanized antibodies formed by transplanting some amino acid residues in the framework as well as CDR sequences into a human antibody according to the CDR grafting method (International Publication No. WO90 / 07861).

[0343] However, the humanized antibody derived from the 151D antibody is not limited to a specific humanized antibody as long as it retains all 6 CDR sequences of the 151D antibody and has anti-tumor activity.

[0344] It should be noted that the heavy chain variable region of the 151D antibody has CDRH1 (GFTFSNYYMA) consisting of an amino acid sequence consisting of amino acid residues at positions 26 to 35 of SEQ ID NO: 15 in the sequence listing, CDRH2 (SIGTVGGNTY) consisting of an amino acid sequence consisting of amino acid residues at positions 50 to 59 of SEQ ID NO: 15 therein, and CDRH3 (EDYGGFPH) consisting of an amino acid sequence consisting of amino acid residues at positions 99 to 106 of SEQ ID NO: 15 therein.

[0345] In addition, the light chain variable region of the 151D antibody has CDRL1 (KASQNVGTNVD) consisting of an amino acid sequence consisting of amino acid residues at positions 24 to 34 of SEQ ID NO: 17 in the sequence listing, CDRL2 (GASNRYT) consisting of an amino acid sequence consisting of amino acid residues at positions 50 to 56 of SEQ ID NO: 17 therein, and CDRL3 (LQYKYNPYT) consisting of an amino acid sequence consisting of amino acid residues at positions 89 to 97 of SEQ ID NO: 17 therein.

[0346] In addition, the heavy chain variable region of the 198D antibody has CDRH1 (GFSLTSFHVS) consisting of an amino acid sequence consisting of amino acid residues at positions 26 to 35 of SEQ ID NO: 19 in the sequence listing, CDRH2 (TISSGGGTY) consisting of an amino acid sequence consisting of amino acid residues at positions 50 to 58 of SEQ ID NO: 19 therein, and CDRH3 (ISGWGHYYVMDV) consisting of an amino acid sequence consisting of amino acid residues at positions 98 to 109 of SEQ ID NO: 19 therein.

[0347] In addition, the light chain variable region of the 198D antibody has CDRL1 (QASEDIYSGLA) consisting of an amino acid sequence consisting of amino acid residues at positions 24 to 34 of SEQ ID NO: 21 in the sequence listing, CDRL2 (GAGSLQD) consisting of an amino acid sequence consisting of amino acid residues at positions 50 to 56 of SEQ ID NO: 21 therein, and CDRL3 (QQGLKFPLT) consisting of an amino acid sequence consisting of amino acid residues at positions 89 to 97 of SEQ ID NO: 21 therein.

[0348] Specific examples of humanized antibodies of rat antibody 151D may be any given combination of the following: a heavy chain comprising a heavy chain variable region consisting of any of the following: (1) an amino acid sequence consisting of the amino acid residues at positions 20 to 136 shown in SEQ ID NO: 33 (h151D-H1) or 35 (h151D-H4) in the sequence listing, (2) an amino acid sequence having at least 95% or more homology with the framework region sequence excluding each CDR sequence in the sequence of the above (1), and (3) an amino acid sequence comprising a deletion, substitution or addition of one or several amino acids in the framework region sequence excluding each CDR sequence in the sequence of the above (1); and a light chain comprising a light chain variable region consisting of any of the following: (4) an amino acid sequence consisting of the amino acid residues at positions 20 to 136 shown in SEQ ID NO: 33 (h151D-H1) or 35 (h151D-H4) in the sequence listing. An amino acid sequence consisting of the amino acid residues at positions 21 to 129 shown in NO: 37 (h151D-L1) or 39 (h151D-L1), (5) an amino acid sequence having at least 95% or more homology with the framework region sequence excluding each CDR sequence in the sequence of the above (4), and (6) an amino acid sequence comprising a deletion, substitution or addition of one or more amino acids in the framework region sequence excluding each CDR sequence in the sequence of the above (4).

[0349] On the other hand, specific examples of the humanized antibody of rat antibody 198D may be any given combination of the following: a heavy chain comprising a heavy chain variable region consisting of any of the following: (1) an amino acid sequence consisting of the amino acid residues at positions 20 to 139 shown in SEQ ID NO: 41 (h198D-H3) in the sequence listing, (2) an amino acid sequence having at least 95% or more homology with the framework region sequence excluding each CDR sequence in the sequence of the above (1), and (3) an amino acid sequence comprising a deletion, substitution or addition of one or several amino acids in the framework region sequence excluding each CDR sequence in the sequence of the above (1); and a light chain comprising a light chain variable region consisting of any of the following: (4) an amino acid sequence consisting of SEQ ID NO: 41 (h198D-H3) in the sequence listing. An amino acid sequence consisting of the amino acid residues at positions 21 to 129 shown in IDNO: 43 (h198D-L4), (5) an amino acid sequence having at least 95% or more homology with the framework region sequence excluding each CDR sequence in the sequence of (4) above, and (6) an amino acid sequence comprising a deletion, substitution or addition of one or more amino acids in the framework region sequence excluding each CDR sequence in the sequence of (4) above.

[0350] Examples of preferred combinations of the heavy chain and light chain of the humanized 151D antibody may include: an antibody consisting of a heavy chain having a heavy chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 20 to 136 shown in SEQ ID NO: 33, and a light chain having a light chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 21 to 129 shown in SEQ ID NO: 37; and an antibody consisting of a heavy chain having a heavy chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 20 to 136 shown in SEQ ID NO: 35, and a light chain having a light chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 21 to 129 shown in SEQ ID NO: 39.

[0351] More preferred examples of their combination may include: an antibody (h151D-H1L1) consisting of a heavy chain having the amino acid sequence shown in SEQ ID NO: 33 and a light chain having the amino acid sequence shown in SEQ ID NO: 37; and an antibody (h151D-H4L4) consisting of a heavy chain having the amino acid sequence shown in SEQ ID NO: 35 and a light chain having the amino acid sequence shown in SEQ ID NO: 39.

[0352] An example of a preferred combination of the heavy chain and light chain of the humanized 198D antibody can be an antibody consisting of a heavy chain having a heavy chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 20 to 139 shown in SEQ ID NO:41, and a light chain having a light chain variable region consisting of an amino acid sequence consisting of amino acid residues at positions 21 to 129 shown in SEQ ID NO:43.

[0353] An example of a more preferred combination thereof may be an antibody (h198D-H3L4) consisting of a heavy chain having the amino acid sequence shown in SEQ ID NO: 41 and a light chain having the amino acid sequence shown in SEQ ID NO: 43.

[0354] By combining sequences showing a high degree of homology to the above-mentioned heavy chain amino acid sequence and light chain amino acid sequence, antibodies having cytotoxicity equivalent to each of the above-mentioned antibodies can be selected. This homology is generally 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 99% or more homology. In addition, by combining amino acid sequences containing substitutions, deletions or additions of one or more amino acid residues with respect to the amino acid sequence of the heavy chain or light chain with each other, antibodies having cytotoxicity equivalent to each of the above-mentioned antibodies can also be selected.

[0355] It should be noted that the term “several” used in the present specification means 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2.

[0356] The amino acid substitution in this specification is preferably a conservative amino acid substitution. Conservative amino acid substitution is a substitution that occurs in an amino acid group associated with certain amino acid side chains. Preferred amino acid groups are as follows: acidic group = aspartic acid and glutamic acid; basic group = lysine, arginine and histidine; non-polar group = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine and tryptophan; and uncharged polar group = glycine, asparagine, glutamine, cysteine, serine, threonine and tyrosine. Other preferred amino acid groups are as follows: aliphatic hydroxyl = serine and threonine; amide-containing group = asparagine and glutamine; aliphatic group = alanine, valine, leucine and isoleucine; and aromatic group = phenylalanine, tryptophan and tyrosine. Such amino acid substitutions are preferably carried out within the range that the properties of the material with the original amino acid sequence are not impaired.

[0357] The homology between two types of amino acid sequences can be determined using the default parameters of the Blast algorithm version 2.2.2 (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs," Nucleic Acids Res. 25: 3389-3402). The Blast algorithm can also be used by accessing www.ncbi.nlm.nih.gov / blast via the Internet. It should be noted that the homology between the nucleotide sequence of an antibody of the present invention and the nucleotide sequence of another antibody can also be determined using the Blast algorithm.

[0358] In the amino acid sequence of the humanized 151D antibody heavy chain shown in SEQ ID NO: 33 or 35 in the sequence listing, the amino acid sequence consisting of amino acid residues at positions 1 to 19 is a signal sequence, the amino acid sequence consisting of amino acid residues at positions 20 to 136 is a variable region, and the amino acid sequence consisting of amino acid residues at positions 137 to 466 is a constant region.

[0359] In addition, in the amino acid sequence of the humanized 151D antibody light chain shown in SEQ ID NO: 37 or 39 in the sequence listing, the amino acid sequence consisting of amino acid residues at positions 1 to 20 is a signal sequence, the amino acid sequence consisting of amino acid residues at positions 21 to 129 is a variable region, and the amino acid sequence consisting of amino acid residues at positions 130 to 234 is a constant region.

[0360] In addition, in the amino acid sequence of the humanized 198D antibody heavy chain shown in SEQ ID NO:41 in the sequence listing, the amino acid sequence consisting of amino acid residues at positions 1 to 19 is a signal sequence, the amino acid sequence consisting of amino acid residues at positions 20 to 139 is a variable region, and the amino acid sequence consisting of amino acid residues at positions 140 to 469 is a constant region.

[0361] In addition, in the amino acid sequence of the humanized 198D antibody light chain shown in SEQ ID NO:43 in the sequence listing, the amino acid sequence consisting of amino acid residues at positions 1 to 20 is a signal sequence, the amino acid sequence consisting of amino acid residues at positions 21 to 129 is a variable region, and the amino acid sequence consisting of amino acid residues at positions 130 to 234 is a constant region.

[0362] The amino acid sequence of the heavy chain of the humanized 151D antibody shown in SEQ ID NO: 33 or 35 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 32 or 34 in the sequence listing, respectively. In addition, the sequence of SEQ ID NO: 33 is shown in Fig.21 The sequence of SEQ ID NO: 35 is shown in Fig.23 The sequence of SEQ ID NO: 32 is shown in Fig.31 and the sequence of SEQ ID NO: 34 is shown in Fig.33 middle.

[0363] The nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 57 in each nucleotide sequence encodes the heavy chain signal sequence of the humanized 151D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 408 therein encodes the heavy chain variable region of the humanized 151D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 409 to 1398 therein encodes the heavy chain constant region of the humanized 151D antibody.

[0364] The amino acid sequence of the humanized 198D antibody heavy chain shown in SEQ ID NO: 41 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 40 in the sequence listing. Fig.25 and the sequence of SEQ ID NO: 40 is shown in Fig.35 middle.

[0365] The nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 57 in the above nucleotide sequence encodes the heavy chain signal sequence of the humanized 198D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 417 therein encodes the heavy chain variable region of the humanized 198D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 418 to 1407 therein encodes the heavy chain constant region of the humanized 198D antibody.

[0366] The amino acid sequence of the light chain of the humanized 151D antibody shown in SEQ ID NO: 37 or 39 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 36 or 38 in the sequence listing, respectively. In addition, the sequence of SEQ ID NO: 37 is shown in Fig. 22 The sequence of SEQ ID NO: 39 is shown in Fig.24 The sequence of SEQ ID NO: 36 is shown in Fig.32 and the sequence of SEQ ID NO: 38 is shown in Fig.34 middle.

[0367] The nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 60 in each nucleotide sequence encodes the light chain signal sequence of the humanized 151D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387 therein encodes the light chain variable region of the humanized 151D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702 therein encodes the light chain constant region of the humanized 151D antibody.

[0368] The amino acid sequence of the humanized 198D antibody light chain shown in SEQ ID NO: 43 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 42 in the sequence listing. In addition, the sequence of SEQ ID NO: 43 is shown in Fig.26 and the sequence of SEQ ID NO: 42 is shown in Fig.36 middle.

[0369] The nucleotide sequence consisting of nucleotides at nucleotide positions 1 to 60 in the above nucleotide sequence encodes the light chain signal sequence of the humanized 198D antibody, the nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387 therein encodes the light chain variable region of the humanized 198D antibody, and the nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702 therein encodes the light chain constant region of the humanized 198D antibody.

[0370] The homology between these nucleotide sequences and the nucleotide sequences of other antibodies can also be determined using the Blast algorithm.

[0371] A further example of the antibody of the present invention may be a human antibody that binds to the same epitope to which the humanized 151D antibody or the humanized 198D antibody also binds. An anti-GARP human antibody means a human antibody having only the gene sequence of an antibody derived from a human chromosome. An anti-GARP human antibody can be obtained by the above method.

[0372] If a newly generated human antibody binds to a portion of a peptide or a portion of a three-dimensional structure to which a humanized 151D antibody or a humanized 198D antibody binds, it can be determined that the human antibody binds to the same epitope to which the humanized 151D antibody or the humanized 198D antibody binds. In addition, by confirming that the human antibody competes with the humanized 151D antibody or the humanized 198D antibody for its binding to GARP (i.e., the human antibody interferes with the binding of the humanized 151D antibody or the humanized 198D antibody to GARP), it can be determined that the human antibody binds to the epitope to which the humanized 151D antibody or the humanized 198D antibody binds, even if the specific sequence or structure of the epitope has not yet been determined. If it is confirmed that the human antibody in question binds to the same epitope to which the humanized 151D antibody or the humanized 198D antibody binds, it is strongly expected that the human antibody should have cytotoxicity equivalent to that of the humanized 151D antibody or the humanized 198D antibody.

[0373] The chimeric antibody, humanized antibody or human antibody obtained by the above method is evaluated in terms of binding activity to the antigen by the method described later in Examples etc., and thus a preferred antibody can be selected.

[0374] The present invention also includes the modification of antibodies. The term "modification" is used herein to refer to the antibody of the present invention that is chemically or biologically modified. The example of this chemical modification includes the combination of chemical moieties with amino acid backbones and the chemical modification of N-linked or O-linked carbohydrate chains. The example of this biological modification includes antibodies that have undergone post-translational modification (e.g., N-linked or O-linked sugar chain modification, N-terminal or C-terminal processing, deamidation, isomerization of aspartic acid and oxidation of methionine), and antibodies to which methionine residues have been added to its N-terminal due to the use of prokaryotic host cells for expression. In addition, this modification also includes a labeled antibody that enables detection or separation of the antibody of the present invention or antigen, such as, for example, enzyme-labeled antibodies, fluorescently labeled antibodies and affinity-labeled antibodies. This modification of the antibody of the present invention can be used to improve the stability and retention of the original antibody of the present invention in blood, the reduction of antigenicity, the detection or separation of this antibody or antigen, etc.

[0375] In addition, by regulating the sugar chain modification (glycosylation, defucosylation, etc.) bound to the antibody of the present invention, antibody-dependent cellular toxicity can be enhanced. As a technique for regulating the sugar chain modification of an antibody, those described in WO99 / 54342, WO2000 / 61739, WO2002 / 31140, etc. are known, but the technique is not limited to these. The antibody of the present invention also includes an antibody in which the above-mentioned sugar chain modification has been regulated.

[0376] After the antibody gene has been isolated, the gene is introduced into a suitable host to produce the antibody using a suitable combination of a host and an expression vector. A specific example of an antibody gene can be a combination of a gene encoding the heavy chain sequence of the antibody described in this specification and a gene encoding the light chain sequence of the antibody described therein. After host cell transformation, the heavy chain sequence gene and the light chain sequence gene can be inserted into a single expression vector, or these genes can be alternatively each inserted into different expression vectors.

[0377] When eukaryotic cells are used as hosts, animal cells, plant cells or eukaryotic microorganisms can be used. Examples of animal cells include mammalian cells, such as COS cells (Gluzman, Y., Cell (1981) 23, pp. 175-182, ATCC CRL-1650), mouse fibroblasts NIH3T3 (ATCC No. CRL-1658), and dihydrofolate reductase-deficient cell lines of Chinese hamster ovary cells (CHO cells, ATCC CCL-61) (Urlaub, G. and Chasin, LA Proc. Natl. Acad. Sci. USA (1980) 77, pp. 4126-4220).

[0378] When a prokaryotic cell is used as the host, for example, Escherichia coli or Bacillus subtilis can be used.

[0379] The target antibody gene is introduced into these cells for transformation, and the transformed cells are then cultured in vitro to obtain the antibody. In the above-mentioned culture, there are cases where the yield is different depending on the sequence of the antibody, and therefore, the yield can be used as an indicator to select an antibody that is easy to produce as a medicament from antibodies with equivalent binding activity. Accordingly, the antibody of the present invention also includes an antibody obtained by the above-mentioned method for producing an antibody, characterized in that it includes a step of culturing the transformed host cell and a step of collecting the target antibody from the culture obtained in the above-mentioned step.

[0380] It is known that the lysine residue at the carboxyl terminus of the heavy chain of antibodies produced in cultured mammalian cells is deleted (Journal of Chromatography A, 705: 129-134 (1995)), and in addition, it is known that two amino acid residues, glycine and lysine, at the carboxyl terminus of the heavy chain are deleted, and the proline residue located at the carboxyl terminus is newly amidated (Analytical Biochemistry, 360: 75-83 (2007)). However, such deletions and modifications of these heavy chain sequences have no effect on the antigen binding activity and effector functions (complement activation, antibody-dependent cellular cytotoxicity, etc.) of the antibody. Accordingly, the present invention also includes antibodies that have undergone the above modifications, and specific examples of the antibodies include deletion mutants comprising a deletion of 1 or 2 amino acids at the carboxyl terminus of the heavy chain, and deletion mutants formed by amidating the above deletion mutants (e.g., heavy chains in which the proline residue at the carboxyl terminal site is amidated). However, deletion mutants involving deletions at the carboxyl terminus of the heavy chain of the antibody according to the present invention are not limited to the above-mentioned deletion mutants, as long as they maintain antigen binding activity and effector function. The two heavy chains constituting the antibody according to the present invention can be any one of the heavy chains selected from the full-length antibody and the above-mentioned deletion mutants, or a combination of any two of the above-mentioned groups. The ratio of individual deletion mutants can be affected by the type and culture conditions of the cultured mammalian cells producing the antibody according to the present invention. The main component of the antibody according to the present invention can be an antibody in which one amino acid residue is deleted at each carboxyl terminus of the two heavy chains.

[0381] Examples of the isotype of the antibody of the present invention may include IgG (IgG1, IgG2, IgG3, and IgG4). Among them, IgG1 and IgG2 are preferred.

[0382] Examples of general functions of antibodies may include antigen binding activity, activity of neutralizing antigen activity, activity of enhancing antigen activity, ADCC activity, antibody-dependent cellular phagocytosis (ADCP) activity, and complement-dependent cytotoxicity (CDC) activity. The function of the antibody according to the present invention is binding activity with GARP, preferably ADCC activity, and more preferably cytotoxicity (anti-tumor activity) caused by ADCC-mediated inhibition of Treg function. In addition, the antibody of the present invention may have ADCP activity and / or CDC activity, as well as ADCC activity. In particular, with respect to agents comprising existing anti-tumor antibodies, it has been reported that the agents act directly on tumor cells to block growth signals, they act directly on tumor cells to induce cell death signals, they suppress angiogenesis, they cause ADCC activity via NK cells, and they induce CDC activity via complement to suppress the growth of tumor cells (J Clin Oncol 28: 4390-4399. (2010), Clin Cancer Res; 16 (1); 11-20. (2010)). However, with regard to the ADCP activity of the anti-GARP antibody of the present invention according to the present application, at least the present inventors are not aware that ADCP activity has been reported as an activity of a pharmaceutical agent comprising an existing anti-GARP anti-tumor antibody.

[0383] The antibody of the present invention may be an antibody that has been multimerized to enhance affinity for an antigen. The antibody to be multimerized may be a single type of antibody, or multiple antibodies that recognize multiple epitopes of a single antigen. Examples of methods for multimerizing antibodies may include the binding of an IgG CH3 domain to two scFvs (single-chain antibodies), the binding of an antibody to streptavidin, and the introduction of a helix-turn-helix motif.

[0384] The antibody of the present invention may also be a polyclonal antibody, which is a mixture of multiple types of anti-GARP antibodies having different amino acid sequences. An example of a polyclonal antibody may be a mixture of multiple types of antibodies having different CDRs. As such a polyclonal antibody, an antibody obtained by culturing a mixture of cells producing different antibodies and then purifying the obtained culture may be used (see WO2004 / 061104).

[0385] As modification of the antibody, antibodies bound to various types of molecules such as polyethylene glycol (PEG) can be used.

[0386] The antibody of the present invention may further be a conjugate (immunoconjugate) formed by such an antibody and another drug. Such an antibody may be, for example, an antibody bound to a radioactive substance or a compound having a pharmacological effect (Nature Biotechnology (2005) 23, pp. 1137-1146). Examples of such antibodies may include indium (111 Indium ( 111 In) Capromab pendetide), Technetium ( 99m Technetium (Tc) 99m Tc) Nofetumomab merpentan), indium ( 111 Indium ( 111 In) Ibritumomab), Yttrium ( 90 Y) Ibritumomab (Yttrium 90 Ibritumomab) and iodine ( 131 I) Tositumomab (Iodine ( 131 I) Tositumomab).

[0387] 3. Drugs containing anti-GARP antibodies

[0388] Since the antibody obtained by the method described in the above section “2. Production of anti-GARP antibody” exhibits cytotoxicity to Tregs, it can be used as a medicament, and particularly as a therapeutic agent for cancer and infectious diseases (particularly malaria and HIV infection).

[0389] Cytotoxicity elicited by antibodies in vitro can be measured based on activity in suppressing the proliferative response of cells.

[0390] For example, a cancer cell line overexpressing GARP is cultured, and antibodies with different concentrations are added to the culture system. Thereafter, the inhibitory activity of the antibodies on focus formation, colony formation, and sphere growth can be measured.

[0391] The in vivo therapeutic effect of an antibody on cancer in an experimental animal can be measured, for example, by administering the antibody to nude mice into which a tumor cell line overexpressing GARP has been transplanted, and then measuring changes in the cancer cells.

[0392] Examples of cancer types may include lung cancer, renal cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, esophageal cancer, and blood cancer. However, the cancer type is not limited to the above examples as long as the cancer cell as a therapeutic target expresses GARP.

[0393] As a substance used in a medicament acceptable to the pharmaceutical composition of the present invention, a substance which is non-toxic to a subject to which the pharmaceutical composition is to be administered in terms of applied dose or applied concentration is preferred.

[0394] The pharmaceutical composition of the present invention may contain a drug substance for changing or maintaining pH, osmotic pressure, viscosity, transparency, color, isotonicity, sterility, stability, solubility, sustained release rate, absorbability and permeability. Examples of drug substances may include, but are not limited to, amino acids such as glycine, alanine, glutamine, asparagine, arginine or lysine; antibacterial agents; antioxidants such as ascorbic acid, sodium sulfate or sodium bisulfite; buffers such as phosphate, citrate or borate buffer, sodium bicarbonate or Tris-HCl solution; fillers such as mannitol or glycine; chelating agents such as ethylenediaminetetraacetic acid (EDTA); complexing agents such as caffeine, polyvinylpyrrolidone, β-cyclodextrin or hydroxypropyl-β-cyclodextrin; bulking agents such as glucose, mannose or dextrin; other carbohydrates such as monosaccharides or disaccharides; colorants; flavoring agents; diluents; emulsifiers; hydrophilic polymers such as polyvinylpyrrolidone; Low molecular weight polypeptide; salt-forming counter ions; preservatives such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenylethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide; solvents such as glycerol, propylene glycol or polyethylene glycol; sugar alcohols such as mannitol or sorbitol; polysorbates such as suspending agents, dehydrated sorbitan esters, polysorbate 20 or polysorbate 80; surfactants such as Triton, tromethamine, lecithin or cholesterol; stability enhancers such as sucrose or sorbitol; suspending agents; elasticity enhancers such as sodium chloride, potassium chloride, mannitol or sorbitol; transport agents; excipients; and / or pharmaceutical adjuvants. Such drug substances are preferably added to the anti-GARP antibody in an amount of 0.001 to 100 times, particularly 0.1 to 10 times as high as the weight of the anti-GARP antibody. The preferred composition of the pharmaceutical composition in the preparation can be appropriately determined by those skilled in the art according to the target disease, the intended administration route, and the like.

[0395] The excipient or carrier in the pharmaceutical composition can be a liquid or a solid. Suitable excipients or carriers can be water for injection, normal saline, artificial cerebrospinal fluid or other substances commonly used for parenteral administration. Neutral saline or normal saline containing serum albumin can also be used as a carrier. The pharmaceutical composition can include a Tris buffer with a pH of 7.0-8.5, an acetate buffer with a pH of 4.0-5.5 or a citrate buffer with a pH of 3.0-6.2. In addition, these buffers can also include sorbitol or other compounds.

[0396] Examples of the pharmaceutical composition of the present invention may include a pharmaceutical composition comprising an anti-GARP antibody, and a pharmaceutical composition comprising an anti-GARP antibody and at least one cancer therapeutic agent. The pharmaceutical composition of the present invention is prepared as a drug having a selected composition and necessary purity in the form of a freeze-dried product or a liquid. Such a pharmaceutical composition comprising an anti-GARP antibody, and a pharmaceutical composition comprising an anti-GARP antibody and at least one cancer therapeutic agent can also be molded into a freeze-dried product containing a suitable excipient such as sucrose.

[0397] The cancer therapeutic agent included together with the anti-GARP antibody in the above-mentioned pharmaceutical composition can be administered to an individual simultaneously, separately or continuously together with the anti-GARP antibody. In other ways, the cancer therapeutic agent and the anti-GARP antibody can be administered to the subject at different administration intervals. Examples of such cancer therapeutic agents may include abraxane, carboplatin, cisplatin, gemcitabine, irinotecan (CPT-11), paclitaxel, pemetrexed, sorafenib, vinblastine, drugs described in International Publication No. WO2003 / 038043, LH-RH analogs (leuprolide, goserelin, etc.), estramustine phosphate, estrogen antagonists (tamoxifen, raloxifene, etc.) and aromatase inhibitors (anastrozole, letrozole, exemestane, etc.). However, examples of cancer therapeutic agents are not limited to the above-mentioned drugs, as long as the agent has anti-tumor activity.

[0398] The subject as a target for administration is not particularly limited. It is preferably a mammal, and more preferably a human.

[0399] The pharmaceutical composition of the present invention can be prepared for parenteral administration, or for gastrointestinal absorption involving oral administration. The composition and concentration of the preparation can be determined according to the method of administration. Regarding the affinity of the anti-GARP antibody contained in the pharmaceutical composition of the present invention for GARP, that is, the dissociation constant (Kd value) of the anti-GARP antibody for GARP, as the affinity increases (that is, the Kd value is low), the pharmaceutical composition can show a pharmaceutical effect even if the dose applied to humans is reduced. Based on these results, the dosage of the pharmaceutical composition of the present invention for humans can also be determined. When a human-type anti-GARP antibody is administered to a human, the antibody can be administered once at a dose of about 0.001 to 100 mg / kg or several times at intervals of 1 to 180 days. Examples of the form of the pharmaceutical composition of the present invention may include injections, suppositories, nasal agents, sublingual agents, and percutaneous absorption agents including drips.

[0400] Hereinafter, the present invention will be specifically described in the following examples. However, these examples are not intended to limit the scope of the present invention. Example

[0401] In the following examples, unless otherwise specified, individual operations concerning genetic manipulation were performed according to the methods described in "Molecular Cloning" (Sambrook, J., Fritsch, EF and Maniatis, T., published by Cold Spring Harbor Laboratory Press in 1989) or other methods described in experimental manuals used by those skilled in the art, or when commercially available reagents or kits were used, the examples were performed according to the instructions contained in the commercially available products.

[0402] Hereinafter, the present invention will be specifically described in the following examples. However, these examples are not intended to limit the scope of the present invention.

[0403] Example 1: Obtaining Antibodies

[0404] 1)-1 Isolation of anti-GARP Fab by panning in phage display

[0405] The n-CoDeR Fab phage library (BioInvent) was used to isolate Fabs that bind to GARP. GARP (R&D Systems) was biotinylated using the EZ-Link NHS-Chromogenic-Biotin reagent (Thermo Scientific). For liquid phase panning, the biotinylated GARP was immobilized on Dynabeads Streptavidin M-280 (Life Technologies), and then phages were added. Unbound phages were removed by a washing operation using a magnet (DynaMag-2, Life Technologies). Thereafter, GARP-bound phages were collected by treating them with trypsin (Sigma-Aldrich), and then amplified using E. coli. A total of three panning operations were performed, and the DNA fragment encoding the Fab was cut from the polyclonal phagemid using restriction enzymes and then loaded onto an expression vector for E. coli. Thereafter, E. coli TOP10F' (Life Technologies) was transformed with the expression vector, and the Fab was then allowed to express in the presence of IPTG (Sigma-Aldrich). The obtained Fabs were subjected to screening by ELISA.

[0406] 1)-2 Screening of GARP binding Fab by ELISA

[0407] 50 μL of GARP diluted to 2 μg / mL with PBS (0.01 M phosphate buffered saline (pH 7.4) containing 0.138 M sodium chloride and 0.0027 M potassium chloride; Sigma-Aldrich) was added to each well of a 384-well Maxi-sorp plate (black, Nunc), and then it was incubated overnight at 4°C for coating the plate. Alternatively, 50 μL of NeutrAvidin (Life Technologies) diluted to 1 μg / mL with PBS was added to this 384-well Maxi-sorp plate for coating the plate (by incubating overnight at 4°C). Thereafter, the plate was washed three times with ELISA buffer (PBS (Sigma-Aldrich) supplemented with 0.05% Tween-20 (Bio-RAD)), and then biotinylated GARP (1 pmol / 50 μL PBS / well) was added thereto, followed by incubation at room temperature for 1 hour with mixing. The plate was washed three times with ELISA buffer, then blocked with Blocker Casein (ThermoScientific), and further washed three times with ELISA buffer. Thereafter, culture supernatant containing Fab produced by E. coli was added, and the plate was then incubated at room temperature with mixing for 1 hour. The plate was washed three times with ELISA buffer, and 50 μL of 2500-fold diluted horseradish peroxidase (HRP)-labeled anti-human F(ab')2 antibody (R&D Systems) was added. The plate was further incubated at room temperature with mixing for 1 hour. The reaction mixture was washed three times with ELISA buffer, and SuperSignal Pico ELISA chemiluminescent substrate (Thermo Scientific) was added to the wells. Ten minutes later, chemiluminescence was measured using a plate reader (Envision 2104 Multilabel Reader, Perkin Elmer), and Fab bound to GARP was separated.

[0408] 1)-3 Determination of nucleotide sequences of ELISA-positive clones

[0409] The heavy and light chain variable regions of ELISA-positive clones (105F and 110F) were analyzed by the dye terminator method (BigDye (registered trademark) Terminator v3.1, Life Technologies). The sequences of the primary primers used in sequencing are as follows.

[0410] Primer A: 5'-GAA ACA GCT ATG AAA TAC CTA TTG C-3' (SEQ ID NO: 10)

[0411] Primer B: 5'-GCC TGA GCA GTG GAA GTC C-3' (SEQ ID NO: 11)

[0412] Primer C: 5'-TAG GTA TTT CAT TAT GAC TGT CTC-3' (SEQ ID NO: 12)

[0413] Primer D: 5′-CCC AGT CAC GAC GTT GTA AAA CG-3′ (SEQ ID NO: 13).

[0414] As a result of the above analysis, the nucleotide sequences of the variable regions of the 105F antibody and 110F antibody genes were determined.

[0415] The nucleotide sequence of the heavy chain variable region of the 105F antibody is a sequence consisting of nucleotides at nucleotide positions 1 to 354 of the nucleotide sequence shown in SEQ ID NO: 6 in the sequence listing, and the nucleotide sequence of the light chain variable region of the 105F antibody is a sequence consisting of nucleotides at nucleotide positions 1 to 336 of the nucleotide sequence shown in SEQ ID NO: 7 in the sequence listing.

[0416] The nucleotide sequence of the heavy chain variable region of the 110F antibody is a sequence consisting of nucleotides at nucleotide positions 1 to 369 of the nucleotide sequence shown in SEQ ID NO: 8 in the sequence listing, and the nucleotide sequence of the light chain variable region of the 110F antibody is a sequence consisting of nucleotides at nucleotide positions 1 to 333 of the nucleotide sequence shown in SEQ ID NO: 9 in the sequence listing.

[0417] 1)-4: Preparation of full-length IgG and expression and purification of IgG

[0418] Full-length IgG of ELISA-positive clones including 105F and 110F was prepared by the following method.

[0419] The nucleotide sequence encoding the Fab was determined, and thereafter the nucleotide sequences corresponding to the heavy chain and light chain variable regions of each antibody specified in 1)-3 above were designated.

[0420] According to a common method, the nucleotide sequence of the variable region of the above heavy chain is linked to the nucleotide sequence encoding the constant region of the human IgG1 heavy chain (CH1 + Fc region: the amino acid sequence at amino acid positions 119 to 448 in the amino acid sequence shown in SEQ ID NO: 2 in the sequence list), and the nucleotide sequence of the variable region of the above light chain is also linked to the nucleotide sequence encoding the constant region of the human IgG1 light chain (CL: the amino acid sequence at amino acid positions 113 to 217 in the amino acid sequence shown in SEQ ID NO: 3 in the sequence list). Thereafter, the resulting conjugate is inserted into an expression vector for animal cells, such as pcDNA3.3 (Invitrogen), to construct an IgG expression vector for animal cells.

[0421] The nucleotide sequence of the constructed IgG expression vector was analyzed again, and it was confirmed that the nucleotide sequence of the full-length heavy chain of the 105F antibody was the nucleotide sequence shown in SEQ ID NO: 6 in the sequence listing, and the nucleotide sequence of the full-length light chain of the 105F antibody was the nucleotide sequence shown in SEQ ID NO: 7 in the sequence listing.

[0422] It was also confirmed that the nucleotide sequence of the full-length heavy chain of the 110F antibody was the nucleotide sequence shown in SEQ ID NO: 8 in the sequence listing, and the nucleotide sequence of the full-length light chain of the 110F antibody was the nucleotide sequence shown in SEQ ID NO: 9 in the sequence listing.

[0423] Furthermore, based on the above nucleotide sequence, the amino acid sequences of the full-length heavy chain and full-length light chain of the 105F antibody encoded by the nucleotide sequence, and the amino acid sequences of the full-length heavy chain and full-length light chain of the 110F antibody encoded by the nucleotide sequence were determined.

[0424] The amino acid sequence of the heavy chain of the 105F antibody is the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, and the amino acid sequence of the light chain thereof is the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing.

[0425] The amino acid sequence of the heavy chain of the 110F antibody is the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing, and the amino acid sequence of the light chain thereof is the amino acid sequence shown in SEQ ID NO: 5 in the sequence listing.

[0426] IgG of the 105F antibody or 110F antibody was transiently expressed by inserting the above-mentioned IgG expression vector for animal cells into FreeStyle 293F cells (Life Technologies), and then the resulting IgG was purified using a protein A affinity column (HiTrap Mab Select SuRe, GE Healthcare) if necessary. Thereafter, the buffer in which the IgG was dissolved was replaced with PBS using Vivaspin 20 (7k MWCO, GE Healthcare), and the resultant was then subjected to the following steps “1)-5”.

[0427] 1)-5 Confirmation of the binding of purified IgG to GARP by ELISA

[0428] 100 μL of human GARP (R&D Systems, catalog number: 6055-LR) diluted to 1 μg / mL with PBS was added to each well of a 96-well Maxi-sorp plate (black, Nunc), and the plate was incubated overnight at 4° C. for coating the plate.

[0429] The plate was washed three times with ELISA buffer and then blocked with Blocker Casein for 1 hour at room temperature. The plate was washed three times with ELISA buffer, and 100 μL of 50 nM 105F antibody, 50 nM 110F antibody, 50 nM human IgG (Jackson Immuno Research), 50 nM mouse anti-GARP antibody (Plato-1, ENZO Life Science), or 50 nM mouse IgG (Jackson Immuno Research) was added to the wells, and the plate was incubated with mixing at room temperature for 1 hour.

[0430] The plate was washed three times with ELISA buffer. After that, 100 μL of HRP-labeled anti-human Fc antibody (R&D Systems) diluted 5000 times with PBS was added to the wells treated with 105F antibody, 110F antibody or human IgG. On the other hand, 100 μL of HRP-labeled anti-mouse Fc antibody (R&D Systems) diluted 5000 times with PBS was added to the wells treated with mouse anti-GARP antibody and mouse IgG. The plate was incubated at room temperature for 1 hour with mixing.

[0431] The plates were washed five times with ELISA buffer and 0.1 mL of SuperSignal Pico ELISA Chemiluminescent Substrate was added to the wells. Ten minutes later, chemiluminescence was measured using a plate reader (Envision 2104 Multilabel Reader, PerkinElmer).

[0432] The results showed that 105F antibody and 110F antibody bound to GARP as well as commercially available anti-GARP antibodies ( Fig.10 ).

[0433] Example 2: Binding to cells expressing antigen genes

[0434] As for the GARP expression vector, a cDNA clone of human GARP was purchased (Origene) and then cloned into a pcDNA3.1(+) vector (Invitrogen) according to a common method. Thereafter, its nucleotide sequence was confirmed.

[0435] The GARP expression vector and the pcDNA3.1 vector used as a control were each transfected into HEK-293T cells (ATCC: CRL-11268) using Lipofectamine 2000 (Invitrogen). The resulting cells were cultured overnight at 37°C in 5% CO2 in DMEM medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS, Hyclone). Thereafter, the cells were harvested from the plate by TrypLE Express (Invitrogen) treatment, and the cells were washed twice with MACS buffer (PBS containing 0.5% BSA and 2 mM EDTA; Miltenyi Biotec) and then suspended in the same solution as described above. The 105F antibody and control human IgG (ENZO Life Science) were each added to the cell suspension, and the cells were incubated at 4°C for 15 minutes. The cells were washed twice with MACS buffer. Fluorescein isothiocyanate (FITC)-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) was added and suspended, and the cells were further incubated at 4°C for 15 minutes. The cells were washed twice with MACS buffer, and then the cells were fixed with 1% PFA (prepared by paraformaldehyde 32% solution (ELECTRON MICROSCOPY SCIENCES)) and measured by using a flow cytometer (FACS Canto II; Becton Dickinson). The data were analyzed using Flowjo (TreeStar). Dead cells were removed from the analysis by gating out cells stained with HorizonFVS450 (Becton Dickinson). Thereafter, a histogram of FITC fluorescence intensity of live cells was generated.

[0436] In the case of HEK-293T cells transfected with the control vector alone, the histogram of fluorescence intensity for the 105F antibody was similar to that for the control IgG. On the other hand, in the case of HEK-293T cells expressing GARP, it was confirmed that the histogram for the 105F antibody shifted toward the strong fluorescence intensity side compared to the histogram for the control IgG ( Fig.11 ). According to the above results, it was found that the 105F antibody specifically binds to GARP expressed by HEK-293T cells.

[0437] Example 3: Binding to endogenous GARP expressing cells

[0438] 3)-1 Flow cytometry analysis using L428 cells

[0439] The fluorescently labeled 105F antibody was prepared using the Alexa Fluor 647 monoclonal antibody labeling kit (Invitrogen). L428 cells (obtained from DSMZ) were washed twice with MACS buffer and suspended in the same solution. The labeled 105F antibody was added to the cell suspension, and the cells were incubated at 4°C for 30 minutes. The cells were washed twice with MACS buffer, and then the cells were fixed with 1% PFA and measured by using a flow cytometer (FACS Canto II, BectonDickinson). The data were analyzed using FlowJo (TreeStar). Dead cells were removed by gating out cells stained with Horizon FVS450. Thereafter, a histogram of the FITC fluorescence intensity of live cells was generated. Compared with the histogram of the fluorescence intensity of L428 cells alone, the histogram of L428 cells to which the 105F antibody had been added shifted to the side of strong fluorescence intensity. Therefore, it was confirmed that the 105F antibody binds to GARP endogenously expressed by the cells ( Fig.12 ).

[0440] 3)-2 Flow cytometry analysis using human Treg

[0441] Peripheral blood mononuclear cells (PBMCs) from healthy subjects were isolated using Ficoll-Paque PLUS (GE Healthcare), and the isolated cells were plated at 2 × 10 6Cells / mL were seeded into RPMI1640 medium (Invitrogen) supplemented with 10% FBS in a low-adhesion 24-well plate (Costar) (hereinafter referred to as "RP-F10 medium"). Anti-CD3 antibody (BD Pharmingen) and anti-CD28 antibody (BD Pharmingen) were added to the wells, and the cells were cultured for 20 hours. Thereafter, the cells were suspended in FACS buffer (HBSS (Invitrogen) supplemented with 10 mM HEPES (Invitrogen), 2 mM EDTA (Invitrogen) and 2% FBS), and the labeled 105F antibody and AlexaFluor 647-labeled anti-GARP antibody (G14D9, eBioscience) prepared in 3)-1 above were added to the suspension. The cells were incubated on ice for 30 minutes. The cells were washed with FACS buffer, and a fixation / permeabilization working solution (eBioscience) was added. The cells were further incubated on ice for 30 minutes, and washed with permeabilization buffer (eBioscience). Thereafter, 2% rat serum (eBioscience) was added to the cells. The cells were incubated at room temperature for 15 minutes, and PE-labeled anti-Foxp3 antibody (eBioscience) was added, followed by further incubation at room temperature for 30 minutes. The cells were washed and fixed for 15 minutes or more at 4°C with a tissue fixative prepared by diluting 4% paraformaldehyde phosphate buffer solution (Wako Pure Chemical Industries, Ltd.) twice with D-PBS (Invitrogen). After washing the cells with FACS buffer, the cells were measured by using a flow cytometer (FACS Canto II; Becton Dickinson) and analyzed using FlowJo (Tree Star). As a result, the 105F antibody bound to FoxP3-positive Tregs ( Fig.13 ).

[0442] Example 4: Properties of anti-GARP antibodies

[0443] 4) -1 ADCC activity

[0444] 4) Preparation of -1-1 effector cells

[0445] PBMCs from healthy volunteers were isolated according to 3)-2 above. NK cells were purified from PBMCs using an NK cell isolation kit (MiltenyiBiotec). The obtained NK cells were incubated overnight in RP-F10 medium (Invitrogen) supplemented with 100 IU / mL rhIL-2 (Novartis). Thereafter, the number of viable cells was counted by trypan blue exclusion test, and then the cells were plated at 2 × 10 5 The cells were resuspended in RP-F10 medium at a cell density of 10 cells / mL and the obtained cells were used as effector cells.

[0446] 4)-1-2 Preparation of target cells

[0447] In RPMI1640 medium (Invitrogen) supplemented with 10% FBS, 30 μL (1110 kBq) of chromium-51 ( 51 Cr) and 0.6 × 10 6 The L428 cells described in Example 3)-1 were mixed, and the cells were incubated at 37°C in 5% CO2 for 2 hours to make the cells radioactively labeled. The labeled cells were washed three times with RPMI1640 medium (Invitrogen) supplemented with 10% FBS, and then the cells were incubated at 4 × 10 4 The cells were resuspended in the same medium at 100 cells / mL and the obtained cells were used as target cells.

[0448] 4) -1-3 51 Cr release assay

[0449] 105F antibody diluted with RP-F10 medium to a final concentration of 1, 10, 100 or 1000 ng / mL was dispensed into a 96-well U-bottom microplate (Costar) at 50 μL / well, and target cells were added to the wells (50 μL / well). The plate was incubated at 4°C for 30 minutes. Subsequently, effector cells were added to the wells (100 μL / well), and the plate was incubated at 37°C in 5% CO2 for 4 hours. Thereafter, 50 μL / well of supernatant was collected and applied to LumaPlate (PerkinElmer), and the released gamma ray dose was measured by using a gamma counter. The cell lysis rate caused by ADCC activity was calculated according to the following formula.

[0450] Cell lysis rate (%) = (AB) / (CB) × 100

[0451] A: Counting of sample wells

[0452] B: Mean value (n = 3) of the counts of spontaneous release (wells without antibody and effector cells). After the addition of antibody and the addition of effector cells, 50 μL and 100 μL of RP-F10 medium were added, respectively. Except for the above, the same operations as those for the sample wells were performed.

[0453] C: Mean (n = 3) of counts of maximum release (wells in which target cells were lysed by surfactant). After adding the antibody, 50 μL of RP-F10 medium was added. After adding the effector cells, 100 μL of RP-F10 medium supplemented with 2% (v / v) Triton-X100 (Sigma) was added. Except for the above, the same operations as those for the sample wells were performed.

[0454] Results are shown in Fig.14 The 105F antibody showed cell lysis activity against L428 cells in an antibody concentration-dependent manner. On the other hand, the control human IgG did not show such cell lysis activity. Therefore, the 105F antibody has ADCC activity against L428 cells expressing endogenous GARP. It should be noted that the human IgG1 anti-GARP antibodies (MHG8 and LHG10) produced based on the sequence information described in Patent Document 1 did not show ADCC activity.

[0455] 4) Inhibitory activity of -2 on Treg function

[0456] 4)-2-1 Preparation of Treg, Teff (effector T cells: CD4 positive CD25 negative helper T cells) and helper cells

[0457] CD4 positive T cells were isolated from PBMCs prepared in the same manner as in 4)-1-1 above using CD4 T cell ISOLATION Kit (Miltenyi Biotec), and FITC-labeled anti-CD4 antibody (Miltenyi Biotec) and APC-labeled anti-CD25 antibody (Miltenyi Biotec) were added to the CD4 positive T cells. The cells were incubated at 4°C for 30 minutes. After cell washing, the cells were suspended in MACS buffer, and CD4 positive CD25 negative cells (Teff) and CD4 positive CD25 strongly positive cells (Treg) were separated using FACS Aria IIu (BectonDickinson).

[0458] On the other hand, CD3-positive cells were removed from PBMCs using CD3 Microbeads (Miltenyi Biotec), and the cells were irradiated at a dose of 1 C / kg (absorbed dose: 38.76 Gy / kg (3876 Rad / kg)) using an X-ray irradiator (Hitachi Medical Corporation) to prepare helper cells.

[0459] 4)-2-2 Co-culture method and determination of inhibitory activity on Treg function

[0460] As a culture medium, RPMI1640 medium (Invitrogen) supplemented with penicillin and streptomycin (Invitrogen), 1 × MEM NEAA (Invitrogen), 1 × sodium pyruvate (Invitrogen), 5 mM Hepes, and 5% human male AB serum (Sigma) was used. Teff (2000 cells / well) and helper cells (20,000 cells / well) were mixed and added to each well of a 96-well U-bottom microplate, and Tregs were further added and seeded into the wells at 500 cells / well. In addition, control wells without Tregs were also prepared. Anti-CD3 antibodies, anti-CD28 antibodies, and 105F antibodies were added to the wells at a final concentration of 50 or 10 μg / mL, and the plates were incubated at 37°C under 5% CO2 for 5 days. Thereafter, a [ 3 H]-thymidine (PerkinElmer) was added to each well at 20 μL / well. The cells were further incubated for 18 hours. The cells were harvested in a Filtermat A (PerkinElmer) using a cell harvester (Mach II, Tomtech), and the incorporation of [ 3 The measured data were expressed as corrected numbers per minute (CCPM).

[0461] Human IgG1 anti-GARP antibodies (MHG8 and LHG10) produced based on the sequence information described in Patent Document 1 were also subjected to the experimental system herein.

[0462] 4) Calculation of -2-3 inhibitory activity

[0463] The mean values ​​of three wells in each co-culture condition were calculated. The reduced proliferation value in the co-culture of Teff and Treg when compared with that of Teff alone was defined as the "suppression rate of Teff proliferation caused by Treg" (= 1 - [CCPM of co-culture / CCPM of Teff alone]).

[0464] The inhibitory activity of each antibody on Treg function was determined by deducting the suppression rate of Teff proliferation by Treg in the presence of the antibody from that in the absence of the antibody (= [suppression rate when no antibody is added] - [suppression rate when each antibody is added]). It should be noted that this inhibitory activity of the sample was calculated every time in each experiment.

[0465] The results of the inhibitory activity of 105F antibody on Treg function at 50 μg / mL (inhibition rate: 72.6%) are shown in Fig.15 , and the results for 105F antibody and MHG-8 and LHG-10 antibodies (10 μg / mL each) are shown in Fig.16 MHG-8 and LHG-10 antibodies had no inhibitory activity on Treg function (inhibition rates: 0.8% and 0.0%, respectively), while 105F antibody significantly inhibited Treg function (inhibition rate: 65.8%). Figure 5 When the value in A (CD4 + CD25 - (Teff): Treg = 4:1) is roughly calculated, the inhibition rate caused by transduction of siRNA targeting GARP into Treg is about 15%.

[0466] Example 5: Production of rat antibodies

[0467] 5)-1 Preparation of GARP expression vector

[0468] The expression vector described in Example 2 was used as a GARP expression vector, and EndoFree Plasmid Giga Kit (QIAGEN) was used for large-scale production.

[0469] 5)-2 Immunization of rats

[0470] For immunization, WKY / Izm female rats (Japan SLC, Inc.) were used. First, the lower limbs of each rat were pretreated with hyaluronidase (SIGMA-ALDRICH), and the GARP expression vector was intramuscularly injected into the same site. Subsequently, in vivo electroporation was performed on the same site using a double needle electrode using ECM830 (BTX). Once every two weeks, the same in vivo electroporation was repeated, and lymph nodes or spleens were collected from rats and used in the production of hybridomas.

[0471] 5) Production of -3 hybridomas

[0472] Lymph node or spleen cells were fused with mouse myeloma SP2 / 0-ag14 cells (ATCC, No. CRL-1581) by electrocellular fusion using LF301 Cell Fusion Unit (BEX), and the cells were then diluted and incubated with ClonaCell-HYSelection Medium D (StemCell Technologies). Hybridoma colonies that emerged in the culture were picked and selected as monoclonal hybridomas. Each hybridoma colony was cultured, and the culture supernatant from each hybridoma was used to screen hybridomas that produced anti-GARP antibodies.

[0473] 5)-4 Antibody screening based on cell-ELISA method

[0474] 5)-4-1 Preparation of Antigen Gene-Expressing Cells for Cell-ELISA

[0475] The cells were cultured at 7.5 × 10 5 293α cells (a stable expression cell line derived from HEK-293 cells (ATCC: CRL-1573) expressing integrin αv and integrin β3) were prepared at 10 cells / mL. GARP expression vector or pcDNA3.1 (+) vector used as a negative control was transfected into the cells according to the transduction procedure using Lipofectamine 2000 (Life Technologies), and the cells were distributed in an amount of 50 μl each into a 96-Half area well plate (Corning). Thereafter, the cells were cultured in a DMEM medium supplemented with 10% FBS at 37°C in % CO2 for 24 to 27 hours. The obtained transfected cells were used for cell-ELISA in an adherent state.

[0476] 5) -4-2 cell-ELISA

[0477] The culture supernatant of the 293α cells transfected with the expression vector prepared in Example 5)-4-1 was removed, and the culture supernatant from the hybridoma was added to the 293α cells transfected with the GARP expression vector or the pcDNA3.1(+) vector. The cells were incubated at 4°C for 1 hour. The cells in the wells were washed once with PBS(+) supplemented with 5% FBS, and thereafter, anti-rat IgG-peroxidase antibody produced in rabbit (SIGMA) diluted 500 times with PBS(+) supplemented with 5% FBS was added to the wells. The cells were incubated at 4°C for 1 hour. The cells in the wells were washed three times with PBS (+) supplemented with 5% FBS, and an OPD coloring solution (which had been prepared by dissolving o-phenylenediamine dihydrochloride (Wako Pure Chemical Industries, Ltd.) and H2O2 in an OPD solution (0.05 M trisodium citrate, 0.1 M disodium hydrogen phosphate 12-water; pH 4.5) so that the substances became 0.4 mg / ml and 0.6% (v / v) respectively) was added to the wells in an amount of 50 μl / well. While the plate was incubated for a period of time with mixing, a color reaction was performed. Thereafter, 1M HCl (50 μl / well) was added to the plate to terminate the color reaction, and the absorbance at 490 nm was measured using a plate reader (ENVISION: PerkinElmer). In order to select a hybridoma producing an antibody that specifically binds to human GARP expressed on the surface of the cell membrane, a hybridoma producing a culture supernatant showing higher absorbance in 293α cells transfected with a GARP expression vector than that in cells transfected with a control pcDNA3.1(+) vector was selected as a positive cell producing an anti-human GARP antibody.

[0478] 5)-5 Antibody screening based on flow cytometry

[0479] 5)-5-1 Preparation of Antigen Gene-Expressing Cells for Use in Flow Cytometry Analysis

[0480] HEK-293T cells (obtained from ATCC) were cultured at 5 × 10 4 cells / cm 2 Inoculated in 225-cm 2flask (Sumitomo Bakelite Co., Ltd.), and then the cells were cultured in DMEM medium supplemented with 10% FBS at 37°C in 5% CO2 overnight. On the second day, HEK-293T cells were transfected with GARP expression vector or pcDNA3.1 (+) vector used as a negative control using Lipofectamine 2000, and the cells were further incubated at 37°C in 5% CO2 overnight. On the second day, the transfected HEK-293T cells were treated with TrypLE Express (LifeTechnologies), washed with DMEM medium supplemented with 10% FBS, and resuspended in PBS supplemented with 5% FBS. The obtained cell suspension was used in flow cytometry analysis.

[0481] 5)-5-2 Flow cytometry analysis

[0482] The binding specificity of the antibody produced from the hybridoma, which had been determined to be positive by cell-ELISA in Example 5)-4-2, to human GARP was further confirmed by flow cytometry analysis.

[0483] The suspension of transiently expressed HEK-293T cells prepared in Example 5)-5-1 was centrifuged, and the supernatant was removed. Thereafter, the culture supernatant from each hybridoma was added to the cells and suspended. The cells were incubated at 4°C for 1 hour. The cells were washed twice with PBS supplemented with 5% FBS, and FITC-conjugated anti-rat IgG (SIGMA) diluted 500 times with PBS supplemented with 5% FBS was added to the cells and suspended. The cells were incubated at 4°C for 1 hour. The cells were washed twice with PBS supplemented with 5% FBS and then resuspended in PBS supplemented with 5% FBS and 2 μg / ml 7-aminoactinomycin D (Molecular Probes). Cells were measured using a flow cytometer (FC500: manufactured by Beckman Coulter). Data were analyzed using Flowjo (TreeStar). After removing dead cells from the analysis by gating out 7-aminoactinomycin D-positive cells, a histogram of FITC fluorescence intensity of live cells was generated. Based on the results in which the histogram for the antibody shifted to the side of strong fluorescence intensity in HEK-293T cells transfected with the GARP expression vector compared to cells transfected with the control pcDNA3.1 vector, hybridomas (113 clones) producing human GARP binding antibodies were selected.

[0484] 5) Preparation of monoclonal antibody against -6

[0485] 5) Cultivation of 6-1 hybridomas 151D and 198D

[0486] From the rat anti-human GARP antibody-producing hybridomas obtained in 5)-5-2 above, hybridomas 151D and 198D, which were shown to strongly bind to human GARP, were selected.

[0487] Rat anti-GARP monoclonal antibodies were purified from hybridoma culture supernatants.

[0488] First, the volume of the rat anti-GARP monoclonal antibody-producing hybridoma was fully increased with ClonaCell-HY Selection Medium E, and then the medium was replaced with Hybridoma SFM (Life Technologies) to which 20% Ultra Low IgG FBS (Life Technologies) was added. 7 Cells) were seeded on 1272-cm 2 The culture supernatant was harvested by centrifugation and sterilized by passing through a 0.8-μm filter and then through a 0.45-μm filter (Corning).

[0489] 5) Purification of 6-2 monoclonal antibody

[0490] The antibody was purified from the culture supernatant of the hybridoma prepared in Example 5)-6-1 according to protein G affinity chromatography. The antibody was adsorbed onto a protein G column (GE Healthcare Bioscience), and the column was then washed with PBS, and then eluted with a 0.1 M glycine / HCl aqueous solution (pH 2.7). 1 M Tris-HCl (pH 9.0) was added to the eluent so that the pH was adjusted to pH 7.0 to 7.5. Thereafter, the solution was dialyzed (Thermo Scientific, Slide-A-Lyzer Dialysis Cassette) so that the buffer was replaced with PBS. Using Centrifugal UF Filter Device VIVASPIN20 (molecular weight cutoff: UF30K, Sartorius), the antibody was concentrated so that the concentration of the antibody was adjusted to 0.7 mg / mL or more. Finally, the antibody was filtered through a Minisart-Plus filter (Sartorius) to obtain a purified sample.

[0491] Example 6: Cloning of rat antibodies and production of human chimeric antibodies

[0492] 6) Cloning and sequencing of cDNA of rat antibody 151D

[0493] 6)-1-1 Preparation of total RNA from hybridoma producing 151D

[0494] To amplify cDNA containing the 151D variable region, total RNA was prepared from the 151D-producing hybridoma using TRIzol reagent (Ambion).

[0495] 6)-1-2 Amplification of cDNA containing the 151D heavy chain variable region by 5'-RACE PCR and its sequencing

[0496] About 1 μg of the total RNA prepared in Example 6)-1-1 was used with SMARTer RACE cDNA Amplification Kit (Clontech) to amplify cDNA containing the heavy chain variable region.

[0497] As primers for amplifying cDNA of the variable region of the 151D heavy chain gene according to PCR, UPM (Universal Primer A Mix: included in the SMARTer RACE cDNA Amplification Kit) and primers designed from the known constant region sequence of rat heavy chain were used.

[0498] The cDNA containing the heavy chain variable region amplified by 5′-RACE PCR was cloned into a plasmid, and thereafter, the nucleotide sequence of the cDNA of the heavy chain variable region was subjected to sequence analysis.

[0499] The determined nucleotide sequence of the cDNA encoding the 151D heavy chain variable region is shown in SEQ ID NO:14, and its amino acid sequence is shown in SEQ ID NO:15.

[0500] 6)-1-3 Amplification of cDNA containing the 151D light chain variable region by 5'-RACE PCR and its sequencing

[0501] Amplification and sequencing were performed by the same method as that used in Example 6)-1-2. However, as primers for amplifying cDNA of the variable region of the 151D light chain gene by PCR, UPM (Universal Primer A Mix: included in the SMARTer RACE cDNA Amplification Kit) and primers designed from the constant region sequence of a known rat light chain were used.

[0502] The determined nucleotide sequence of the cDNA encoding the 151D light chain variable region is shown in SEQ ID NO:16, and its amino acid sequence is shown in SEQ ID NO:17.

[0503] 6) Cloning and sequencing of cDNA of rat antibody 198D

[0504] The sequence was determined by the same method as that used in Example 6)-1.

[0505] The nucleotide sequence of the cDNA encoding the 198D heavy chain variable region determined is shown in SEQ ID NO: 18, and its amino acid sequence is shown in SEQ ID NO: 19. The nucleotide sequence of the cDNA encoding the 198D light chain variable region determined is shown in SEQ ID NO: 20, and its amino acid sequence is shown in SEQ ID NO: 21.

[0506] 6) Production of human chimeric antibody expression vector

[0507] 6) Construction of 3-1 human chimeric light chain expression vector pCMA-LK

[0508] An approximately 5.4-kb fragment obtained by digesting plasmid pcDNA3.3-TOPO / LacZ (Invitrogen) with restriction enzymes XbaI and PmeI was combined with a DNA fragment containing the human light chain signal sequence shown in SEQ ID NO: 22 and a DNA sequence encoding the human κ chain constant region to generate pcDNA3.3 / LK using the In-Fusion Advantage PCR Cloning Kit (CLONTECH).

[0509] The neomycin expression unit was removed from pcDNA3.3 / LK to construct pCMA-LK.

[0510] 6) Construction of 3-2 human chimeric IgG1 heavy chain expression vector pCMA-G1

[0511] Using the In-Fusion Advantage PCR Cloning Kit (CLONTECH), a DNA fragment obtained by digesting pCMA-LK with XbaI and PmeI to remove the light chain signal sequence and the human κ chain constant region therefrom was combined with a DNA fragment containing the human heavy chain signal sequence shown in SEQ ID NO: 23 and a DNA sequence encoding the amino acids in the human IgG1 constant region to construct pCMA-G1.

[0512] 6) Construction of 3-3 human chimeric 151D heavy chain expression vector

[0513] Using the cDNA encoding the heavy chain variable region of rat antibody 151D obtained in Example 6)-1 as a template, PCR was performed with primers designed for In-fusion cloning to amplify a DNA fragment containing the cDNA encoding the heavy chain variable region. Using the In-Fusion HD PCR Cloning Kit (Clontech), the amplified DNA fragment was inserted into the site of pCMA-G1 cut with restriction enzyme BIpI to construct a human chimeric 151D heavy chain expression vector.

[0514] The nucleotide sequence of the human chimeric 151D heavy chain and the amino acid sequence of the heavy chain are shown in SEQ ID NO: 24 and SEQ ID NO: 25, respectively.

[0515] 6) Construction of 3-4 human chimeric 151D light chain expression vector

[0516] Using the cDNA encoding the variable region of the 151D light chain variable region obtained in Example 6)-1 as a template, PCR was performed with primers designed for In-fusion cloning to amplify a DNA fragment containing the cDNA encoding the light chain variable region. Using the In-Fusion HD PCR Cloning Kit (Clontech), the amplified DNA fragment was inserted into the site of pCMA-LK that had been cut with the restriction enzyme BsiWI to construct a human chimeric 151D light chain expression vector.

[0517] The nucleotide sequence of the human chimeric 151D light chain and the amino acid sequence of the light chain are shown in SEQ ID NO: 26 and SEQ ID NO: 27, respectively.

[0518] 6) Construction of 3-5 human chimeric 198D heavy chain expression vector

[0519] Using the cDNA encoding the rat antibody 198D heavy chain variable region obtained in Example 6)-2 as a template, a human chimeric 198D heavy chain expression vector was constructed by the same method as that used in Example 6)-3-3.

[0520] The nucleotide sequence of the human chimeric 198D heavy chain and the amino acid sequence of the heavy chain are shown in SEQ ID NO: 28 and SEQ ID NO: 29, respectively.

[0521] 6) Construction of 3-6 human chimeric 198D light chain expression vector

[0522] Using the cDNA encoding the 198D light chain variable region obtained in Example 6)-2 as a template, a human chimeric 198D light chain expression vector was constructed by the same method as that used in Example 6)-3-4.

[0523] The nucleotide sequence of the human chimeric 198D light chain and the amino acid sequence of the light chain are shown in SEQ ID NO: 30 and SEQ ID NO: 31, respectively.

[0524] 6) Preparation of 4-human chimeric antibodies

[0525] 6) Production of 4-1 human chimeric antibodies

[0526] FreeStyle 293F cells (Invitrogen) were cultured and passaged according to the manual. 1 × 10 8 FreeStyle 293F cells (Invitrogen) were seeded in 250-mL Fernbach Erlenmeyer flasks (CORNING) and then cultured at 2.0 × 10 6 cells / mL were diluted with FreeStyle 293 Expression Medium (Invitrogen).

[0527] At the same time, 20 μg of the heavy chain expression vector, 30 μg of the light chain expression vector, and 150 μg of polyethyleneimine (Polyscience #24765) were added to 5 mL of Opti-Pro SFM medium (Invitrogen), and the resulting mixture was gently stirred. After incubation for 5 minutes, the mixture was added to FreeStyle 293F cells.

[0528] The cells were incubated in an incubator (37°C, 8% CO2) with shaking at 125 rpm for 4 hours, and thereafter, 50 mL EX-CELL VPRO medium (SAFC Biosciences), 0.36 mL GlutaMAX I (GIBCO), and 2.5 mL Yeasolate Ultrafiltrate (GIBCO) were added to the culture. The cells were further incubated in an incubator (37°C, 8% CO2) with shaking at 125 rpm for 7 days. The culture supernatant was harvested and filtered using a 250-mL Filter System (CORNING, #431096).

[0529] The human chimeric 151D antibody obtained by combining the human chimeric 151D heavy chain expression vector with the human chimeric 151D light chain expression vector was named "c151D", and the human chimeric 198D antibody obtained by combining the human chimeric 198D heavy chain expression vector with the human chimeric 198D light chain expression vector was named "c198D".

[0530] 6) Purification of -4-2 chimeric antibody

[0531] The culture supernatant obtained in Example 6)-4-1 was purified by one-step purification of rProtein A affinity chromatography. The culture supernatant was applied to a column (manufactured by GE Healthcare Bioscience) filled with MabSelectSuRe equilibrated with PBS, and then the column was washed with PBS in an amount of 2 or more times the column volume. Subsequently, elution was performed using a 2 M arginine hydrochloride solution (pH 4.0) so that the antibody-containing fraction was collected. The fraction was subjected to Centrifugal UF FilterDevice VIVASPIN20 (molecular weight cutoff: UF30K, Sartorius) so that the buffer was replaced with PBS, and the antibody was concentrated to adjust the antibody concentration to 1 mg / mL or more. Finally, the antibody was filtered through a Minisart-Plus filter (Sartorius) to obtain a purified sample.

[0532] 6) Evaluation of the binding activity of 5-human chimeric antibodies to human GARP

[0533] The dissociation constant between c151D or c198D produced in Example 6)-4 and human GARP was evaluated by using Biacore T200 (GE Healthcare Bioscience) according to a capture method comprising capturing an antibody as a ligand with immobilized protein A and then analyzing the dissociation constant using an antigen (recombinant human GARP: R&D Systems) as an analyte. HBS-EP + (manufactured by GE Healthcare Bioscience) was used as a running buffer, and a protein A sensor chip (manufactured by GE Healthcare Bioscience) was used as a sensor chip.

[0534] Human chimeric antibody (1 μg / mL) was added to the chip at a rate of 10 μL / min for 20 seconds, and then a dilution series solution of the antigen (8 to 128 nM) was added at a flow rate of 30 μl / min for 120 seconds. Subsequently, dissociation was monitored for 480 seconds. As a regeneration solution, glycine 1.5 (manufactured by GE Healthcare Bioscience) was added at a flow rate of 20 μl / min for 30 seconds.

[0535] A 1:1 fitting model was used in data analysis, and the association rate constant ka, dissociation rate constant kd, and dissociation constant (KD; KD = kd / ka) were calculated.

[0536] The results are shown in Table 1.

[0537] Table 1 Dissociation constants between c151D or c198D and human GARP

[0538] [Table 1]

[0539] name KD (nM) 1 c151D 0.47 2 c198D 0.17

[0540] Example 7 Production of humanized antibodies

[0541] 7)-1 Molecular modeling of the variable region of c151D antibody

[0542] Molecular modeling of the variable region of the c151D antibody was performed according to a method generally known as homology modeling (Methods in Enzymology, 203, 121-153, (1991)).

[0543] The primary sequence of the variable region of human immunoglobulin registered in the Protein Data Bank (Nuc. Acid Res. 28, 235-242 (2000)) (the three-dimensional structure deduced from the X-ray crystal structure is available) was compared with the variable region of the c151D antibody.

[0544] The three-dimensional structure of the variable region was generated by combining the coordinates of the heavy and light chains of the c151D antibody and a model with a high degree of sequence homology to the interface with each other in order to obtain a "framework model".

[0545] Following this, representative conformations of each CDR were incorporated into the framework model.

[0546] Finally, energy minimization calculations were performed to eliminate energetically unfavorable atomic contacts. The above procedures were performed using Discovery Studio (Dassault Systemes).

[0547] 7)-2 Design of the amino acid sequence of humanized 151D antibody

[0548] Humanized 151D antibody was constructed according to a method generally referred to as CDR grafting (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)). The acceptor antibody was selected based on amino acid homology in the framework region.

[0549] The sequence of the c151D antibody framework region was compared with the framework region of the human subgroup consensus sequence determined by KABAT et al. (Sequences of Proteins of Immunological Interest, 5th edition Public Health Service National Institutes of Health, Bethesda, MD. (1991)). As a result, the consensus sequences of human γ chain subgroup 3 and human κ chain subgroups 1 and 4 had high sequence homology, and on this basis, they were selected as receptors.

[0550] The amino acid residues in the framework region were aligned with the amino acid residues of the c151D antibody with respect to the consensus sequence of human γ chain subgroup 3 and the consensus sequences of human κ chain subgroup 1 and human κ chain subgroup 4, so that positions where different amino acids were used were identified. The positions of these residues were analyzed using the three-dimensional model of the c151D antibody constructed in 7)-1 above, and based on the criteria given by Queen et al. (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)), the donor residues to be transplanted onto the acceptor were selected.

[0551] Several donor residues thus selected were introduced into the acceptor antibody in order to construct the sequence of humanized h151D as described in the following Examples.

[0552] 7) -3 Design of humanized 151D heavy chain h151D-H

[0553] 7) -3-1 h151D-H1 heavy chain

[0554] By replacing the arginine residue at amino acid position 35 with a glycine residue, the lysine residue at amino acid position 37 with a leucine residue, the lysine residue at amino acid position 38 with an arginine residue, the serine residue at amino acid position 42 with an alanine residue, the threonine residue at amino acid position 61 with a glycine residue, the glutamine residue at amino acid position 62 with a lysine residue, the alanine residue at amino acid position 68 with a serine residue, and the arginine residue at amino acid position 80 with an alanine residue in the c151D heavy chain shown in SEQ ID NO: 25 in the sequence listing. , the alanine residue at amino acid position 94 is replaced by a serine residue, the serine residue at amino acid position 96 is replaced by an asparagine residue, the aspartic acid residue at amino acid position 103 is replaced by an asparagine residue, the serine residue at amino acid position 107 is replaced by an alanine residue, the threonine residue at amino acid position 112 is replaced by a valine residue, the valine residue at amino acid position 130 is replaced by a threonine residue, and the methionine residue at amino acid position 131 is replaced by a leucine residue. The designed humanized 151D heavy chain was named "h151D-H1 type heavy chain".

[0555] In the nucleotide sequence encoding the h151D-H1 type heavy chain (SEQ ID NO: 32), the mature heavy chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 1398, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 408, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 409 to 1398. The above-mentioned variable region has, in SEQ ID NO: 32 in the sequence listing, a nucleotide sequence consisting of nucleotides at nucleotide positions 133 to 162 encoding CDRH1, a nucleotide sequence consisting of nucleotides at nucleotide positions 205 to 234 encoding CDRH2, and a nucleotide sequence consisting of nucleotides at nucleotide positions 352 to 375 encoding CDRH3.

[0556] In addition, in the amino acid sequence of the h151D-H1 type heavy chain (SEQ ID NO: 33), the mature heavy chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 20 to 466, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 20 to 136, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 137 to 466. The above-mentioned variable region has CDRH1 consisting of the amino acid sequence at amino acid positions 45 to 54 in SEQ ID NO: 33 in the sequence listing, CDRH2 consisting of the amino acid sequence at amino acid positions 69 to 78 therein, and CDRH3 consisting of the amino acid sequence at amino acid positions 118 to 125 therein.

[0557] In addition, the sequences shown in SEQ ID NOs: 32 and 33 are also shown in Fig.31 and 21 middle.

[0558] 7)-3-2 h151D_H4 heavy chain

[0559] The humanized 151D heavy chain designed by replacing the arginine residue at amino acid position 35 with a glycine residue, the lysine residue at amino acid position 37 with a leucine residue, the lysine residue at amino acid position 38 with an arginine residue, the serine residue at amino acid position 42 with an alanine residue, the threonine residue at amino acid position 61 with a glycine residue, the glutamine residue at amino acid position 62 with a lysine residue, the alanine residue at amino acid position 94 with a serine residue, the aspartic acid residue at amino acid position 103 with an asparagine residue, the serine residue at amino acid position 107 with an alanine residue, the threonine residue at amino acid position 112 with a valine residue, the valine residue at amino acid position 130 with a threonine residue, and the methionine residue at amino acid position 131 with a leucine residue in the c151D heavy chain shown in SEQ ID NO: 25 in the sequence listing was named “h151D_H4 type heavy chain”.

[0560] In the nucleotide sequence encoding the h151D-H4 type heavy chain (SEQ ID NO: 34), the mature heavy chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 1398, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 408, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 409 to 1398. The above-mentioned variable region has, in SEQ ID NO: 34 in the sequence listing, a nucleotide sequence consisting of nucleotides at nucleotide positions 133 to 162 encoding CDRH1, a nucleotide sequence consisting of nucleotides at nucleotide positions 205 to 234 encoding CDRH2, and a nucleotide sequence consisting of nucleotides at nucleotide positions 352 to 375 encoding CDRH3.

[0561] In addition, in the amino acid sequence of the h151D-H4 type heavy chain (SEQ ID NO: 35), the mature heavy chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 20 to 466, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 20 to 136, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 137 to 466. The above-mentioned variable region has CDRH1 consisting of the amino acid sequence at amino acid positions 45 to 54 in SEQ ID NO: 35 in the sequence listing, CDRH2 consisting of the amino acid sequence at amino acid positions 69 to 78 therein, and CDRH3 consisting of the amino acid sequence at amino acid positions 118 to 125 therein.

[0562] In addition, the sequences shown in SEQ ID NOs: 34 and 35 are also shown in Fig.33 and 23 middle.

[0563] 7) -4 Design of humanized 151D light chain h151D_L

[0564] 7) -4-1 h151D-L1 type light chain

[0565] By replacing the threonine residue at amino acid position 29 with an aspartic acid residue, the methionine residue at amino acid position 31 with a leucine residue, the phenylalanine residue at amino acid position 32 with an alanine residue, the isoleucine residue at amino acid position 33 with a valine residue, the valine residue at amino acid position 35 with a leucine residue, the aspartic acid residue at amino acid position 37 with a glutamic acid residue, the valine residue at amino acid position 39 with an alanine residue, the methionine residue at amino acid position 41 with an isoleucine residue, the threonine residue at amino acid position 60 with a proline residue, and the serine residue at amino acid position 61 with a leucine residue. The humanized 151D light chain designed by replacing the threonine residue at amino acid position 83 with a serine residue, replacing the asparagine residue at amino acid position 97 with a serine residue, replacing the methionine residue at amino acid position 98 with a leucine residue, replacing the leucine residue at amino acid position 103 with a valine residue, replacing the threonine residue at amino acid position 120 with a glutamine residue, replacing the leucine residue at amino acid position 124 with a valine residue, replacing the leucine residue at amino acid position 126 with an isoleucine residue, replacing the asparagine residue at amino acid position 127 with a lysine residue, and replacing the alanine residue at amino acid position 129 with a threonine residue was named "h151D_L1 type light chain".

[0566] In the nucleotide sequence encoding the h151D-L1 type light chain (SEQ ID NO: 36), the mature light chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 702, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702. The above-mentioned variable region has, in SEQ ID NO: 36 in the sequence listing, a nucleotide sequence consisting of nucleotides at nucleotide positions 130 to 162 encoding CDRH1, a nucleotide sequence consisting of nucleotides at nucleotide positions 208 to 228 encoding CDRH2, and a nucleotide sequence consisting of nucleotides at nucleotide positions 325 to 351 encoding CDRH3.

[0567] In addition, in the amino acid sequence of the h151D_L1 type light chain (SEQ ID NO: 37), the mature light chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 21 to 234, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 21 to 129, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 130 to 234. The above-mentioned variable region has CDRL1 consisting of the amino acid sequence at amino acid positions 44 to 54 in SEQ ID NO: 37 in the sequence listing, CDRL2 consisting of the amino acid sequence at amino acid positions 70 to 76 therein, and CDRL3 consisting of the amino acid sequence at amino acid positions 109 to 117 therein.

[0568] In addition, the sequences shown in SEQ ID NOs: 36 and 37 are also shown in Fig.32 and 22 middle.

[0569] 7) -4-2 h151D-L4 type light chain:

[0570] The c151D light chain shown in SEQ ID NO: 27 in the sequence listing is prepared by replacing the threonine residue at amino acid position 29 with a serine residue, replacing the methionine residue at amino acid position 31 with a leucine residue, replacing the phenylalanine residue at amino acid position 32 with a serine residue, replacing the isoleucine residue at amino acid position 33 with an alanine residue, replacing the methionine residue at amino acid position 41 with an isoleucine residue, replacing the threonine residue at amino acid position 60 with a proline residue, replacing the glutamine residue at amino acid position 62 with a lysine residue, replacing the threonine residue at amino acid position 83 with a serine residue, replacing the asparagine residue at amino acid position 97 with a serine residue, and replacing the asparagine residue at amino acid position 97 with a leucine residue. The humanized 151D light chain designed by replacing the methionine residue at amino acid position 98 with a proline residue, the alanine residue at amino acid position 100 with a proline residue, the leucine residue at amino acid position 103 with a phenylalanine residue, the valine residue at amino acid position 105 with a threonine residue, the threonine residue at amino acid position 120 with a glutamine residue, the leucine residue at amino acid position 124 with a valine residue, the leucine residue at amino acid position 126 with an isoleucine residue, the asparagine residue at amino acid position 127 with a lysine residue, and the alanine residue at amino acid position 129 with a threonine residue was named "h151D-L4 type light chain".

[0571] In the nucleotide sequence encoding the h151D-L4 type light chain (SEQ ID NO: 38), the mature light chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 702, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702. The above-mentioned variable region has, in SEQ ID NO: 38 in the sequence listing, a nucleotide sequence consisting of nucleotides at nucleotide positions 130 to 162 encoding CDRL1, a nucleotide sequence consisting of nucleotides at nucleotide positions 208 to 228 encoding CDRL2, and a nucleotide sequence consisting of nucleotides at nucleotide positions 325 to 351 encoding CDRL3.

[0572] In addition, in the amino acid sequence of the h151D_L4 type light chain (SEQ ID NO: 39), the mature light chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 21 to 234, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 21 to 129, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 130 to 234. The above-mentioned variable region has CDRL1 consisting of the amino acid sequence at amino acid positions 44 to 54 in SEQ ID NO: 39 in the sequence listing, CDRL2 consisting of the amino acid sequence at amino acid positions 70 to 76 therein, and CDRL3 consisting of the amino acid sequence at amino acid positions 109 to 117 therein.

[0573] In addition, the sequences shown in SEQ ID NOs: 38 and 39 are also shown in Fig.34 and 24 middle.

[0574] 7) Molecular modeling of the -5 c198D mutation region

[0575] Molecular modeling of the variable region of the c198D antibody was performed according to a method generally referred to as homology modeling (Methods in Enzymology, 203, 121-153, (1991)). The primary sequence of the variable region of a human immunoglobulin registered in the Protein Data Bank (Nuc. Acid Res. 28, 235-242 (2000)) (the three-dimensional structure inferred from the X-ray crystal structure is available) was compared with the variable region of the c198D antibody.

[0576] The three-dimensional structure of the variable region was generated by combining the coordinates of the heavy and light chains of the c198D antibody and a model with a high degree of sequence homology to their interfaces with one another in order to obtain a "framework model".

[0577] Following this, representative conformations of each CDR were incorporated into the framework model.

[0578] Finally, energy minimization calculations were performed to eliminate energetically unfavorable atomic contacts. The above procedures were performed using Discovery Studio (Dassault Systemes).

[0579] 7) Amino acid sequence design of -6 humanized 198D

[0580] Humanized 198D antibody was constructed according to a method generally referred to as CDR grafting (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)). The acceptor antibody was selected based on amino acid homology in the framework region.

[0581] The sequence of the c198D antibody framework region was compared with the framework region of the human subgroup consensus sequence determined by KABAT et al. (Sequences of Proteins of Immunological Interest, 5th Edition Public Health Service National Institutes of Health, Bethesda, MD. (1991)). As a result, the consensus sequences of human γ chain subgroup 2 and human κ chain subgroup 1 had a high degree of sequence homology, and on this basis, they were selected as receptors. In addition, several residues in the consensus sequence of human γ chain subgroup 3 were introduced into the receptor of the heavy chain.

[0582] With respect to the consensus sequence of human γ chain subgroup 2 and the consensus sequence of human κ chain subgroup 1, which include a portion of the consensus sequence of human γ chain subgroup 3, the amino acid residues in the framework region were aligned with the amino acid residues of the c198D antibody, so that positions where different amino acids were used were identified. The positions of these residues were analyzed using the three-dimensional model of the c198D antibody constructed in 7)-5 above, and based on the criteria given by Queen et al. (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)), the donor residues to be transplanted onto the acceptor were selected.

[0583] Several donor residues thus selected were introduced into the acceptor antibody in order to construct the sequence of humanized h198D as described in the following Examples.

[0584] 7) Design of humanized 198D heavy chain h198D-H

[0585] 7)-7-1 h198D-H3 heavy chain

[0586] by replacing the glutamine residue at amino acid position 20 with a glutamic acid residue, the arginine residue at amino acid position 24 with a valine residue, the proline residue at amino acid position 28 with a glycine residue, the glutamine residue at amino acid position 32 with a lysine residue, the glutamic acid residue at amino acid position 61 with a glycine residue, the serine residue at amino acid position 80 with a proline residue, the alanine residue at amino acid position 81 with a serine residue, the leucine residue at amino acid position 86 with a valine residue, the serine residue at amino acid position 87 with a threonine residue, the serine residue at amino acid position 95 with an asparagine residue, and the phenylalanine residue at amino acid position 98 with a serine residue in the c198D heavy chain shown in SEQ ID NO: 29 in the sequence listing. The humanized 198D heavy chain designed by replacing the methionine residue at amino acid position 101 with a leucine residue, the threonine residue at amino acid position 103 with a serine residue, the leucine residue at amino acid position 104 with a valine residue, the glutamine residue at amino acid position 105 with a threonine residue, the threonine residue at amino acid position 106 with an alanine residue, the glutamic acid residue at amino acid position 107 with an alanine residue, the methionine residue at amino acid position 111 with a valine residue, the phenylalanine residue at amino acid position 113 with a tyrosine residue, the alanine residue at amino acid position 133 with a threonine residue, and the serine residue at amino acid position 134 with a leucine residue was named "h198D_H3 type heavy chain".

[0587] In the nucleotide sequence encoding the h198D-H3 type heavy chain (SEQ ID NO: 40), the mature heavy chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 1407, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 58 to 417, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 418 to 1407. The above-mentioned variable region has, in SEQ ID NO: 40 in the sequence listing, a nucleotide sequence consisting of nucleotides at nucleotide positions 130 to 162 encoding CDRH1, a nucleotide sequence consisting of nucleotides at nucleotide positions 205 to 231 encoding CDRH2, and a nucleotide sequence consisting of nucleotides at nucleotide positions 349 to 384 encoding CDRH3.

[0588] In addition, in the amino acid sequence of the h198D-H3 type heavy chain (SEQ ID NO: 41), the mature heavy chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 20 to 469, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 20 to 139, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 140 to 469.

[0589] In addition, the sequences shown in SEQ ID NOs: 40 and 41 are also shown in Fig.35 and 25 middle.

[0590] 7) Design of -8 humanized 198D light chain h198D-L

[0591] 7) -8-1 h198D-L4 type light chain

[0592] by substituting, in the c198D light chain shown in SEQ ID NO: 31 in the sequence listing, the alanine residue at amino acid position 29 with a serine residue, the glycine residue at amino acid position 33 with an alanine residue, the leucine residue at amino acid position 35 with a valine residue, the glutamic acid residue at amino acid position 37 with an aspartic acid residue, the threonine residue at amino acid position 38 with an arginine residue, the glutamine residue at amino acid position 42 with a threonine residue, the glutamine residue at amino acid position 65 with a lysine residue, the glycine residue at amino acid position 85 with a serine residue, the serine residue at amino acid position 92 with a threonine residue, the The humanized 198D light chain designed by replacing the lysine residue at amino acid position 94 with a leucine residue, the methionine residue at amino acid position 98 with a leucine residue, the threonine residue at amino acid position 100 with a proline residue, the glutamic acid residue at amino acid position 103 with a phenylalanine residue, the glycine residue at amino acid position 104 with an alanine residue, the valine residue at amino acid position 105 with a threonine residue, the serine residue at amino acid position 120 with a glutamine residue, the leucine residue at amino acid position 124 with a valine residue, and the alanine residue at amino acid position 129 with a threonine residue was named "h198D-L4 type light chain".

[0593] In the nucleotide sequence encoding the h198D-L4 type light chain (SEQ ID NO: 42), the mature light chain from which the signal sequence has been removed is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 702, the variable region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 61 to 387, and the constant region is encoded by a nucleotide sequence consisting of nucleotides at nucleotide positions 388 to 702. The above-mentioned variable region has, in SEQ ID NO: 42 in the sequence listing, a nucleotide sequence consisting of nucleotides at nucleotide positions 130 to 162 encoding CDRL1, a nucleotide sequence consisting of nucleotides at nucleotide positions 208 to 228 encoding CDRL2, and a nucleotide sequence consisting of nucleotides at nucleotide positions 325 to 351 encoding CDRL3.

[0594] In addition, in the amino acid sequence of the h198D_L4 type light chain (SEQ ID NO: 43), the mature light chain from which the signal sequence has been removed is an amino acid sequence consisting of amino acids at amino acid positions 21 to 234, the variable region is an amino acid sequence consisting of amino acids at amino acid positions 21 to 129, and the constant region is an amino acid sequence consisting of amino acids at amino acid positions 130 to 234.

[0595] In addition, the sequences shown in SEQ ID NOs: 42 and 43 are also shown in Fig.36 and 26 middle.

[0596] 7)-9 Construction of expression vector for humanized antibody

[0597] 7)-9-1 Construction of expression vector for humanized anti-human GARP antibody h151D-H1L1

[0598] A DNA fragment containing a sequence encoding a h151D-H1 type heavy chain was synthesized (GENEART, artificial gene synthesis service), the h151D-H1 type heavy chain consisting of nucleotides at nucleotide positions 58 to 1398 of the nucleotide sequence of the h151D-H1 type heavy chain shown in SEQ ID NO: 32 in the sequence list. Using the synthesized DNA fragment, an expression vector of the h151D-H1 type heavy chain was constructed according to the protocol of Potelligent (R) CHOK1SV Technology by BioWa and Lonza. The constructed expression vector was named "GSV-h151D-H1".

[0599] Subsequently, a DNA fragment containing a sequence encoding an h151D-L1 type light chain consisting of nucleotides at nucleotide positions 61 to 702 of the nucleotide sequence of the h151D-L1 type light chain shown in SEQ ID NO: 36 in the sequence listing was synthesized (GENEART, artificial gene synthesis service).

[0600] Using the synthetic DNA fragment, an expression vector of the h151D-L1 type light chain was constructed according to the protocol of Potelligent (R) CHOK1SV Technology from BioWa and Lonza. The constructed expression vector was named "GSV-h151D-L1".

[0601] Subsequently, the MACA-1511a expression vector was constructed from the thus constructed expression vectors "GSV-h151D-H1" and "GSV-h151D-L1" according to the protocol of Potelligent (R) CHOK1SV Technology of BioWa and Lonza. The obtained expression vector was named "DGV-h151D-H1L1-GS".

[0602] 7)-9-2 Construction of expression vector for humanized anti-human GARP antibody h151D-H4L4

[0603] As in the case of Example 7)-9-1, a DNA fragment comprising a sequence encoding an h151D-H4 type heavy chain and a DNA fragment comprising a sequence encoding an h151D-L4 type light chain were synthesized (GENEART, artificial gene synthesis service), wherein the h151D-H4 type heavy chain consists of nucleotides at nucleotide positions 58 to 1398 of the nucleotide sequence of the h151D-H4 type heavy chain shown in SEQ ID NO: 34 in the sequence listing, and the h151D-L4 type light chain consists of nucleotides at nucleotide positions 61 to 702 of the nucleotide sequence of the h151D-L4 type light chain shown in SEQ ID NO: 38 in the sequence listing.

[0604] Using the synthetic DNA fragment, the MACA-1514a expression vector was constructed according to the protocol of Potelligent (R) CHOK1SV Technology from BioWa and Lonza. The obtained expression vector was named "DGV-h151D-H4L4-GS".

[0605] 7)-9-3 Construction of expression vector for humanized anti-human GARP antibody h198D-H3L4

[0606] As in the case of Example 7)-9-1, a DNA fragment comprising a sequence encoding an h198D-H3 type heavy chain and a DNA fragment comprising a sequence encoding an h198D-L4 type light chain were synthesized (GENEART, artificial gene synthesis service), wherein the h198D-H4 type heavy chain consists of nucleotides at nucleotide positions 58 to 1407 of the nucleotide sequence of the h198D-H3 type heavy chain shown in SEQ ID NO: 40 in the sequence listing, and the h198D-L4 type light chain consists of nucleotides at nucleotide positions 61 to 702 of the nucleotide sequence of the h198D-L4 type light chain shown in SEQ ID NO: 42 in the sequence listing.

[0607] Using the synthetic DNA fragment, the MACA-1983a expression vector was constructed according to the protocol of Potelligent (R) CHOK1SV Technology from BioWa and Lonza. The obtained expression vector was named "DGV-h198D-H3L4-GS".

[0608] 7) Preparation of humanized anti-human GARP antibody

[0609] 7)-10-1 Production of cells producing humanized anti-human GARP antibodies

[0610] 7)-10-1-1 Production of cells producing humanized anti-human GARP antibody h151D-H1L1

[0611] Potelligent CHOK1SV cells (BioWa and Lonza) were transfected with the humanized anti-human GARP antibody h151D-H1L1 expression vector DGV-h151D-H1L1-GS, which had been constructed in Example 7)-9-1 according to the protocol of Potelligent (R) CHOK1SV Technology by BioWa and Lonza, in order to construct a cell line producing humanized anti-human GARP antibody h151D-H1L1. The obtained production cell line was named "MAC1-1".

[0612] 7)-10-1-2 Production of cells producing humanized anti-human GARP antibody h151D-H4L4

[0613] As in the case of Example 7)-10-1-1, Potelligent CHOK1SV cells (BioWa and Lonza) were transfected with the humanized anti-human GARP antibody h151D-H4L4 expression vector DGV-h151D-H4L4-GS, which had been constructed in Example 7)-9-2, in order to construct a cell line producing humanized anti-human GARP antibody h151D-H4L4. The obtained production cell line was named "MAC2-1".

[0614] 7)-10-1-3 Production of cells producing humanized anti-human GARP antibody h198D-H3L4

[0615] As in the case of Example 7)-10-1-1, Potelligent CHOK1SV cells (BioWa and Lonza) were transfected with the humanized anti-human GARP antibody h198D-H3L4 expression vector DGV-h198D-H3L4-GS, which had been constructed in Example 7)-9-3, to construct a cell line producing humanized anti-human GARP antibody h198D-H3L4. The obtained cell line was named "MAC3-1".

[0616] 7) -10-2 Cultivation of cells producing humanized anti-human GARP antibodies

[0617] 7)-10-2-1 Cultivation of cells producing humanized anti-human GARP antibody h151D-H1L1

[0618] The humanized anti-human GARP antibody h151D-H1L1 producing cell line "MAC1-1" produced in Example 7)-10-1-1 was cultured using a culture instrument Wave reactor (GE Healthcare Japan). The producing cell line "MAC1-1" was thawed in Dsp04B (JX Energy) medium, and then cultured in Dsp04B (JX Energy) medium in an incubator (37°C, 5% CO2) at 120 rpm. The obtained culture solution was diluted with C36 (JX Energy) medium, and then amplified and cultured in an incubator (37°C, 5% CO2) at 120 rpm.

[0619] The obtained culture solution was diluted with C36 medium at 30 × 10 4The cells were diluted at 10 cells / mL and transferred to WAVE CELLBAG (GE Healthcare Bioscience), and then cultured at 37°C in 5% CO2, with an air supply rate of 0.3 L / min, at a rotation speed of 18-24 rpm, and at an angle of 6-8° for 13 days.

[0620] From the third day after the start of the culture, FM4Ae2 medium (homemade) was added to the culture at 6% of the initial culture volume per day. The obtained culture solution was roughly filtered through a depth filter Millistak MC0HC054H1 (MerckMillipore), and then filtered through a 0.22-μm filter (Sartorius) attached to Flexboy Bags. The filtrate was named "MACA-1511a culture supernatant".

[0621] 7)-10-2-2 Cultivation of cells producing humanized anti-human GARP antibody h151D-H4L4

[0622] In the same manner as that applied in Example 7)-10-2-1, the humanized anti-human GARP antibody h151D-H4L4 producing cell line "MAC2-1" produced in Example 7)-10-1-2 was cultured and expanded, and thereafter, the cells were subjected to fed-batch culture using a culture instrument Wave reactor (GE Healthcare Japan). The obtained culture was incubated with C36 medium at 30 × 10 4 The culture solution was filtered and the filtrate was named "MACA-1514a culture supernatant".

[0623] 7)-10-2-3 Cultivation of cells producing humanized anti-human GARP antibody h198D-H3L4

[0624] In the same manner as that applied in Example 7)-10-2-1, the humanized anti-human GARP antibody h198D-H3L4 producing cell line "MAC3-1" produced in Example 7)-10-1-3 was cultured and expanded, and thereafter, the cells were subjected to fed-batch culture using a culture instrument Wave reactor (GE Healthcare Japan). The obtained culture was incubated with C36 medium at 30 × 10 4The culture solution was filtered and the filtrate was named "MACA-1983a culture supernatant".

[0625] 7) Purification of humanized anti-human GARP antibody

[0626] 7) Purification of the humanized anti-human GARP antibody h151D-H1L1

[0627] The "MACA-1511a culture supernatant" obtained in Example 7)-10-2-1 was purified by a three-step method, namely, rProtein A affinity chromatography, anion exchange chromatography, and cation exchange chromatography.

[0628] First, the culture supernatant was applied to the rProtein A affinity chromatography resin equilibrated with PBS. After the entire culture solution had entered the column, the column was washed with PBS, an arginine-containing buffer, and PBS. Subsequently, the remaining material in the column was eluted with an acetate buffer, and the absorption peak at 280 nm was collected. The collected solution was neutralized with a Tris buffer and then roughly filtered through a glass fiber filter AP20 (Merck Millipore). The solution was filtered through Stericup-GV (Merck Millipore), which was a 0.22-μm filter, and the resulting filtrate was defined as the rProtein A purification pool.

[0629] Subsequently, the rProtein A purification pool was applied to an anion exchange chromatography resin that had been equilibrated with PBS. After the application solution as a whole had entered the column, PBS was supplied. The flow-through fraction and the absorption peak at 280 nm when PBS was supplied were collected. The pH of the collected solution was adjusted with acetic acid, and then the solution was roughly filtered through a glass fiber filter AP20 (Merck Millipore). The solution was filtered through Stericup-GV (Merck Millipore) which was a 0.22-μm filter, and the resulting filtrate was defined as the AEX purification pool.

[0630] Subsequently, the AEX purification pool was applied to a cation exchange chromatography resin that had been equilibrated with acetate buffer. After the application solution as a whole had entered the column, the column was washed with acetate buffer. Thereafter, elution was performed using an acetate buffer containing a high concentration of NaCl, and the absorption peak at 280 nm was collected. The collected solution was roughly filtered through a glass fiber filter AP20 (Merck Millipore), and then filtered through Stericup-GV (Merck Millipore), which was a 0.22-μm filter. The resulting filtrate was defined as the CEX purification pool.

[0631] The CEX purified pool was concentrated to an antibody concentration of 25 mg / mL using a Pellicon 3 Cassette 30 kDa (Merck Millipore), and then the buffer was replaced with a histidine buffer (25 mM histidine, 5% sorbitol, pH 6.0). Finally, the solution was roughly filtered through a glass fiber filter AP20 (Merck Millipore) and then filtered through a Stericup-GV (Merck Millipore) which is a 0.22-μm filter to obtain a purified sample. This purified sample was named "h151D-H1L1".

[0632] 7) Purification of the humanized anti-human GARP antibody h151D-H4L4

[0633] In the same manner as that used in Example 7)-10-3-1, the "MACA-1514a culture supernatant" obtained in Example 7)-10-2-2 was purified by a three-step method, namely rProtein A affinity chromatography, anion exchange chromatography and cation exchange chromatography. The purified sample was named "h151D-H4L4".

[0634] 7) Purification of the humanized anti-human GARP antibody h198D-H3L4

[0635] In the same manner as that used in Example 7)-10-3-1, the "MACA-1983a culture supernatant" obtained in Example 7)-10-2-3 was purified by a three-step method, namely rProtein A affinity chromatography, anion exchange chromatography and cation exchange chromatography. The purified sample was named "h198D-H3L4".

[0636] 7) Evaluation of the binding activity of humanized anti-human GARP antibody against human GARP

[0637] The dissociation constant between each of the humanized anti-human GARP antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 produced in Examples 7)-10 and GARP was evaluated by using Biacore T200 (GE Healthcare Bioscience) according to a capture method comprising capturing the antibody as a ligand by immobilized protein A and then analyzing the dissociation constant using an antigen as an analyte. HBS-EP + (manufactured by GE Healthcare Bioscience) was used as a running buffer, and a protein A sensor chip (manufactured by GE Healthcare Bioscience) was used as a sensor chip.

[0638] Human chimeric antibody (1 μg / mL) was added to the chip at a rate of 10 μL / min for 20 seconds, and a dilution series solution of the antigen (8 to 128 nM) was added at a flow rate of 30 μl / min for 120 seconds. Subsequently, dissociation was monitored for 480 seconds. As a regeneration solution, glycine 1.5 (manufactured by GE Healthcare Bioscience) was added at a flow rate of 20 μl / min for 30 seconds.

[0639] A 1:1 fitting model was used in data analysis, and the association rate constant ka, dissociation rate constant kd, and dissociation constant (KD; KD = kd / ka) were calculated.

[0640] The results are shown in Table 2.

[0641] Table 2 Dissociation constants of humanized anti-human GARP antibodies

[0642] [Table 2]

[0643] name KD (nM) 1 h151D-H1L1 1.8 2 h151D-H4L4 1.2 3 h198D-H3L4 0.088

[0644] Example 8: Binding to cells expressing antigen genes

[0645] 8) Binding of β-1 to GARP

[0646] A HEK-293T cell suspension into which a human GARP expression vector or a control vector had been transfected was prepared according to the method described in Example 2. h151D-H1L1, h151D-H4L4, h198D-H3L4, and control human IgG (human IgG: Eureka Therapeutics) were added to the cell suspension, and the cells were incubated at 4°C for 15 minutes.

[0647] The cells were washed twice with FACS buffer (PBS supplemented with 3% FBS (Invitrogen)), and thereafter, R-phycoerythrin (PE)-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) and Horizon FVS450 (Becton Dickinson) were added and suspended. The cells were further incubated at 4°C for 15 minutes. Flow cytometry analysis was performed as described in Example 2, and a histogram of PE fluorescence intensity was generated ( Fig.37 ).

[0648] The histograms of fluorescence intensity of h151D-H1L1, h151D-H4L4, and h198D-H3L4 in HEK-293T cells transfected with the control vector were similar to that of the control IgG (in this figure, the cells are referred to as "mock vector-transfected HEK-293T").

[0649] On the other hand, compared with the histogram for control human IgG, it was confirmed that the histogram for fluorescence intensity of h151D-H1L1, h151D-H4L4, and h198D-H3L4 shifted to the strong fluorescence intensity side in HEK-293T cells expressing GARP (which are referred to as "hGARP-transfected HEK-293T" in the figure).

[0650] Based on the above results, it was found that h151D-H1L1, h151D-H4L4, and h198D-H3L4 specifically bound to GARP.

[0651] 8) Binding of GARP-TGFβ1 to β-2

[0652] 8) Construction of expression vector of human GARP mutant

[0653] Using human GARP expression vector (Origene) as a template, primer F (cacggcaacctgctggagcggctgctgggggagg) (SEQ ID NO: 44), primer R (caggctgttcccagacaggtccag) (SEQ ID NO: 45) and KOD-Plus-Mutagenesis Kit (Toyobo) were used to convert YSG at amino acid positions 137-139 of the human GARP amino acid sequence (SEQ ID NO: 1) to HGN to construct a human GARP mutant expression vector. Then, the nucleotide sequence of the vector was confirmed.

[0654] 8) Co-expression of GARP-TGFβ1

[0655] HEK-293T cells were transfected with human TGFβ1 expression vector (SinoBiological) and human GARP expression vector or human GARP mutant expression vector using Lipofectamine 2000 (Invitrogen).

[0656] The cells were cultured in DMEM medium (Invitrogen) supplemented with 10% FBS at 37°C overnight in 5% CO2, and then harvested from the plate by treating them with TrypLE Express (Invitrogen). The harvested cells were washed twice with FACS buffer and resuspended in the same solution.

[0657] The antibodies 105F, h151D-H1L1, h151D-H4L4 and h198D-H3L4 of the present invention, known antibodies (human IgG1 anti-GARP antibodies MHG8 and LHG10 produced based on the sequence information described in Patent Document 1) and control human IgG (Eureka Therapeutics) were added to the cell suspension, and the cells were incubated at 4°C for 15 minutes.

[0658] The cells were washed twice with FACS buffer, PE-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) and Horizon FVS450 (Becton Dickinson) were added and suspended. The cells were further incubated at 4°C for 15 minutes. Flow cytometry analysis was performed as described in Example 2, and a histogram of PE fluorescence intensity was generated ( Fig.38 ).

[0659] Compared with the histogram of control IgG ( Fig.38 ), it was confirmed that the histograms for all antibodies were shifted toward the strong fluorescence intensity side in HEK-293T cells co-transfected with TGFβ1 and GARP.

[0660] On the other hand, in HEK-293T cells co-transfected with TGFβ1 and GARP mutants, the histograms for MHG8 and LHG10 did not shift and were similar to the histogram for control IgG, while the histograms for antibodies 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 shifted to the strong fluorescence intensity side in the cells. Therefore, as described in [Non-Patent Document 12], it was demonstrated that antibodies MHG8 and LHG10 did not bind to GARP mutants.

[0661] According to the above results, it was demonstrated that antibodies 105F, h151D-H1L1, h151D-H4L4 and h198D-H3L4 bound to both GARP and GARP mutants on cells co-expressing TGFβ1, and it was found that these antibodies bound to regions different from those to which MHG8 and LHG10 antibodies bound.

[0662] Example 9: Binding to endogenous GARP expressing cells

[0663] 9)-1 Flow cytometry analysis using L428 cells

[0664] L428 cells were washed twice with FACS buffer and suspended in the same solution. Thereafter, h151D-H1L1, h151D-H4L4, h198D_H3L4 and control human IgG (human IgG: Eureka Therapeutics) were added to the suspension, and the cells were incubated at 4°C for 15 minutes. The cells were washed twice with FACS buffer, PE-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) was added and suspended. The cells were incubated at 4°C for 15 minutes. Flow cytometry analysis was performed as described in Example 3, and a histogram of PE fluorescence intensity was generated.

[0665] As a result, the histograms for antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 were shifted toward the strong fluorescence intensity side in L428 cells compared to the histogram for control IgG. Therefore, it was confirmed that h151D-H1L1, h151D-H4L4, and h198D-H3L4 bind to endogenously expressed GARP ( Fig.39 ).

[0666] 9)-2 Flow cytometry analysis using human Treg

[0667] Frozen human PBMCs (Cell Technology) were thawed according to the protocol and cultured at 2 × 10 6 Cells / mL were seeded in 24-well plates (Umitomo Bakelite Co., Ltd.).

[0668] Dynabeads Human T-Activator CD3 / CD28 (Life technologies) was added to the plate, and the cells were cultured for 48 hours. Thereafter, the cells were suspended in FACS buffer, and antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 and control human IgG (human IgG: Eureka Therapeutics) were added. APC-labeled anti-CD4 antibody (Becton Dickinson) was also added to the suspension. The cells were incubated at 4°C for 10 minutes.

[0669] The cells were washed with FACS buffer, and thereafter, FITC-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) and Horizon FVS450 (Becton Dickinson) were added and suspended. The cells were further incubated at 4°C for 15 minutes.

[0670] The cells were washed again with FACS buffer and resuspended in solution using FoxP3 Staining Buffer Set (Miltenyi Biotec). After that, PE-labeled anti-Foxp3 antibody (Miltenyi Biotec) was added to the cells and the cells were incubated at 4°C for 30 minutes.

[0671] After washing the cells, the cells were measured using a flow cytometer (FACS Canto II; Becton Dickinson). After removing dead cells from the analysis by gating out cells stained with Horizon FVS450, CD4-positive cells were analyzed using FlowJo (TreeStar).

[0672] The results showed that antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 bound to FoxP3-positive Treg ( Fig.40 ).

[0673] Example 10: Properties of anti-GARP antibodies

[0674] 10)-1 ADCC activity

[0675] According to the method described in Example 4, antibodies h151D-H1L1, h151D-H4L4 and h198D-H3L4, known antibodies (human IgG1 anti-GARP antibodies MHG8 and LHG10 produced based on the sequence information described in Patent Document 1) and control human IgG (Sigma) were analyzed for their ADCC activities.

[0676] Antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 showed cytolytic activity against L428 cells in an antibody concentration-dependent manner ( Fig.41 A).

[0677] In contrast, as described in Example 4, MHG8 and LHG10 did not show cell lytic activity in the same manner as the control human IgG did not ( Fig.41 B).

[0678] Based on the above results, it was demonstrated that antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 had ADCC activity.

[0679] 10)-2 inhibitory activity on Treg function

[0680] Antibodies h151D-H1L1, h151D-H4L4 and h198D-H3L4 were analyzed for their inhibitory activity on Treg function according to the method described in Example 4. At a final concentration of 1 μg / mL, the inhibitory activity of h151D-H1L1, h151D-H4L4 and h198D-H3L4 on Treg function was shown in Fig.42 medium (h151D-H1L1 inhibition rate: 81.5%; h151D-H4L4 inhibition rate: 80.4%; and h198D-H3L4 inhibition rate: 70.8%).

[0681] It was demonstrated that antibodies h151D-H1L1, h151D-H4L4 and h198D-H3L4 had inhibitory activity on Treg function.

[0682] 10)-3 antitumor activity (in vitro)

[0683] 10)-3-1 Preparation of cytotoxic T lymphocytes (CTL)

[0684] According to the protocol from Mie University, CTL cells with NY-ESO-1-specific T cell receptor (MU28CD8B35 clone #7: obtained from Mie University) were cultured at 3 × 10 5 cells in 25 cm 2 The cells were cultured in flasks (Sumitomo Bakelite Co., Ltd.) in RPMI1640 medium (Invitrogen) supplemented with 10% human male AB serum (Sigma) in the presence of anti-CD3 antibody (OKT3: Imgenex), IL-2 (Novartis) and feeder cells for 7 days.

[0685] Regarding feeder cells, frozen human PBMCs (Cellular Technology) were thawed, and CD8-positive cells were removed from PBMCs using CD8 MicroBeads (Miltenyi Biotech) to obtain CD8-depleted PBMCs (7.5 × 10 6 cells / 25 cm 2 flask), and the cells were irradiated with X-rays. In addition, 103-LCL cells (obtained from Riken BioResource Center) (1.5 × 10 6 cells / 25 cm 2 The culture flasks) were also irradiated with X-rays by using an X-ray irradiator (Hitachi Medical Corporation). These cells were used as feeder cells.

[0686] At the beginning of the culture (1.5 × 10 5 cells / 25 cm 2 In the culture flask, Treg obtained by the method described in Example 4)-2-1 was added to evaluate the inhibitory effect of Treg on CTL cell activity. In addition, at the beginning of the culture, Treg obtained by the above method ((7.5 × 10 4 cells / 25 cm 2 flasks) as well as antibodies 105F, h151D-H1L1, h151D-H4L4, h198D-H3L4, and human IgG1 (Enzo) in order to assess the antitumor activity of each antibody.

[0687] After the culture is completed, use CD8 + CD8 positive cells were purified and separated using T Cell Isolation Kit (Miltenyi Biotech) to prepare CTL cells, which were then used for activity evaluation.

[0688] 10)-3-2 Preparation of target cells

[0689] Human melanoma cell line, SK-MEL-52 cells expressing NY-ESO-1 (obtained from Mie University: Proc Natl Acad Sci USA. 1980 Jul; 77(7): 4260-4), was cultured in RPMI1640 medium (Invitrogen) supplemented with 10% FBS. 51 Cr labeling was carried out as described in Example 4)-1-2, and the cells were adjusted to 2 × 10 4The obtained cells are defined as target cells.

[0690] 10) -3-3 51 Cr release assay

[0691] Target cells were dispensed into 96-well U-bottom microplates (Costar) (50 μL / well).

[0692] Subsequently, CTL cells were added to the plate (100 μL / well) so that the number of CTL cells was 16, 8, 4, or 2 times the number of target cells (CTL cells: target cells = 16:1, 8:1, 4:1, or 2:1), and the cells were incubated at 37°C for 4 hours in % CO2. Thereafter, the cells were processed according to the method described in Example 4)-1-3. It should be noted that the inhibitory activity of the sample was calculated each time in each experiment. In addition, it was confirmed that CTL cells did not show cell lytic activity against cells that did not express NY-ESO-1.

[0693] The measurement results are shown in Fig.43 and 44 middle.

[0694] The cytolytic activity of CTL cells against SK-MEL-52 was inhibited by Treg ( Fig.43 ).

[0695] On the other hand, in CTL cells to which antibody 105F, h151D-H1L1, h151D-H4L4, or h198D-H3L4 had been added, the cell lysis rate of CTL cells against SK-MEL-52 cells increased as the number of CTL cells increased, and at any target-effector ratio, the cell lysis rate was also significantly higher than that of control CTL cells to which control IgG had been added ( Fig.44 ).

[0696] Therefore, it was demonstrated that antibodies 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 inhibited the suppressive activity of Treg on CTL cells and enhanced the anti-tumor activity.

[0697] 10)-4 antitumor activity (in vivo)

[0698] It is known that the anti-tumor effect of chimeric antibodies with ADCC activity can be found in NOD / Shi-scid, IL-2R null The expression of L428 cells in the NOG mice was evaluated in mice transplanted with L428 cells and administered with human PBMCs (J Immunol. 2009 Oct 1; 183(7): 4782-91).

[0699] 1×107 L428 cells (DSMZ) suspended in a mixed solution (1:1) of RPMI1640 medium (Invitrogen) and Matrigel (BectonDickinson) at 1:1 were transplanted into the subcutaneous tissue of the axillary region of NOG mice (female, In vivo science) at a volume of 0.1 mL. The date of transplantation of L428 cells was defined as day 0. On day 6, mice were grouped based on tumor volume values ​​(n = 6 in each group), and the administration groups were set as follows.

[0700] PBS control 1: administered on days 6, 10, 14, 18, 22, and 26, and in addition, human PBMC (lot number: 20140707) administered on days 6, 14, and 22

[0701] 105F antibody: 5 mg / kg was administered on days 6, 10, 14, 18, 22, and 26, and in addition, human PBMCs (lot number: 20140707) were administered on days 6, 14, and 22

[0702] PBS control 2: Administered on days 6, 10, 14, 18, 22, and additionally, human PBMC (lot number: 20150924) administered on days 6, 14, and 22

[0703] h151D-H1L1 antibody: administered at a dose of 1 mg / kg on days 6, 10, 14, 18, and 22, and in addition, human PBMCs (lot number: 20150924) were administered on days 6, 14, and 22

[0704] h151D-H4L4 antibody: administered at a dose of 1 mg / kg on days 0, 6, 10, 14, 18, and 22, and in addition, human PBMCs (lot number: 20150924) were administered on days 6, 14, and 22

[0705] h198D-H3L4 antibody: administered at a dose of 1 mg / kg on days 0, 6, 10, 14, 18, and 22, and in addition, human PBMCs (lot number: 20150924) were administered on days 6, 14, and 22.

[0706] Each antibody was diluted with PBS (Invitrogen) and administered to mice via the tail vein (10 mL / kg).

[0707] For human PBMC, frozen human PBMC (Cellular Technology) were thawed according to the protocol and cultured at 1 × 10 7The prepared cells (0.2 mL) were administered to mice via the tail vein.

[0708] Using an electronic digital caliper (Mitutoyo), the long diameter (mm) and short diameter (mm) of the tumor were measured over time, and the volume of the tumor was calculated according to the following expression.

[0709] Tumor volume (mm3) = 1 / 2 × [longer diameter of the tumor] × [shorter diameter of the tumor] × [shorter diameter of the tumor]

[0710] The changes in the mean ± standard error (SE) of tumor volume in each group are shown in Fig.45 middle.

[0711] Compared with the control group to which only PBMC was administered, antibodies 105F, h151D-H1L1, h151D-H4L4 and h198D-H3L4 showed antitumor activity against L428 cells. Therefore, significant differences were observed with respect to the control group (105F: t test; and h151D-H1L1, h151D-H4L4 and h198D-H3L4: Dunnett's multiple comparison test). The figure also shows the results of the significant difference test (P value) at the last measurement day of each group (105F: day 31; and h151D-H1L1, h151D-H4L4 and h198D-H3L4: day 25).

[0712] Thus, antibodies 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 showed anti-tumor activity in in vivo models.

[0713] Example 11: Epitope analysis of anti-GARP antibodies

[0714] The epitopes of anti-human GARP antibodies (105F, 110F, h151D-H1L1, and h198D-H3L4) were analyzed by hydrogen-deuterium exchange mass spectrometry.

[0715] 7 mg / mL anti-human GARP antibody was mixed with 3 mg / mL human GARP (R&D Systems) or in an equal volume of blank buffer. 9 equivalents of light water or heavy water were added to the obtained solution. After 30 seconds, 480 seconds or 6000 seconds of adding water, or after one night, an equal amount of 100 mM phosphoric acid, 4 M Gdn-HCl and 150 mM TCEP (pH 2.5) were added to the sample, and the obtained mixture was subjected to deuterium substitution. Such a deuterium-substituted sample was injected into HPLC under cooling, and then it was supplied to a fixed pepsin column with a 0.1% TFA solution.

[0716] The peptide fragments obtained by digesting human GARP in a pepsin column were retained in a C18 capture column, and then eluted by a linear gradient of water and acetonitrile to which 0.1% formic acid and 0.025% TFA had been added, and then separated in a C18 analytical column. The separated peptide fragments were subjected to mass spectrometry using a time-of-flight mass spectrometer.

[0717] The deuterium substitution rate was calculated based on the mass of each peptide. Peptide fragments in which a significant decrease in the deuterium substitution rate was observed due to the addition of the anti-human GARP antibody were identified as epitope fragments.

[0718] In the case of 105F, suppression of the deuterium substitution rate was found in the amino acid residues at positions 366-377, 407-445, and 456-470 of human GARP shown in SEQ ID NO: 1, and thus, they were identified as epitopes.

[0719] In the case of 110F, suppression of the deuterium substitution rate was found in the amino acid residues at positions 54-112 and 366-392 of human GARP shown in SEQ ID NO: 1, and thus, they were identified as epitopes.

[0720] In the case of h151D-H1L1, suppression of the deuterium substitution rate was found in the amino acid residues at positions 352 to 392 of human GARP shown in SEQ ID NO: 1, and thus, they were identified as epitopes.

[0721] In the case of h198D-H3L4, suppression of the deuterium substitution rate was found in the amino acid residues at positions 18 to 112 of human GARP shown in SEQ ID NO: 1, and thus, they were identified as epitopes.

[0722] Industrial Applicability

[0723] The anti-GARP antibody of the present invention has anti-tumor activity caused by inhibitory activity on Treg function mediated by ADCC activity, and therefore, a pharmaceutical composition containing the anti-GARP antibody can be used as an anticancer agent.

[0724] In addition, the over-presence of Tregs and their activation in patients with malaria and HIV infection have been shown to correlate with disease states, and the removal of Tregs induces remission of each disease in mouse models for the disease. Accordingly, it can be expected that effective inhibition of Treg function will also have a therapeutic effect on refractory infections such as malaria and HIV.

[0725] Sequence Listing Free Text

[0726] SEQ ID NO: 1 - Amino acid sequence of GARP

[0727] SEQ ID NO: 2 - Amino acid sequence of 105F antibody heavy chain

[0728] SEQ ID NO: 3 - Amino acid sequence of 105F antibody light chain

[0729] SEQ ID NO:4 - Amino acid sequence of 110F antibody heavy chain

[0730] SEQ ID NO: 5 - Amino acid sequence of 110F antibody light chain

[0731] SEQ ID NO: 6 - Nucleotide sequence of 105F antibody heavy chain

[0732] SEQ ID NO: 7 - Nucleotide sequence of 105F antibody light chain

[0733] SEQ ID NO: 8 - Nucleotide sequence of 110F antibody heavy chain

[0734] SEQ ID NO: 9 - Nucleotide sequence of 110F antibody light chain

[0735] SEQ ID NO: 10 - Primer A

[0736] SEQ ID NO: 11 - Primer B

[0737] SEQ ID NO: 12 - Primer C

[0738] SEQ ID NO: 13 - Primer D

[0739] SEQ ID NO: 14 - Nucleotide sequence of cDNA encoding 151D heavy chain variable region

[0740] SEQ ID NO: 15 - 151D Amino acid sequence of heavy chain variable region

[0741] SEQ ID NO: 16 - Nucleotide sequence of cDNA encoding 151D light chain variable region

[0742] SEQ ID NO: 17 - Amino acid sequence of 151D light chain variable region

[0743] SEQ ID NO: 18 - Nucleotide sequence of cDNA encoding 198D heavy chain variable region

[0744] SEQ ID NO: 19-198D amino acid sequence of heavy chain variable region

[0745] SEQ ID NO: 20 - Nucleotide sequence of cDNA encoding 198D light chain variable region

[0746] SEQ ID NO: 21 - Amino acid sequence of 198D light chain variable region

[0747] SEQ ID NO: 22 - Nucleotide sequence of a DNA fragment comprising a human light chain signal sequence and a sequence encoding amino acids in a human kappa chain constant region

[0748] SEQ ID NO: 23 - Nucleotide sequence of a DNA fragment comprising a human heavy chain signal sequence and a sequence encoding amino acids in a human IgG1 constant region

[0749] SEQ ID NO: 24 - Nucleotide sequence of human chimeric antibody c151D heavy chain

[0750] SEQ ID NO: 25 - Amino acid sequence of the heavy chain of human chimeric antibody c151D

[0751] SEQ ID NO: 26 - Nucleotide sequence of human chimeric antibody c151D light chain

[0752] SEQ ID NO: 27 - Amino acid sequence of human chimeric antibody c151D light chain

[0753] SEQ ID NO: 28 - Nucleotide sequence of human chimeric antibody c198D heavy chain

[0754] SEQ ID NO: 29 - Amino acid sequence of the heavy chain of human chimeric antibody c198D

[0755] SEQ ID NO: 30 - Nucleotide sequence of human chimeric antibody c198D light chain

[0756] SEQ ID NO: 31 - Amino acid sequence of human chimeric antibody c198D light chain

[0757] SEQ ID NO: 32 - Nucleotide sequence of humanized antibody h151D-H1

[0758] SEQ ID NO: 33 - Amino acid sequence of humanized antibody h151D-H1

[0759] SEQ ID NO: 34 - Nucleotide sequence of humanized antibody h151D-H4

[0760] SEQ ID NO: 35 - Amino acid sequence of humanized antibody h151D-H4

[0761] SEQ ID NO: 36 - Nucleotide sequence of humanized antibody h151D-L1

[0762] SEQ ID NO: 37 - Amino acid sequence of humanized antibody h151D-L1

[0763] SEQ ID NO: 38 - Nucleotide sequence of humanized antibody h151D-L4

[0764] SEQ ID NO: 39 - Amino acid sequence of humanized antibody h151D-L4

[0765] SEQ ID NO: 40 - Nucleotide sequence of humanized antibody h198D-H3

[0766] SEQ ID NO:41 - Amino acid sequence of humanized antibody h198D-H3

[0767] SEQ ID NO: 42 - Nucleotide sequence of humanized antibody h198D-L4

[0768] SEQ ID NO: 43 - Amino acid sequence of humanized antibody h198D-L4

[0769] SEQ ID NO: 44 - Primer F

[0770] SEQ ID NO:45—Primer R.

Claims

1. An immunoconjugate comprising an antibody and another drug, wherein the antibody specifically binds to a glycoprotein A repeat dominant sequence and is conjugated to the drug, and wherein the antibody has: (1) CDRH1 consisting of the amino acid sequence at amino acid positions 45 to 54 as set forth in SEQ ID NO:25, CDRH2 consisting of the amino acid sequence at amino acid positions 69 to 78 as set forth in SEQ ID NO:25, and CDRH3 consisting of the amino acid sequence at amino acid positions 118 to 125 as set forth in SEQ ID NO:25, and CDRL1 consisting of the amino acid sequence at amino acid positions 44 to 54 as set forth in SEQ ID NO:27, CDRL2 consisting of the amino acid sequence at amino acid positions 70 to 76 as set forth in SEQ ID NO:27, and CDRL3 consisting of the amino acid sequence at amino acid positions 109 to 117 as set forth in SEQ ID NO:27, or (2) CDRH1 consisting of the amino acid sequence at amino acid positions 45 to 54 as shown in SEQ ID NO:29, CDRH2 consisting of the amino acid sequence at amino acid positions 69 to 77 as shown in SEQ ID NO:29, and CDRH3 consisting of the amino acid sequence at amino acid positions 117 to 128 as shown in SEQ ID NO:29, and CDRL1 consisting of the amino acid sequence at amino acid positions 44 to 54 as shown in SEQ ID NO:31, CDRL2 consisting of the amino acid sequence at amino acid positions 70 to 76 as shown in SEQ ID NO:31, and CDRL3 consisting of the amino acid sequence at amino acid positions 109 to 117 as shown in SEQ ID NO:

31.

2. The immunoconjugate according to claim 1, wherein the antibody has inhibitory activity on the immunosuppressive function of regulatory T cells.

3. The immunoconjugate according to claim 1, wherein the antibody has antibody-dependent cellular cytotoxicity activity.

4. The immunoconjugate according to claim 1, wherein the antibody has in vivo anti-tumor activity.

5. The immunoconjugate according to claim 1, wherein the glycoprotein A repeat dominant sequence is a molecule consisting of the amino acid sequence shown in SEQ ID NO:

1.

6. The immunoconjugate according to claim 4, wherein the tumor is a cancer.

7. The immunoconjugate according to claim 6, wherein the cancer is lung cancer, renal cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, gastric cancer, esophageal cancer or a blood cancer.

8. The immunoconjugate according to claim 1, wherein the antibody has: (1) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 136 as shown in SEQ ID NO: 25, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 as shown in SEQ ID NO: 27, or (2) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 139 shown in SEQ ID NO: 29, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 shown in SEQ ID NO:

31.

9. The immunoconjugate according to claim 1, wherein the constant region of the antibody is a human-derived constant region.

10. The immunoconjugate according to claim 1, wherein the antibody has: (1) a heavy chain consisting of the amino acid sequence at amino acid positions 20 to 466 as shown in SEQ ID NO: 25, and a light chain consisting of the amino acid sequence at amino acid positions 21 to 234 as shown in SEQ ID NO: 27, or (2) a heavy chain consisting of the amino acid sequence at amino acid positions 20 to 469 shown in SEQ ID NO: 29, and a light chain consisting of the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO:

31.

11. The immunoconjugate according to claim 1, wherein the antibody is humanized.

12. The immunoconjugate according to claim 11, wherein the antibody has: (1) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 136 as shown in SEQ ID NO: 33, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 as shown in SEQ ID NO: 37, (2) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 136 as shown in SEQ ID NO: 35, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 as shown in SEQ ID NO: 39, or (3) a heavy chain variable region consisting of the amino acid sequence at amino acid positions 20 to 139 shown in SEQ ID NO: 41, and a light chain variable region consisting of the amino acid sequence at amino acid positions 21 to 129 shown in SEQ ID NO:

43.

13. The immunoconjugate according to claim 11, wherein the antibody has: (1) a heavy chain having the amino acid sequence at amino acid positions 20 to 466 shown in SEQ ID NO: 33, and a light chain having the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO: 37, (2) a heavy chain having the amino acid sequence at amino acid positions 20 to 466 as shown in SEQ ID NO: 35, and a light chain having the amino acid sequence at amino acid positions 21 to 234 as shown in SEQ ID NO: 39, or (3) a heavy chain having the amino acid sequence at amino acid positions 20 to 469 shown in SEQ ID NO:41, and a light chain having the amino acid sequence at amino acid positions 21 to 234 shown in SEQ ID NO:

43.

14. The immunoconjugate according to any one of claims 1 to 4 and 7 to 13, wherein the antibody comprises one, two or more modifications selected from the group consisting of N-linked glycosylation, O-linked glycosylation, N-terminal processing, C-terminal processing, deamidation, isomerization of aspartic acid, oxidation of methionine, addition of methionine residues to the N-terminus, amidation of proline residues, and a heavy chain comprising a deletion of one or two amino acids at the carboxyl terminus.

15. The immunoconjugate according to claim 14, wherein one or two amino acids are deleted at the carboxyl terminus of its heavy chain.

16. The immunoconjugate according to claim 15, wherein one amino acid is deleted at each carboxyl terminus of its two heavy chains.

17. The immunoconjugate according to claim 14, wherein the proline residue at the carboxyl terminus of its heavy chain is further amidated.

18. The immunoconjugate according to any one of claims 1 to 4 and 7 to 13, wherein the sugar chain modification is modulated so as to enhance antibody-dependent cellular cytotoxicity.

19. The immunoconjugate according to any one of claims 1 to 4 and 7 to 13, wherein the drug is a radioactive substance or a compound having a pharmacological effect.

20. The immunoconjugate according to claim 19, wherein the radioactive substance is 111 In, 99m Tc, 90 Y or 131 I.

21. A pharmaceutical composition comprising at least one of the immunoconjugates according to any one of claims 1 to 20.

22. Use of the pharmaceutical composition according to claim 21 in the preparation of a medicament for tumor treatment.

23. Use according to claim 22, wherein the tumor is cancer.

24. Use according to claim 23, wherein the cancer is lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer or a blood cancer.

Images