Application of Lactobacillus johnsonii in the preparation of drugs for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia environment

Abstract

The present invention relates to the use of Lactobacillus johnsonii in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high-altitude hypoxia. The use of miR‑122‑5p in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high-altitude hypoxia, the sequence of the miR‑122‑5p is: uggagugugacaaugguguuug. The use of Lactobacillus johnsonii YH1136 in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high-altitude hypoxia. The present invention discloses for the first time the use of Lactobacillus johnsonii YH1136 to treat and prevent intestinal barrier damage caused by high-altitude hypoxia, and for the first time determines the role of miR‑122‑5p therein. Compared with other existing drugs for preventing and treating intestinal barrier damage, Lactobacillus johnsonii YH1136 has a safer and more stable effect.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial application, and in particular to the application of Lactobacillus johnsonii in the preparation of a medicine for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia environment. Background Art

[0002] At high altitudes in plateau areas, the structure and function of the body, including the intestines, will be damaged. The hypoxic environment of the plateau will cause gastrointestinal stress response, accompanied by intestinal mucosal damage, which will lead to bacterial and endotoxin translocation, inducing systemic inflammatory response syndrome and multiple organ dysfunction. One of the important reasons for damage to the intestinal mucosal barrier is hypoxia. The oxygen content in the plateau is significantly lower than that in low-altitude areas. In order to adapt to the plateau environment, the body will experience physiological changes such as increased hemoglobin content and increased oxygen carrying capacity. At the same time, there will also be adverse reactions such as increased circulatory system resistance, impaired immune system, and decreased arterial oxygen partial pressure. Zheng Bihai et al. conducted multiple tests on 20 individuals who entered the plateau from the plains. The results showed that acute hypoxia in the plateau can lead to acute gastrointestinal mucosal damage. Its mechanism of action is mainly gastrointestinal motility disorders, inflammatory reactions, and free radical damage. Wu Wenming and others explored the mechanism of intestinal mucosal damage caused by plateau hypoxia conditions by establishing a rat model of plateau hypoxia. The study showed that hypoxia induced the upregulation of the expression of hypoxia-inducible factor HIF-1α and iNOS protein in the intestinal mucosa; HIF-1α may be involved in the expression process of iNOS protein in intestinal tissue and intestinal mucosal damage.

[0003] Drugs commonly used in the treatment of gastrointestinal barrier function can be divided into the following categories: First, immune nutrients, such as glutamine, arginine, ω-3 fatty acids and dietary fiber, can provide calories, block anaerobic glycolysis, and effectively improve the immune function of the gastrointestinal tract; second, recombinant human growth hormone (rhGH), which can reduce intestinal mucosal permeability, enhance intestinal immunity, stimulate intestinal mucosal epithelial regeneration, repair and promote the recovery of intestinal mucosal structure and function; third, epidermal growth factor (EGF), which can enhance the nutritional effect of glutamine on the small intestinal mucosa and reduce damage to gastrointestinal tissue; fourth, traditional Chinese medicine. Some traditional Chinese medicine decoctions have the effect of strengthening the gastric mucosal defense mechanism.

[0004] However, the above-mentioned drugs also have certain limitations. Immunonutrients, recombinant human growth hormone and epidermal growth factor are mostly administered by subcutaneous injection, which is not convenient and the price of the drugs is relatively expensive. The mechanism of action and safety of traditional Chinese medicine still need to be studied and determined. Summary of the invention

[0005] In view of this, it is necessary to provide the use of Lactobacillus johnsonii in the preparation of drugs for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia environment in order to address the above problems.

[0006] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides use of miR-122-5p in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia environment, wherein the sequence of miR-122-5p is: uggagugugacaaugguguuug.

[0008] In a second aspect, the present invention provides the use of an agent for inhibiting the expression of miR-122-5p in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia.

[0009] Furthermore, the agent for inhibiting the expression of miR-122-5p includes Lactobacillus johnsonii YH1136.

[0010] Furthermore, the Lactobacillus johnsonii YH1136 is deposited in the China Center for Type Culture Collection, with the deposit number: CCTCC M 20221116, the strain name: Lactobacillus johnsonii YH1136, and the deposit time: July 15, 2022.

[0011] In a third aspect, the present invention provides the use of Lactobacillus johnsonii YH1136 in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia.

[0012] Furthermore, the bacterial solution concentration of Lactobacillus johnsonii YH1136 is 10 8 CFU / mL.

[0013] Further, the processing process of the Lactobacillus johnsonii YH1136 includes:

[0014] After the activation of Lactobacillus johnsonii YH1136, it was inoculated into sterilized MRS liquid medium and cultured at 37℃ for 24h. The viable bacteria were counted, and then the bacterial solution was divided and centrifuged at 3000r / min and 4℃ for 15min. The supernatant was discarded to collect the bacteria. The cells were resuspended to the initial volume with pH7.0 PBS buffer, mixed and centrifuged again for 15min, and repeated twice; finally, the cells were resuspended in PBS buffer, and the concentration of the bacterial solution was adjusted to 10 according to the viable bacteria count results. 8 CFU / mL, stored at 4℃ for future use.

[0015] In a fourth aspect, the present invention provides a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia environment, wherein the drug comprises an agent for inhibiting the expression of miR-122-5p.

[0016] Furthermore, the reagent includes Lactobacillus johnsonii YH1136.

[0017] Furthermore, the drug also includes a pharmaceutically acceptable carrier.

[0018] Furthermore, the drug is in the form of a liquid dosage form.

[0019] The advantages and beneficial effects of the present invention are:

[0020] The present invention discloses for the first time the use of Lactobacillus johnsonii YH1136 to inhibit the expression of miR-122-5p to treat and / or prevent intestinal barrier damage caused by high altitude hypoxia environment, and for the first time determines the role of miR-122-5p therein. Compared with other existing drugs for preventing and treating intestinal barrier damage, Lactobacillus johnsonii YH1136 has a safer and more stable effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Intestinal barrier function detection index, * indicates significant difference P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001, and no * indicates no significant difference;

[0022] Figure 2 Statistics for differential expression analysis results;

[0023] Figure 3 Bubble plot for Go enrichment analysis A. HA vs HAP BC vs HA;

[0024] Figure 4 KEGG pathway enrichment bubble diagram A. HA VS HAP BC VS HA. DETAILED DESCRIPTION

[0025] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0026] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0027] Embodiment 1:

[0028] This embodiment provides the use of an agent for inhibiting the expression of miR-122-5p in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia.

[0029] The reagent for inhibiting the expression of miR-122-5p includes Lactobacillus Johnsonii YH1136. The Lactobacillus Johnsonii YH1136 of the present invention is isolated by Guangdong Yihe Biotechnology Co., Ltd. The strain isolation and identification method of Lactobacillus Johnsonii YH1136 (CCTCC M20221116) is as follows:

[0030] 1. Take the feces of healthy children in Bange County, Nagqu Prefecture, Tibet Autonomous Region, mix it with 0.8% sterile saline at a ratio of 1:49, and then use a shaker at a speed of 200r / min for 30min. Take 1mL of the suspension and dilute it in equal proportions to 10 -8 . Take 100 μL of the dilution and spread it on an MRS plate, incubate it anaerobically at 37°C for 36 hours, then pick a typical single colony for Gram staining and observe it under a microscope. Based on the colony morphology and the results of staining and microscopy, pick a single colony for further streaking and purification culture. After purification and culture, pick a single colony and inoculate it into MRS liquid culture medium for expanded culture. Preliminary screening of potential lactobacilli, and the next step of acid and bile resistance experiment, among which the lactic acid bacteria provided by the present invention is temporarily named lactic acid bacteria YH1136.

[0031] 2. Activate the lactic acid bacteria liquid in MRS liquid culture medium for 3 generations, then inoculate it in MRS liquid culture medium with pH=3.0 and pH=6.4 at an inoculum size of 2%, and culture it anaerobically at 37°C for 12 hours; at the same time, inoculate it in 0.3% ox bile salt MRS liquid culture medium at an inoculum size of 2%, and culture it anaerobically at 37°C for 12 hours. Detect the change in the number of viable bacteria during the culture period, and repeat the experiment 3 times to take the average value. The experimental results show that the lactic acid bacteria YH1136 provided by the present invention still grows well after being cultured in MRS liquid culture medium with pH6.4 for 12 hours; and the number of viable bacteria is still 2.0×10 7 CFU / mL, which indicates that lactic acid bacteria YH1136 has strong acid resistance and bile salt tolerance, and has the ability to colonize in the intestine, and the colonization can reach a certain number, which meets the requirement of probiotics to exert their effects. 6 The specific results are shown in Table 1.

[0032] strain pH 6.4 pH 3.0 0.3% bile resistance test (CFU / mL) Lactic acid bacteria YH1136 +++ ++ <![CDATA[2×10 7 CFU / mL]]>

[0033] Note: +++ means excellent growth; ++ means good growth. 9 , 10 6 , 10 3 CFU / mL) was used as a control to determine the growth status. The culture medium without turbidity was considered to have no growth, and the turbidity was less than 10 3CFU / mL is considered to be slight growth, and turbidity is 10 3 CFU / mL and 10 6 CFU / mL is considered normal growth, and turbidity is higher than 10 6 CFU / mL is less than 10 9 CFU / mL is considered good growth, and turbidity is close to 10 9 CFU / mL was considered excellent growth.

[0034] 3. Take the lactic acid bacteria YH1136 bacterial liquid and activate it for 3 generations, then inoculate it into MRS-CHOL medium (MRS broth medium with a cholesterol content of 0.1 mg / mL by ultrasonic crushing and using a membrane filtration method), and after anaerobic culture at 37°C for 24 hours, measure the mass fraction of cholesterol in the bacterial liquid supernatant, washing liquid, and cell crushing liquid by the o-phthalaldehyde method, take the MRS-CHOL medium without lactic acid bacteria YH1136 bacterial liquid as a blank control, and calculate the removal rate of cholesterol in the medium according to the mass fraction of cholesterol in the supernatant, and repeat the test 3 times to take the average value. The experimental results show that the removal rate of cholesterol in the supernatant of lactic acid bacteria YH1136 of the present invention is the highest, which is 38.75%, the removal rate of washing liquid is 33.22%, and the removal rate of cell crushing liquid is the lowest, which is 28.03% (see Table 2). This shows that lactic acid bacteria YH1136 of the present invention has a good effect of degrading cholesterol.

[0035] strain Cell disruption fluid removal rate (%) Washing liquid removal rate (%) Supernatant removal rate (%) YH1136 28.03 33.22 38.75

[0036] 4. Use The total DNA of lactic acid bacteria YH1136 was extracted using the DNA Stool Mini Kit, and the total DNA was detected by 2% agarose gel electrophoresis. The full length of 16S rDNA of the total genomic DNA was PCR amplified using specific primers 27F and 1492R, and the amplified product was detected by 1.0% agarose gel electrophoresis, and then the amplified product was purified using the kit. The purified product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results are shown below. The 16S rDNA sequence of the lactic acid bacteria YH1136 was uploaded to the website of the National Center for Bioinformatics (NCBI) of the United States, and the accession number (Accession) was OP049985. After Blast comparison on the NCBI website, it was most closely related to Lactobacillus johnsonii YH1136, with a homology of up to 99.79%. Therefore, the target lactic acid bacteria YH1136 was identified as Lactobacillus johnsonii YH1136 and deposited in the China Center for Type Culture Collection on July 15, 2022. The collection address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the collection number is CCTCC M 20221116.

[0037] The results of 16S rDNA sequencing are as follows:

[0038]

[0039] Embodiment 2:

[0040] This embodiment provides the use of miR-122-5p in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia environment. The sequence of the miR-122-5p is: uggagugugacaaugguguuug.

[0041] Embodiment 3:

[0042] This embodiment provides the use of Lactobacillus johnsonii YH1136 in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia. The bacterial solution concentration of Lactobacillus johnsonii YH1136 is 10 8 CFU / mL.

[0043] The processing process of the Lactobacillus johnsonii YH1136 comprises:

[0044] The Lactobacillus johnsonii YH1136 strain was activated for 3 generations. The strain stored at -80℃ was taken out of the refrigerator and quickly dissolved at 37℃. Then the bacterial solution was transferred to a small amount of MRS liquid culture medium for culture and inoculation. The culture conditions were 37℃, 24h, and the inoculation ratio was 2%. After culturing at 37℃ for 24h in the sterilized MRS liquid culture medium, the viable bacteria were counted, and then the bacterial solution was divided and centrifuged at 3000r / min and 4℃ for 15min. The supernatant was discarded to collect the bacteria. Resuspended to the initial volume with pH7.0 PBS buffer, mixed and centrifuged again for 15min, repeated twice; finally, the bacteria were resuspended in PBS buffer, and the concentration of the bacterial solution was adjusted to 10 according to the viable bacteria count results. 8 CFU / mL, stored at 4℃ for future use.

[0045] Embodiment 4:

[0046] This embodiment provides a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia, wherein the drug includes an agent that inhibits the expression of miR-122-5p. The agent includes Lactobacillus johnsonii YH1136, or includes other agents that can inhibit the expression of miR-122-5p. In addition, the drug also includes a pharmaceutically acceptable carrier. The acceptable carrier used in this application is a PBS buffer solution with a pH of 7.0. The drug is in the form of a liquid dosage form.

[0047] Embodiment 5:

[0048] 1. Experimental animals and experimental design:

[0049] Thirty-six C57BL / 6J mice of the same age and similar weight (purchased from Dashuo Biological Research Institute, Chengdu, China) were randomly divided into three groups. They were allowed to adapt to the new environment for one week before the experiment. During the adaptation period, they were fed with a basic diet and ordinary drinking water. The treatment of the three groups was as follows: the first group of mice was placed in a hypobaric oxygen chamber and fed normally, serving as the high altitude group (HA group); the second group of mice was also raised in a hypobaric oxygen chamber, and the mice in the group were gavaged with 0.2 mL of Lactobacillus johnsonii YH1136 bacterial solution (10 8 CFU / mL), as the plateau probiotics group (HAP group); the last group was used as the control group (C group) and was fed under normal air pressure (about 94.5KPa). The low pressure level in the hypobaric oxygen chamber was maintained at about 40-45KPa to simulate the air pressure environment at an altitude of 4000m, and the temperature and humidity were consistent with those outside the cabin. The HA group and the HAP group were fed in the hypobaric oxygen chamber for 14 days, and the oxygen chamber was opened once a day (1h) for gavage and water and food were replenished. All animal experiments were carried out in accordance with the Guidelines for the Care and Use of Laboratory Animals approved by the Committee of Sichuan Agricultural University (Approval No.: SYXKchuan2019-187). All animals were kept in the animal room of the Animal Microecology Research Center of Sichuan Agricultural University, with a 12-hour day and night cycle.

[0050] 2. Cultivation of strains and preparation of bacterial suspension:

[0051] The experimental strain is Lactobacillus Johnsonii YH1136. YH1136 has been proven to have good therapeutic effects in the treatment and prevention of non-alcoholic fatty liver disease, necrotic enteritis in broilers and other pathological processes. However, there are currently no reports on the research and application of Lactobacillus johnsonii YH1136 in the treatment of intestinal mucosal damage caused by plateau hypoxia. After the bacteria are activated, they are inoculated into sterilized MRS liquid culture medium and cultured at 37°C for 24 hours, and then the viable bacteria are counted. The bacterial solution is then divided into portions, centrifuged at 3000r / min and 4°C for 15 minutes, and the supernatant is discarded to collect the bacteria. Resuspend to the initial volume with PBS buffer at pH 7.0, mix well and centrifuge again for 15 minutes, and repeat twice. Finally, the bacteria are resuspended in PBS buffer, and the concentration of the bacterial solution is adjusted to 10 according to the viable bacteria count results. 8 CFU / mL, stored at 4℃ for future use.

[0052] 3. Sample collection:

[0053] Six mice were randomly selected from each group and sacrificed by cervical dislocation on day 15. The intestinal segments were separated and 0.5 cm ileum segments were collected, washed with cold DEPC, and stored in liquid nitrogen at -80°C for future use.

[0054] 4. Evaluation of intestinal damage in mice:

[0055] Before killing the mice, 0.5-1 mL of blood was collected by orbital blood sampling. The blood was then placed in a 4°C refrigerator for 30 min, and centrifuged at 2000 x g for 20 min at 4°C. After centrifugation, the serum was aspirated with an enzyme-free pipette and stored at -30°C. The ELISA kit (Shanghai ELISA Biotechnology) was used to detect the content of D-lactic acid and DAO in the serum.

[0056] 5. miRNA sequencing and analysis:

[0057] The sample RNA was extracted and sent to a biological company for sequencing to obtain the original data. Then the differential expression analysis of miRNA was performed, and the target gene prediction, Go function analysis and KEGG pathway analysis of the screened differentially expressed miRNA were further performed. By analyzing the genes and functions of the miRNAs that were significantly different between the HAP group supplemented with probiotics and the HA group exposed to high altitude, it was clarified how the probiotic Lactobacillus johnsonii YH1136 played an inhibitory role in the process of intestinal damage caused by high altitude hypoxia by regulating the expression of miRNA.

[0058] Experimental results:

[0059] 1. Evaluation of intestinal barrier damage in mice:

[0060] We used ELISA kits to detect the levels of D-lactic acid and DAO (diamine oxidase) in mouse serum. The levels of D-lactic acid and DAO in serum are usually used to evaluate intestinal barrier function. When the intestinal mucosa is damaged or the permeability increases, a large amount of D-lactic acid and DAO produced by bacteria in the intestine enter the blood through the damaged mucosa, increasing the levels of D-lactic acid and DAO in the blood. Therefore, by measuring the levels of D-lactic acid and DAO in the blood, it can reflect the damage to the intestinal mucosa and the changes in permeability to a certain extent. The results are as follows: Figure 1 As shown in the figure, * indicates significant difference P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001, and NS means not significant, indicating that the difference is not significant. The levels of D-lactic acid and DAO in the serum of the HA group were significantly higher than those of the C group and the HAP group, and there was no significant difference in the levels of the two substances between the HAP group and the C group. This suggests that the plateau environment may increase the permeability of the intestinal mucosa of mice or damage the intestinal barrier, and the use of Lactobacillus johnsonii YH1136 for prevention and treatment can alleviate these effects to a certain extent.

[0061] 2. Differential expression analysis of known miRNAs:

[0062] According to the expression data of miRNA in each sample, DEseq (version 1.18.0, Anders S and Huber W, 2010) was used to perform differential expression analysis of miRNA, and differentially expressed miRNAs were screened according to the fold difference of expression (|log2foldchange|>1) and the significance of expression difference (P-value<0.05). The results of differentially expressed miRNAs in each group were compared as follows: Figure 2 As shown. Among them, a total of 22 differentially expressed miRNAs were screened between the control group and the plateau group, including 11 up-regulated expressions (i.e., the expression level of the plateau group was higher than that of the control group, and the same is true below) and 11 down-regulated expressions (the expression level of the plateau group was lower than that of the control group); a total of 9 differentially expressed miRNAs were screened between the control group and the plateau probiotics group, of which 4 were up-regulated and 5 were down-regulated; a total of 13 differentially expressed miRNAs were screened between the plateau group and the plateau probiotics group, of which 8 were up-regulated and 5 were down-regulated. All differentially expressed miRNAs are shown in Tables 1, 2, and 3. In combination with the objectives of the experiment, we will focus on the differentially expressed miRNAs between the control group and the plateau group and between the plateau group and the plateau probiotics group for subsequent analysis.

[0063] Table 1 Differentially expressed miRNAs in the plateau group and the plateau probiotic group (up-regulated expression means that the former is higher than the latter, that is, the expression level of the miRNA in the HA group is higher than that in the HAP group, and down-regulated expression means the opposite, the same as in the following table.)

[0064]

[0065] Table 2 Differentially expressed miRNAs between the control group and the plateau group

[0066]

[0067]

[0068] Table 3 Differentially expressed miRNAs between the control group and the plateau probiotics group

[0069]

[0070] 3. Prediction and functional analysis of miRNA target genes:

[0071] As an important regulator of biological processes, miRNA uses its target genes to exert regulatory effects. MiRNA mainly binds to the target site through complementary pairing. We use miranda to predict the target genes of differentially expressed miRNA sequences with the 3'UTR sequence of mouse mRNA as the target sequence. According to the results of Go enrichment, the degree of enrichment is evaluated by the enrichment factor, FDR value, and the number of target genes enriched on the Go item. The larger the enrichment factor, the higher the degree of enrichment. FDR takes values ​​of 0-1, and the closer to 0, the more significant the enrichment effect. A total of 36 miRNAs were aligned to target genes, and the number of predicted target genes was 14753. Then, topGo was used to perform Go enrichment analysis on the predicted genes. During the analysis, the differential miRNA target genes annotated by Go terms were used to calculate the list of miRNA target genes and the number of miRNA target genes for each term. Then, the P-value was calculated by the hypergeometric distribution method (the standard for significant enrichment was P-value < 0.05), and the Go terms with significantly enriched differential miRNA target genes compared with the entire genome background were found, thereby determining the main biological functions performed by the differential miRNA target genes ( Figure 3 ).Depend on Figure 3 It can be seen that the Go analysis of the plateau group and the plateau probiotic group showed that the target genes of differentially expressed miRNAs were mainly enriched in cell process, biological process, regulation of cell process, regulation of biological process and cellular response to stimulus. The target genes of differentially expressed miRNAs in the control group and the plateau group were mainly enriched in cell process, biological process and signal transduction. The enrichment degree of target genes in pathways was analyzed using the KEGG database, and the enrichment factor, FDR value and number of target genes were also used to evaluate the enrichment degree. Figure 4The top 20 KEGG pathways with the smallest FDR value were obtained. The results showed that the differentially expressed miRNA target genes between the plateau group and the plateau probiotic group were mainly enriched in olfactory transduction, pathways of cancer, MAPK signaling pathway, and AMPK pathway. The differentially expressed miRNA target genes between the control group and the plateau were mainly enriched in pathways of cancer, MAPK signaling pathway, AMPK signaling pathway, and Wnt signaling pathway. It can be seen that multiple signaling pathways, mainly MAPK, Wnt, and AMPK signaling pathways, may play a role in intestinal damage induced by plateau hypoxia, and the intervention of probiotics may regulate through multiple pathways. MAPK, or mitogen-activated protein kinase, is a class of serine-threonine protein kinases that can be activated by different extracellular stimuli (cytokines, neurotransmitters, hormones, stress, etc.). It is an important transmitter of signals from the cell surface to the nucleus. The Wnt signaling pathway is a complex protein action network that plays a role in embryos and cancers, but also participates in the normal physiological processes of cells. Studies have found that the Wnt pathway is a key regulator of intestinal epithelial cell proliferation. Wnt / β-catenin is a key regulatory pathway in the intestinal mucosa and a typical Wnt signaling pathway. In this pathway, Wnt and R-spondin family ligands induce the stability of the transcription cofactor β-catenin by inhibiting the multiprotein destruction complex. β-catenin, together with transcription factor / lymphoid enhancer (TCF / LEF) type transcription factors, drives the expression of target genes that promote stem cell characteristics and cell cycle progression. Mahurkar-Joshi et al. analyzed the differentially expressed miRNAs in irritable bowel syndrome (IBS) and healthy controls (HC). The results showed that the levels of miR-219a-5p and miR-338-3p were decreased in IBS, and inhibition of miR-219a-5p led to changes in the expression of proteasome / barrier function genes, which could enhance the permeability of intestinal epithelial cells. In addition, inhibition of miR-338-3p could lead to changes in MAPK signaling pathway genes.AMPK (Adenosine 5'-monophosphate (AMP)-activated protein kinase) is an AMP-dependent protein kinase, which is a key molecule in regulating bioenergy metabolism. It is responsible for regulating the input and output of cell energy and maintaining the smooth operation of cell physiological activities. At the same time, AMPK is also a key protein involved in multiple signal transduction pathways. The study by Long et al. pointed out that miR-122 is upregulated in non-alcoholic fatty liver disease (NAFLD). In further studies, it was found that knocking down miR-122 expression can upregulate the expression of Sirt1 protein and activate the AMPK pathway to inhibit lipogenesis, playing a protective role in the process of NAFLD.

[0072] We analyzed the differentially expressed miRNAs in the plateau group and the plateau probiotic group. The results showed that the miRNA mmu-miR-122-5p (sequence: UGGAGUGUGACAAUGGUGUUUG) had a high expression level in both groups (GY158.23, GYP 65.77), and was significantly lower in the plateau probiotic group than in the plateau group. By predicting the target genes of the specific miRNA mmu-miR-122-5p, we found that its main target genes are Slc25a34, Aldoa, and Vamp3. Among them, Aldoa is a gene encoding fructose bisphosphate aldolase. In the study, it has been found that Aldoa can control the activation of AMPK in the classical activation process of NLRP3 by monitoring the flux of glycolysis, thereby maintaining the activation of inflammasomes and causing mitochondrial damage. Figure 4 The KEGG analysis results of the middle-plateau group and the plateau probiotic group showed that the target gene was also enriched in the AMPK pathway, suggesting that the differentially expressed miRNA between the two groups, namely miR-122-5p, may play a regulatory role in intestinal mucosal damage and inflammatory response caused by hypoxia through the AMPK pathway.

[0073] From this we concluded that the probiotic Lactobacillus johnsonii YH1136 has a protective effect on intestinal barrier damage caused by plateau hypoxia; Lactobacillus johnsonii YH1136 can inhibit the expression of miR-122-5p, reduce its expression level, and further target the Aldoa gene to play a role in the AMPK signaling pathway.

[0074] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Use of an agent for inhibiting the expression of miR-122-5p in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia, characterized in that: The reagent for inhibiting the expression of miR-122-5p includes Lactobacillus johnsonii YH1136, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: M20221116, strain name: Lactobacillus johnsonii, and deposit time: July 15, 2022; The processing process of the Lactobacillus johnsonii YH1136 comprises: After the activation of Lactobacillus johnsonii YH1136, it was inoculated into sterilized MRS liquid medium and cultured at 37°C for 24 hours. The viable bacteria were counted, and then the bacterial solution was divided and centrifuged at 3000r / min and 4°C for 15 minutes. The supernatant was discarded and the bacteria were collected; the cells were resuspended to the initial volume with PBS buffer at pH 7.0, mixed and centrifuged again for 15 minutes, and repeated twice; finally, the cells were resuspended in PBS buffer, and the concentration of the bacterial solution was adjusted to 10 according to the viable bacteria count results. 8 CFU / mL, stored at 4℃ for future use.

2. A strain of Lactobacillus johnsonii YH1136, characterized in that: The Lactobacillus johnsonii YH1136 is deposited in the China Center for Type Culture Collection, with the deposit number: CCTCC NO: M 20221116, strain name: Lactobacillus johnsonii, and deposit time: July 15, 2022.

3. Use of the Lactobacillus johnsonii YH1136 according to claim 2 in the preparation of a drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia; The bacterial liquid concentration of Lactobacillus johnsonii YH1136 is 10 8 CFU / mL; The processing process of the Lactobacillus johnsonii YH1136 comprises: After the activation of Lactobacillus johnsonii YH1136, it was inoculated into sterilized MRS liquid medium and cultured at 37°C for 24 hours. The viable bacteria were counted, and then the bacterial solution was divided and centrifuged at 3000r / min and 4°C for 15 minutes. The supernatant was discarded and the bacteria were collected; the cells were resuspended to the initial volume with PBS buffer at pH 7.0, mixed and centrifuged again for 15 minutes, and repeated twice; finally, the cells were resuspended in PBS buffer, and the concentration of the bacterial solution was adjusted to 10 according to the viable bacteria count results. 8 CFU / mL, stored at 4℃ for future use.

4. A drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia, characterized in that: The medicine comprises the Lactobacillus johnsonii YH1136 described in claim 2.

5. A drug for treating and / or preventing intestinal barrier damage caused by high altitude hypoxia according to claim 4, characterized in that: The medicament further includes a pharmaceutically acceptable carrier.

Images