A plant silique-specific promoter
By designing and applying the plant silique-specific promoter SSEp, the problem of unclear regulatory mechanism of FT gene expression in siliques in plants such as Arabidopsis thaliana has been solved, realizing the specific expression of the gene in siliques and promoting the research and application of flowering and yield regulation.
Patent Information
- Application Number
- CN202111157622.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-09-30
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2041-09-30
AI Technical Summary
In plants such as Arabidopsis, the expression regulation mechanism and biological function of FT genes after flowering induction are unclear, especially the specific expression regulation mechanism in siliques, which has affected the understanding and application of flowering and yield regulation.
A plant silique-specific promoter SSEp is provided, which, through specific nucleotide sequence design and hybridization conditions, ensures that it specifically drives gene expression in siliques. It includes a DNA fragment of 1500 to 3300 bp in length or a fragment with an identity greater than 75%, which is used to construct recombinant vectors and transform plants to achieve specific expression of the target gene in siliques.
This study enabled specific gene expression in plant siliques, especially in the septum and carpels, providing a deeper understanding of FT gene function and regulatory mechanisms, and enhancing the research and application capabilities for flowering and yield regulation.
Smart Images

Figure CN115873853B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically a plant silique-specific promoter. Background Technology
[0002] In angiosperms, flowering is a crucial turning point in the transition from vegetative to reproductive growth. Flowering induction is regulated by genetic pathways such as photoperiod, temperature, vernalization, and spontaneous flowering. In Arabidopsis thaliana, the florallin gene FLOWERING LOCUS T (FT) serves as a key hub for several major flowering regulatory pathways. The transcriptional regulation of the FT gene integrates core flowering regulatory pathways, including the photoperiod pathway, vernalization pathway, gibberellin pathway, and spontaneous pathway.
[0003] Fragrance-inducing protein (FT) plays a conserved biological role in regulating flowering in various plants. FT protein is expressed in the vascular tissue of leaves and can be transported long distances to the shoot apex to induce flowering. Studies have found that the FT gene is highly expressed in fruit, but the key cis-regulatory elements that control its expression remain unclear. Furthermore, FT plays an important role in inhibiting flower reversal and promoting inflorescence primordium stability; FT and its homologs play a crucial role in regulating yield in crops such as tomato. However, the expression regulation mechanism and biological function of the FT gene in the model plant silique remain unclear after flowering induction. Therefore, functional identification and analysis of FT promoters specifically expressed in siliques are crucial. Summary of the Invention
[0004] The purpose of this invention is to provide a silique-specific promoter for plants, named SSEp (Silique-Specific Expression Promoter), wherein SSEp is a) or b) or c) below:
[0005] a) The 3′ end contains at least nucleotides 1801-3300 of sequence 1 in the sequence listing, and extends from position 1802 of sequence 1 to the 5′ end of sequence 1 according to the nucleotide sequence of sequence 1 to obtain any DNA fragment of length from 1500 to 3300 bp; the DNA molecule has promoter function;
[0006] b) A DNA fragment that has 75% or more identity with the nucleotide sequence defined in a) and has promoter function;
[0007] c) A DNA fragment that hybridizes to the nucleotide sequence defined in a) or b) under strict conditions and has promoter function.
[0008] The stringent conditions were: hybridization in a 2×SSC, 0.1% SDS solution at 68°C, followed by two washes of 5 min each; and hybridization in a 0.5×SSC, 0.1% SDS solution at 68°C, followed by two washes of 15 min each.
[0009] Those skilled in the art can readily mutate the SSEp nucleotide sequence of the present invention using known methods, such as directed evolution and point mutation. Nucleotides that have been artificially modified and possess 75% or higher identity with the SSEp nucleotide sequence isolated in this invention, as long as they retain the promoter activity of the target gene, are derived from and are equivalent to the nucleotide sequence of the present invention.
[0010] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of the DNA molecule of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0011] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.
[0012] The last nucleotide at the 3′ end of SSEp is position 3300 of sequence 1.
[0013] SSEp can be 1), 2), 3), or 4) of the following:
[0014] 1) The DNA molecule shown at positions 1801-3300 of sequence 1 in the sequence listing;
[0015] 2) The DNA molecule shown at positions 1301-3300 of sequence 1 in the sequence listing;
[0016] 3) The DNA molecule shown at positions 601-3300 of sequence 1 in the sequence listing;
[0017] 4) The DNA molecule shown in sequence 1 of the sequence listing.
[0018] The present invention also provides biomaterials containing SSEp, which are any one of B1) to B19) below:
[0019] B1) Expression box containing SSEp;
[0020] B2) Recombinant vectors containing SSEp;
[0021] B3) A recombinant vector containing the expression cassette described in B1);
[0022] B4) Recombinant microorganisms containing SSEp;
[0023] B5) Recombinant microorganisms containing the expression cassette described in B1);
[0024] B6) Recombinant microorganisms containing the recombinant vector described in B2);
[0025] B7) Recombinant microorganisms containing the recombinant vector described in B3);
[0026] B8) Transgenic plant cell lines containing SSEp;
[0027] B9) Transgenic plant cell lines containing the expression cassette described in B1);
[0028] B10) Transgenic plant cell lines containing the recombinant vector described in B2);
[0029] B11) Transgenic plant cell lines containing the recombinant vector described in B3);
[0030] B12) Transgenic plant tissue containing SSEp;
[0031] B13) Transgenic plant tissue containing the expression cassette described in B1);
[0032] B14) Transgenic plant tissue containing the recombinant vector described in B2);
[0033] B15) Transgenic plant tissue containing the recombinant vector described in B3);
[0034] B16) Transgenic plant organs containing SSEp;
[0035] B17) Transgenic plant organs containing the expression cassette described in B1);
[0036] B18) Transgenic plant organs containing the recombinant vector described in B2);
[0037] B19) Transgenic plant organs containing the recombinant vector described in B3).
[0038] In the aforementioned biological material, the expression cassette may consist of an SSEp, a target gene for which SSEp initiates expression, and a transcription termination sequence; the SSEp is functionally linked to the target gene, and the target gene is linked to the transcription termination sequence. In one embodiment of the present invention, the target gene is specifically the GUS gene.
[0039] In the aforementioned biological materials, the vector can be a plasmid, granule, bacteriophage, or viral vector. Specifically, the plasmid can be the vector pGreen-GW-GUS.
[0040] In the recombinant vector, the expression of the target gene is initiated by SSEp. In one embodiment of the present invention, the recombinant vector is 1.5kbSSEp::GUS, 2.0kbSSEp::GUS, 2.7kbSSEp::GUS, or 3.3kbSSEp::GUS.
[0041] The 1.5kbSSEp::GUS contains the DNA fragment shown at positions 1801-3300 of sequence 1 in the sequence listing, which is obtained by inserting the DNA fragment shown at positions 1801-3300 of sequence 1 in the sequence listing upstream of the GUS gene in the pGreen-GW-GUS vector. The DNA fragment shown at positions 1801-3300 of sequence 1 in the 1.5kbSSEp::GUS can drive the expression of the GUS gene.
[0042] The 2.0kbSSEp::GUS contains the DNA fragment shown at positions 1301-3300 of sequence 1 in the sequence listing, which is obtained by inserting the DNA fragment shown at positions 1301-3300 of sequence 1 in the sequence listing upstream of the GUS gene in the pGreen-GW-GUS vector. The DNA fragment shown at positions 1301-3300 of sequence 1 in the 2.0kbSSEp::GUS can drive the expression of the GUS gene.
[0043] The 2.7kbSSEp::GUS contains the DNA fragment shown at positions 601-3300 of sequence 1 in the sequence listing, which is obtained by inserting the DNA fragment shown at positions 601-3300 of sequence 1 in the sequence listing upstream of the GUS gene in the pGreen-GW-GUS vector. The DNA fragment shown at positions 601-3300 of sequence 1 in the 2.7kbSSEp::GUS can drive the expression of the GUS gene.
[0044] The 3.3kbSSEp::GUS contains the DNA fragment shown in Sequence 1 of the sequence listing, which is obtained by inserting the DNA fragment shown in Sequence 1 of the sequence listing upstream of the GUS gene in the pGreen-GW-GUS vector. The DNA fragment shown in Sequence 1 of the sequence listing in the 3.3kbSSEp::GUS can drive the expression of the GUS gene.
[0045] In the aforementioned biological materials, the microorganisms may be yeast, bacteria, algae, or fungi. Among them, bacteria may be Agrobacterium.
[0046] The aforementioned expression cassettes or recombinant vectors can be transformed into animal organs, tissues, or cells using conventional biological methods such as prokaryotes, embryonic stem cell-mediated methods, retroviral vector methods, sperm-mediated gene transfer, nuclear transfer transgenic methods, somatic cell nuclear transfer methods, and mitochondrial-mediated methods to obtain transgenic plant cells, tissues, or organs.
[0047] Among the aforementioned biological materials, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation materials.
[0048] This invention also provides the application of SSEp as a promoter.
[0049] In the above applications, SSEp can be a plant silique-specific promoter.
[0050] In the above applications, SSEp can be a specific promoter for plant siliques or carpels.
[0051] The present invention also provides the use of SSEp or the biomaterial in any of the following (a) to (d):
[0052] (a) Cultivating plant varieties or strains;
[0053] (b) Driving the expression of target genes in plants;
[0054] (c) Driving the expression of the target gene in plant siliques;
[0055] (d) Drive the expression of the target gene in the silique or carpel of the plant.
[0056] The present invention also provides a method for the specific expression of a target gene in plant siliques, comprising: introducing an expression cassette containing SSEp and the target gene into a plant to achieve the specific expression of the target gene in plant siliques.
[0057] The present invention also provides a method for the specific expression of a target gene in the silique or carpel of a plant, comprising: introducing an expression cassette containing SSEp and the target gene into a plant to achieve the specific expression of the target gene in the silique or carpel of the plant.
[0058] In the above applications, the plant can be a dicotyledonous plant or a monocotyledonous plant. The dicotyledonous plant can be a Brassicaceae plant. The Brassicaceae plant can be Arabidopsis thaliana.
[0059] Experiments have shown that the SSEp of this invention has promoter function and can specifically drive the expression of target genes in plant siliques, especially in the septum and carpel. The promoter of this invention has great application prospects. Attached Figure Description
[0060] Figure 1Results of GUS staining.
[0061] (A) Siliques from left to right: 1.5kbSSEp::GUS / Col-0, 2.0kbSSEp::GUS / Col-0, 2.7kbSSEp::GUS / Col-0 and 3.3kbSSEp::GUS / Col-0.
[0062] (B) From left to right, the cauline leaves are 1.5kbSSEp::GUS / Col-0, 2.0kbSSEp::GUS / Col-0, 2.7kbSSEp::GUS / Col-0, and 3.3kbSSEp::GUS / Col-0. Detailed Implementation
[0063] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0064] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, and instruments used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.
[0065] Example 1
[0066] 1. Amplification of the target fragment
[0067] Using genomic DNA from the Arabidopsis thaliana ecotype Col-0 as a template, amplification was performed using primers consisting of BP-1.5kbSSEp-F and BP-SSEp-R, yielding a PCR product of 1.5kb. Amplification using primers consisting of BP-2.0kbSSEp-F and BP-SSEp-R yielded a PCR product of 2.0kb. Amplification using primers consisting of BP-2.7kbSSEp-F and BP-SSEp-R yielded a PCR product of 2.7kb. Amplification using primers consisting of BP-3.3kbSSEp-F and BP-SSEp-R yielded a PCR product of 3.3kb. The 5' ends of the primers contained either attB1 or attB2 sequences. The primer sequences are as follows:
[0068] BP-1.5kbSSEp-F:GGGGACAAGTTTGTACAAAAAAGCAGGCTGAAATGATAAGATAAAGTTC;
[0069] BP-2.0kbSSEp-F:GGGGACAAGTTTGTACAAAAAAGCAGGCTAGAAGAAATACAAAATGAAT;
[0070] BP-2.7kbSSEp-F:GGGGACAAGTTTGTACAAAAAAGCAGGCTATTTTCACCGGGGAAAACCTT;
[0071] BP-3.3kbSSEp-F:GGGGACAAGTTTGTACAAAAAAGCAGGCTCTTGTAAACGTAGGTTTGCC;
[0072] BP-SSEp-R:GGGGACCACTTTGTACAAGAAAGCTGGGTCTTTGATCTTGAACAAACAG.
[0073] 2. Construction of the recombinant vector
[0074] The four PCR products obtained in step 1 were used to prepare BP reaction systems according to the following configurations. The resulting systems were incubated at 25°C for 1 hour, and 1 μL of Proteinase K (Sigma, P2308) was added. After mixing by pipetting, the mixture was incubated at 37°C for 1 hour. Subsequently, the products were transformed into competent *E. coli* cells using the heat shock method. After recovery, the cells were plated on LB agarose gel (50 μg / mL, Gentamycin). After 12-14 hours, single colonies were picked for colony PCR to screen for positive clones. After confirming the correct band size by agarose gel electrophoresis, the clones were sent to a sequencing company for first-generation sequencing. The target vectors of the correctly sequenced positive clones were extracted; these are the entry vectors.
[0075] Table 1. BP Reaction System
[0076]
[0077] The obtained entry vectors were used to prepare LR reaction systems according to the following procedures. The systems were incubated at 25°C for 1 hour, then 1 μL of Proteinase K was added, and the mixture was thoroughly mixed and incubated at 37°C for 1 hour. Subsequently, the cells were transformed into competent *E. coli* cells using the heat shock method. After recovery, the cells were plated on LB agar (50 μg / mL, Kanamycin). After 12-14 hours, single colonies were selected for colony PCR to screen for positive clones. After confirming the correct band size by agarose gel electrophoresis, the cells were sent to a sequencing company for first-generation sequencing. The target vector from the correctly sequenced positive clones was extracted; this was the desired recombinant vector.
[0078] Table 2. LR Reaction System
[0079]
[0080] Among them, BP Clonase TM II enzyme mix, product number 11789-020, LR Clonase TM II enzymemix, catalog number 11791-020, is a product of Invitrogen; pDONOR vector is a product of Invitrogen; the sequence of pGreen-GW-GUS is shown in Sequence 2 of the sequence listing.
[0081] The recombinant vectors obtained from PCR products of 1.5kb, 2.0kb, 2.7kb, and 3.3kb were designated as 1.5kbSSEp::GUS, 2.0kbSSEp::GUS, 2.7kbSSEp::GUS, and 3.3kbSSEp::GUS, respectively. The 1.5kbSSEp::GUS vector contains the DNA fragment shown in positions 1801-3300 of sequence 1 in the sequence listing (designated as 1.5kb-DNA). This 1.5kb-DNA is located upstream of the GUS gene and can drive GUS gene expression. The 2.0kbSSEp::GUS vector contains the DNA fragment shown in positions 1301-3300 of sequence 1 in the sequence listing (designated as 2.0kb-DNA). This 2.0kb-DNA is located upstream of the GUS gene and can drive GUS gene expression. The 2.7kbSSEp::GUS sequence contains the DNA fragment shown at positions 601-3300 of sequence 1 in the sequence listing (this fragment is denoted as 2.7kb-DNA). The 2.7kb-DNA in 2.7kbSSEp::GUS is located upstream of the GUS gene and can drive the expression of the GUS gene. The 3.3kbSSEp::GUS sequence contains the DNA fragment shown at positions 1-3300 of sequence 1 in the sequence listing (this fragment is denoted as 3.3kb-DNA). The 3.3kb-DNA in 3.3kbSSEp::GUS is located upstream of the GUS gene and can drive the expression of the GUS gene.
[0082] 3. Obtaining transgenic plants
[0083] 3.1 Agrobacterium-mediated transformation
[0084] Pre-cool the electroporation cuvette to -20℃, wipe the moisture off both electrodes, add 100μL of freshly prepared Agrobacterium GV3101 electroporation competent cells, and take 500μg of each of the 1.5kbSSEp::GUS, 2.0kbSSEp::GUS, 2.7kbSSEp::GUS, or 3.3kbSSEp::GUS obtained in step 2, along with pSOUP plasmid, at a 1:1 ratio. Add these plasmids to the gaps between the electrodes of the pre-cooled electroporation cuvette, gently tap away air bubbles with your fingertips, and electroporate using the preset Agrobacterium electroporation program. Immediately after electroporation, add 1mL of LB liquid medium to resuspend the cells, and aspirate the bacterial solution from the electroporation cuvette. Transfer the solution to a 1.5mL centrifuge tube and incubate at 28℃ and 200rpm for 2-3 hours. After resuscitation, the culture was plated on LB agar (50 μg / mL Kanamycin, 50 μg / mL Rifampicin, 5 μg / mL Tetracycline). After 12-14 hours, single colonies were selected for colony PCR to screen for positive clones. After confirming the band size was correct by agarose gel electrophoresis, the bacterial culture was mixed with 60% glycerol at a ratio of 1:1, flash-frozen in liquid nitrogen, and stored at -80°C. Recombinant bacteria containing 1.5 kbSSEp::GUS, 2.0 kbSSEp::GUS, 2.7 kbSSEp::GUS, or 3.3 kbSSEp::GUS were designated as GV3101 / 1.5 kbSSEp::GUS, GV3101 / 2.0 kbSSEp::GUS, GV3101 / 2.7 kbSSEp::GUS, and GV3101 / 3.3 kbSSEp::GUS, respectively.
[0085] 3.2 Transformation of Arabidopsis thaliana by flower soaking method
[0086] Plants of Arabidopsis thaliana ecotype Col-0 that are in full bloom were selected, and Arabidopsis thaliana were transformed by the recombinant bacteria obtained in step 3.1 using the flower immersion method. The plants were cultured under long-day conditions (16 hours of light, 22°C, 8 hours of darkness, 18°C) until the seeds matured. The seeds were then harvested to obtain T1 seeds.
[0087] 3.3 Screening of positive transgenic plants
[0088] A large number of T1 generation plants were sown, and leaves were harvested at the 6-8 leaf stage for PCR identification to determine if they were positive transgenic plants. After the positive transgenic plants grew normally and matured, T2 generation seeds were harvested from each plant. Approximately 100 T2 generation seeds were sown using the same method, and the ratio of surviving to dead plants was counted. Lines with a surviving:dead plant ratio of 3:1 were selected; these are single-copy insertion plants, and T3 generation seeds were harvested from them. The same method was used to test all surviving lines in the T3 generation; these are homozygous single-copy insertion transgenic lines.
[0089] The single-copy insertion transgenic line obtained using GV3101 / 1.5kbSSEp::GUS is designated as 1.5kbSSEp::GUS / Col-0, the single-copy insertion transgenic line obtained using GV3101 / 2.0kbSSEp::GUS is designated as 2.0kbSSEp::GUS / Col-0, the single-copy insertion transgenic line obtained using GV3101 / 2.7kbSSEp::GUS is designated as 2.7kbSSEp::GUS / Col-0, and the single-copy insertion transgenic line obtained using GV3101 / 3.3kbSSEp::GUS is designated as 3.3kbSSEp::GUS / Col-0.
[0090] 4. GUS identification of transgenic plants
[0091] Stem leaves and siliques of T3 generation 1.5kbSSEp::GUS / Col-0, 2.0kbSSEp::GUS / Col-0, 2.7kbSSEp::GUS / Col-0, and 3.3kbSSEp::GUS / Col-0 were stained with GUS, with Arabidopsis thaliana Col-0 as a control.
[0092] result( Figure 1 The results showed that GUS staining signals were undetectable in the stems and leaves of all four transgenic Arabidopsis species, but were detected in the siliques. GUS staining signals were also present on the septa and carpels, with deeper staining at the junction of the silique and the parent plant. This indicates that the 1.5kb, 2.0kb, 2.7kb, and 3.3kb DNA fragments are silique-specific promoters.
[0093] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. <110> Capital Normal University <120> A plant silique-specific promoter <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 3300 <212> DNA <213> Arabidopsis thaliana <400> 1 cttgtaaacg taggtttgcc ggatctcttg ttcctcatcc acttgccaat cttcgtaatc 60 caaaaggtaa atatctatgt ttaattatct tctagatttt aaggcacaac ggattgatcg 120 ttctatattg tatgcacgat tgaagaagtt gtttaagaag cacaaacatt tgactatcgg 180 ctttaacacc tttttgtcac ttggagataa gatatttctt catggtgacg cagaagcctc 240 tactagctcc accgcaaaag actattgaaa tttcttatca tggtcattac accaatgata 300 ctatcaaaat ctctaaacta atctctatgt tcagtttttg atggtttatt atcaagtatg 360 tgtctttgta attatcttct cttctaagat tgaatcatca caatgttttt gaattatttg 420 attttcattg aatatttcaa ccaaccaaaa tgttttcgtt ctagaaataa agtcctaaag 480 tgacgtacat tcgttttcta atgaaaatgc tatttcataa gttattcctt tcattttttt 540 tgggtcgtca aaacataagt taatattctt tttttatttg actaaaacta cttttccaaa 600 attttcaccg gggaaacctt ctcaagctt tatgagctta aacatatgca aagtgtctca 660 ttaacttaaa taatataga gtacaattaa ttgttcaca acgtttta taggaaactt 720 agaatatgtt ctgtgatgca ctatatgttg cttcgtaagg aaattgcatg cgaaaatcta 780 gtggaagaaa tttagttaaa cggcaaaaat cttcaattaa tcgtttcctt tatctacatt 840 accaaaaggt tgcgaacatt atgcgacata tggtggttag aacttaatac actaatgttt 900 ttcaagatg ctatttgtgg agttgataaa haaaacat atttgaagaa ataatttta 960 aacatgtagt gtttaggac atcacggctt catagatata gagtcaactt atatgttac 1020 aatgatattg aaataatgttc tctaactct aaaggttct acctgattt cttaaacaat 1080 gcatcttcga agataaga aaatatattt ttctattttc tcttacatg tcaatgctta 1140 ctatatcatc ttacgatata ctataaacgt tttattcata agtaaagac aagtggcaga 1200 tacgttaaat tttataatag aaaaatta gttaaatctt aaaagttgc tgaaataga 1260 aagcaacta cttatttta agcaacgta agtctcttta agagaata caatgaat 1320 atatatcgga ttaaatcaaa aaacaaaaag atacactttt gtttttctga acaaatgaaa 1380 aatgatatac acaagtggcg gacaatccat ctatctcatt ttagcgaaca attaatcttg 1440 tctgcgactg cgacctattt ttttctacat defectctttt gtttcgtatg aacactaaca 1500 tgattgaatg acaaaattta ctaacaattc ttatagtact gagctctcct gtccaatatt 1560 taaaaatgca tacatttttt tgtgtgtaac taaaattagt agaaaataaa tgctagtcgt 1620 taaaaagtgc atatagcaga tttcgagttt tttttaattg cgatttcgat tatcaatggt 1680 cgatcgtaga cgtctttttt agtaaacaaa tctgaaattt ctatgaaggt taccaaatat 1740 tttggatttc aacctaagat gaagttaacc tatggacgtg tagaacagtg gctgaagtct 1800 gaaatgataa gataaagttc aatatgaata cattactgag atgttacaaa aaactacatc 1860 actgaataat tcctttatt tccagtttgg acagtagaac ctatcgctaa ttatttaatt 1920 accaattaaa agaaaaagaa agaataattc ctacagttgt taggctatgg ttataagttt 1980 catctttgaa cttaagaaat gctctaatta gtggtaatgg tagttacatc tatatatgtt 2040 gatgcaatgt caaaaagaaa atctctcaaa ttagcaaatc catacctatt tatagacgca 2100 taagtatata taccaattat cctggtcgtg caaatggatg gttagtattt ttacaaccaa 2160 actaatgtct aattttaaaa agtaatcatt attttgcttt agatttttaa tagttaatat 2220 tatatgtata gatagattac cgtatgatat aattgtttca agacactaga tactatctca 2280 attataaaac tcacttttcc samaatggc cgcttgttta taaaaaaaga agagaataa 2340 aacaattgat ttggtttata ttatttaatt gcagatatct tgtactttaat tcattttgag 2400 ataattttgc gtatttgagt tcggacattg gtaggtatgg acgatgaaaa taactgcctt 2460 cattctacat gtttgagatt tgtttgtcga ccatataaca caagcggcta gaaaaatagg 2520 tgactattct caaatgtcct ggttctatct aacctgaagg atcccttgtt ctacctggta 2580 taactacaag aaaaggctgt tttataaaat atatcatttc ttctatgatt tctatctcaa 2640 ctttttttt agtttttttc tttagaacg tttcgcttt cgaattttt aagaattttt 2700 tttttcttta tatctcttaaa taatagtttt aaaaacataa caagtgatac tgtaattttt 2760 ttttctctat aaacttggcg gtaccctact tttttcttat ttttattaat aatcttactt 2820 tgttatgata aattatgtta atatatggca aaactaaata tatatgaaac tactgattac 2880 tcattatcat aattaatatc tttgtataaa agtaaataat atttagtcga gagaggtatc 2940 ttgttaaagg aaataaatca aaaattagtg gctaccaagt gggagatata atttggaata 3000 tttccagtgt attagtgtgg tgggtttgga ataccacaaa cagaaataaa aagaaagaaa 3060 aatatgaaat aagacgacaa tgtgtgatgt acgtagaatc agttttagat tctagtacat 3120 caatagacaa gaaaaagatt gtggttatga tttcaccgac ccgagttaat gcaaatccga 3180 aacagtataa atatgtgtag agggttcatg cctatgatac aaattaaaga agcagaaaca 3240 aaaacaagta aaacagaaac aatcaacaca gagaaaccac ctgtttgttc aagatcaaag 3300 <210> 2 <211> 8240 <212> DNA <213> Artificial Sequence[[ID=2ccggtcttgc gatgattatc fatherttc tgttgatta cgttaagcat gtaatatta acatgtaatg catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata cgcgatagaa aacaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc tatgttacta gatcgggaat tcagctccag cttttgttcc ctttagtgag 300 ggttaattcc gagcttggcg taatcatggt catagctgtt tcctgtgtga aattgttatc 360 cgctcacaat tccacacaac atacgagccg gaaghcataa agtgtaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 540. attggggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 600 cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaga acatgaaggc cttgacagga tatattggcg ggtaaacta gtcgctgtat gtgtttgttt gagatctcat gtgagcaaaa ggccagcaaa aggccagga ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 840 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 900 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 960 tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg 1020 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 1080 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 1140 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 1200 ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg tatctgcgct 1260 ctgctgaagc cagttacctt cggaagaaga gttggtagct cttgatccgg caaacaaacc 1320 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 1380 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 1440 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat 1500 taaaaatgaa gttttaaatc aatctaaagt atatatgtgt aacattggtc tagtgattag 1560 aaaaactcat cgagcatcaa atgaaactgc aatttattca tatcaggatt atcaatacca 1620 tatttttgaa aaagccgttt ctgtaatgaa ggagaaaact caccgaggca gttccatagg 1680 atggcaagat cctggtatcg gtctgcgatt ccgactcgtc caacatcaat acaacctatt 1740 aatttcccct cgtcaaaaat aaggttatca agtgagaaat caccatgagt gacgactgaa 1800 tccggtgaga atggcaaaag tttatgcatt tctttccaga cttgttcaac aggccagcca 1860 ttacgctcgt catcaaaatc actcgcatca accaaaccgt tattcattcg tgattgcgcc 1920 tgagcgagac gaaatacgcg atcgctgtta aaaggacaat tacaaacagg aatcgaatgc 1980 aaccggcgca ggaacactgc cagcgcatca acaatatttt cacctgaatc aggatattct 2040 tctaatacct ggaatgctgt tttccctggg atcgcagtgg tgagtaacca tgcatcatca 2100 ggagtacgga taaaatgctt gatggtcgga agaggcataa attccgtcag ccagtttagt 2160 ctgaccatct catctgtaac aacattggca acgctacctt tgccatgttt cagaaacaac 2220 tctggcgcat cgggcttccc atacaatcgg tagattgtcg cacctgattg cccgacatta 2280 tcgcgagccc atttataccc atataaatca gcatccatgt tggaatttaa tcgcggcctt 2340 gagcaagacg tttcccgttg aatatggctc ataacacccc ttgtattact gtttatgtaa 2400 gcagacagtt ttatgttca tgatgatata tttttatctt gtgcaatgta acatcagaga 2460 ttttgagaca caacgtggct ttgttgaata aatcgaactt ttgctgagtt gaaggatcag 2520 atcacgcatc ttcccgacaa cgcagaccgt tccgtggcaa agcaaaagtt caaaatcacc 2580 aactggtcca cctacaacaa agctctcatc aaccgtggct ccctcacttt ctggctggat 2640 gatggggcga ttcaggcgat ccccatccaa cagcccgccg tcgagcgggc ttttttatcc 2700 ccggaagcct gtggatagag ggtagttatc cacgtgaaac cgctaatgcc ccgcaaagcc 2760 ttgattcacg gggctttccg gcccgctcca aaaactatcc acgtgaaatc gctaatcagg 2820 gtacgtgaaa tcgctaatcg gagtacgtga aatcgctaat aaggtcacgt gaaatcgcta 2880 atcaaaaagg cacgtgagaa cgctaatagc cctttcagat caacagcttg caaacacccc 2940 tcgctccggc aagtagttac agcaagtagt atgttcaatt agcttttcaa ttatgaatat 3000 atatatcaat tattggtcgc ccttggcttg tggacaatgc gctacgcgca ccggctccgc 3060 ccgtggacaa ccgcaagcgg ttgcccaccg tcgagcgcca gcgcctttgc ccacaacccg 3120 gcggccggcc gcaacagatc gttttataaa tttttttttt tgaaaaagaa aaagcccgaa 3180 aggcggcaac ctctcgggct tctggatttc cgatccccgg aattagagat cttggcagga 3240 tatattgtgg tgtaacgtta tcagcttgca tgccggtcga tctagtaaca tagatgacac 3300 cgcgcgcgat aatttatcct agtttgcgcg ctatattttg ttttctatcg cgtattaaat 3360 gtataattgc gggactctaa tcaaaaaacc catctcataa ataacgtcat gcattacatg 3420 ttaattatta catgcttaac gtaattcaac agaaattata tgataatcat cgcaagaccg 3480 gcaacaggat tcaatcttaa gaaactttat tgccaaatgt ttgaacgatc tgcttgactc 3540 taggggtcat cagatttcgg tgacgggcag gaccggacgg ggcggcaccg gcaggctgaa 3600 gtccagctgc cagaaaccca cgtcatgcca gttcccgtgc ttgaagccgg ccgcccgcag 3660 catgccacgg ggggcatatc cgagcgcctc gtgcatgcgc acgctcgggt cgttgggcag 3720 cccgatgaca gcgaccacgc tcttgaagcc ctgtgcctcc agggacttca gcaggtgggt 3780 gtagagcgtg gagcccagtc ccgtccgctg gtggcggggg gagacgtaca cggttgactc 3840 ggccgtccag tcgtaggcgt tgcgtgcctt ccagggaccc gcgtaggcga tgccggcgac 3900 ctcgccgtcc acctcggcga cgagccaggg atagcgctcc cgcagacgga cgaggtcgtc 3960 cgtccactcc tgcggttcct gcggctcggt acggaagttg accgtgcttg tctggatgta 4020 gtggttgacg atggtgcaga ccgccggcat gtccgcctcg gtggcacggc ggatgtcggc 4080 cgggcgtcgt tctgggctca tggtagatcc ccctcgatcg agttgagagt gaatatgaga 4140 ctctaattgg ataccgaggg gaatttatgg aacgtcagtg gagcattttt gacaagaaat 4200 atttgctagc tgatagtgac cttaggcgac ttttgaacgc gcaataatgg tttctgacgt 4260 atgtgcttag ctcattaaac tccagaaacc cggctgagtg gctccttcaa cgttgcggtt 4320 ctgtcagttc caaacgtaaa acggcttgtc ccgcgtcatc ggcgggggtc ataacgtgac 4380 tcccttaatt ctcatgtatc gataacatta acgtttacaa tttcgcgcca ttcgccattc 4440 aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg 4500 gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 4560 cgacgttgta aaacgacggc cagtgaattg taatacgact cactataggg cgaattgggt 4620 acagtactga tatcacaagt ttgtacaaaa aagctgaacg agaaacgtaa aatgatataa 4680 atatcaatat attaaattag attttgcata aaaaacagac tacataatac tgtaaaacac 4740 aacatatcca gtcatattgg cggccgcatt aggcacccca ggctttacac tttatgcttc 4800 cggctcgtat aatgtgtgga ttttgagtta ggatccgtcg agattttcag gagctaagga 4860 agctaaaatg gagaaaaaaa tcactggata taccaccgtt gatatatccc aatggcatcg 4920 taaagaacat tttgaggcat ttcagtcagt tgctcaatgt acctataacc agaccgttca 4980 gctggatatt acggcctttt taaagaccgt aaagaaaaat aagcacaagt tttatccggc 5040 ctttattcac attcttgccc gcctgatgaa tgctcatccg gaattccgta tggcaatgaa 5100 agacggtgag ctggtgatat gggatagtgt tcacccttgt tacaccgttt tccatgagca 5160 aactgaaacg tttcatcgc tctggagtga ataccacgac gatttccggc agttctca 5220 catatattcg caagatgtgg cgtgttacgg tgaaaacctg gcctatttcc ctaaagggtt 5280 tattgagaat atgtttttcg tctcagccaa tccctgggtg agtttcacca gttttgattt 5340 aaacgtggcc aatatggaca acttcttcgc ccccgttttc accatgggca atattattac 5400 gcaaggcgac aaggtgctga tgccgctggc gattcaggtt catcatgccg tttgtgatgg 5460 cttccatgtc ggcagaatgc ttaatgaatt acaacagtac tgcgatgagt ggcagggcgg 5520 ggcgtaaacg cgtggatccg gcttactaaa agccagataa cagtatgcgt atttgcgcgc 5580 tgatttttgc ggtataagaa tatatactga tatgtatacc cgaagtatgt caaaaagagg 5640 tatgctatga agcagcgtat tacagtgaca gttgacagcg acagctatca gttgctcaag 5700 gcatatatga tgtcaatatc tccggtctgg taagcacaac catgcagaat gaagcccgtc 5760 gtctgcgtgc cgaacgctgg aaagcggaaa atcaggaagg gatggctgag gtcgcccggt 5820 ttattgaaat gaacggctct tttgctgacg agaacagggg ctggtgaaat gcagtttaag 5880 gtttacacct ataaaagaga gagccgttat cgtctgtttg tggatgtaca gagtgatatt 5940 attgacacgc ccgggcgacg gatggtgatc cccctggcca gtgcacgtct gctgtcagat 6000 aaagtctccc gtgaacttta cccggtggtg catatcgggg atgaaagctg gcgcatgatg 6060 accaccgata tggccagtgt gccggtctcc gttatcgggg aagaagtggc tgatctcagc 6120 caccgcgaaa atgacatcaa aaacgccatt aacctgatgt tctggggaat ataaatgtca 6180 ggctccctta tacacagcca gtctgcaggt cgaccatagt gactggatat gttgtgtttt 6240 acagcattat gtagtctgtt ttttatgcaa aatctaattt aatatattga tatttatatc 6300 attttacgtt tctcgttcag ctttcttgta caaagtggtg atatcaagct tgggtaccac 6360 tcgagtggcc accatggtcc gtcctgtaga aaccccaacc cgtgaaatca aaaaactcga 6420 cggcctgtgg gcattcagtc tggatcgcga aaactgtgga attgatcagc gttggtggga 6480 aagcgcgtta caagaaagcc gggcaattgc tgtgccaggc agttttaacg atcagttcgc 6540 cgatgcagat attcgtaatt atgcgggcaa cgtctggtat cagcgcgaag tctttatacc 6600 gaaaggttgg gcaggccagc gtatcgtgct gcgtttcgat gcggtcactc attacggcaa 6660 agtgtgggtc aataatcagg aagtgatgga gcatcagggc ggctatacgc catttgaagc 6720 cgatgtcacg ccgtatgtta ttgccgggaa aagtgtacgt atcaccgttt gtgtgaacaa 6780 cgaactgaac tggcagacta tcccgccggg aatggtgatt accgacgaaa acggcaagaa 6840 aaagcagtct tacttccatg atttctttaa ctatgccgga atccatcgca gcgtaatgct 6900 ctacaccacg ccgaacacct gggtggacga tatcaccgtg gtgacgcatg tcgcgcaaga 6960 ctgtaaccac gcgtctgttg actggcaggt ggtggccaat ggtgatgtca gcgttgaact 7020 gcgtgatgcg gatcaacagg tggttgcaac tggacaaggc actagcggga ctttgcaagt 7080 ggtgaatccg cacctctggc aaccgggtga aggttatctc tatgaactgt gcgtcacagc 7140 caaaagccag acagagtgtg atatctaccc gcttcgcgtc ggcatccggt cagtggcagt 7200 gaagggccaa cagttcctga ttaaccacaa accgttctac tttactggct ttggtcgtca 7260 tgaagatgcg gacttacgtg gcaaaggatt cgataacgtg ctgatggtgc acgaccacgc 7320 attaatggac tggattgggg ccaactccta ccgtacctcg cattaccctt acgctgaaga 7380 gatgctcgac tgggcagatg aacatggcat cgtggtgatt gatgaaactg ctgctgtcgg 7440 ctttaacctc tctttaggca ttggtttcga agcgggcaac aagccgaaag aactgtacag 7500 cgaagaggca gtcaacgggg aaactcagca agcgcactta caggcgatta aagagctgat 7560 agcgcgtgac aaaaaccacc caagcgtggt gatgtggagt attgccaacg aaccggatac 7620 ccgtccgcaa gtgcacggga atatttcgcc actggcggaa gcaacgcgta aactcgaccc 7680 gacgcgtccg atcacctgcg tcaatgtaat gttctgcgac gctcacaccg ataccatcag 7740 cgatctcttt gatgtgctgt gcctgaaccg ttattacgga tggtatgtcc aaagcggcga 7800 tttggaaacg gcagagaagg tactggaaaa agaacttctg gcctggcagg agaaactgca 7860 tcagccgatt atcatcaccg aatacggcgt ggatacgtta gccgggctgc actcaatgta 7920 caccgacatg tggagtgaag agtatcagtg tgcatggctg gatatgtatc accgcgtctt 7980 tgatcgcgtc agcgccgtcg tcggtgaaca ggtatggaat ttcgccgatt ttgcgacctc 8040 gcaaggcata ttgcgcgttg gcggtaacaa gaaagggatc ttcactcgcg accgcaaacc 8100 gaagtcggcg gcttttctgc tgcaaaaacg ctggactggc atgaacttcg gtgaaaaacc 8160 gcagcaggga ggcaaacaat gaatcaacaa ctctcctggc gcaccatcgt cgctacagcc 8220 tcgggaattg ctaccgagct 8240
Claims
1. The application of DNA molecules as promoters, characterized by: The DNA molecule is either 1), 2), 3), or 4) below. 1) The DNA molecule shown at positions 1801-3300 of sequence 1 in the sequence listing; 2) The DNA molecule shown at positions 1301-3300 of sequence 1 in the sequence listing; 3) The DNA molecule shown at positions 601-3300 of sequence 1 in the sequence listing; 4) The DNA molecule shown in sequence 1 of the sequence listing; The promoter is a plant silique-specific promoter; The plant in question is Arabidopsis thaliana.
2. The application according to claim 1, characterized in that: The promoter is a plant silique septum or carpel-specific promoter.
3. The use of the DNA molecule of claim 1 or biological material containing the DNA molecule in the following (a) or (b): (a) Breeding plant varieties or strains; (b) Driving the expression of target genes in plants; The biomaterial is any one of B1) to B19) below: B1) An expression cassette containing the DNA molecule of claim 1; B2) A recombinant vector containing the DNA molecule of claim 1; B3) A recombinant vector containing the expression cassette described in B1); B4) Recombinant microorganisms containing the DNA molecule of claim 1; B5) Recombinant microorganisms containing the expression cassette described in B1); B6) Recombinant microorganisms containing the recombinant vector described in B2); B7) Recombinant microorganisms containing the recombinant vector described in B3); B8) A transgenic plant cell line containing the DNA molecule of claim 1; B9) Transgenic plant cell lines containing the expression cassette described in B1); B10) Transgenic plant cell lines containing the recombinant vector described in B2); B11) Transgenic plant cell lines containing the recombinant vector described in B3); B12) Transgenic plant tissue containing the DNA molecule of claim 1; B13) Transgenic plant tissue containing the expression cassette described in B1); B14) Transgenic plant tissue containing the recombinant vector described in B2); B15) Transgenic plant tissue containing the recombinant vector described in B3); B16) A transgenic plant organ containing the DNA molecule of claim 1; B17) Transgenic plant organs containing the expression cassette described in B1); B18) Transgenic plant organs containing the recombinant vector described in B2); B19) Transgenic plant organs containing the recombinant vector described in B3); The plant in question is Arabidopsis thaliana.
4. The application of the DNA molecule of claim 1 or biological material containing the DNA molecule in driving the expression of the target gene in plant siliques; The biomaterial is any one of B1) to B19) below: B1) An expression cassette containing the DNA molecule of claim 1; B2) A recombinant vector containing the DNA molecule of claim 1; B3) A recombinant vector containing the expression cassette described in B1); B4) Recombinant microorganisms containing the DNA molecule of claim 1; B5) Recombinant microorganisms containing the expression cassette described in B1); B6) Recombinant microorganisms containing the recombinant vector described in B2); B7) Recombinant microorganisms containing the recombinant vector described in B3); B8) A transgenic plant cell line containing the DNA molecule of claim 1; B9) Transgenic plant cell lines containing the expression cassette described in B1); B10) Transgenic plant cell lines containing the recombinant vector described in B2); B11) Transgenic plant cell lines containing the recombinant vector described in B3); B12) Transgenic plant tissue containing the DNA molecule of claim 1; B13) Transgenic plant tissue containing the expression cassette described in B1); B14) Transgenic plant tissue containing the recombinant vector described in B2); B15) Transgenic plant tissue containing the recombinant vector described in B3); B16) A transgenic plant organ containing the DNA molecule of claim 1; B17) Transgenic plant organs containing the expression cassette described in B1); B18) Transgenic plant organs containing the recombinant vector described in B2); B19) Transgenic plant organs containing the recombinant vector described in B3); The plant in question is Arabidopsis thaliana.
5. The use of the DNA molecule of claim 1 or biological material containing the DNA molecule in driving the expression of a target gene in the silique or carpel of a plant; The biomaterial is any one of B1) to B19) below: B1) An expression cassette containing the DNA molecule of claim 1; B2) A recombinant vector containing the DNA molecule of claim 1; B3) A recombinant vector containing the expression cassette described in B1); B4) Recombinant microorganisms containing the DNA molecule of claim 1; B5) Recombinant microorganisms containing the expression cassette described in B1); B6) Recombinant microorganisms containing the recombinant vector described in B2); B7) Recombinant microorganisms containing the recombinant vector described in B3); B8) A transgenic plant cell line containing the DNA molecule of claim 1; B9) Transgenic plant cell lines containing the expression cassette described in B1); B10) Transgenic plant cell lines containing the recombinant vector described in B2); B11) Transgenic plant cell lines containing the recombinant vector described in B3); B12) Transgenic plant tissue containing the DNA molecule of claim 1; B13) Transgenic plant tissue containing the expression cassette described in B1); B14) Transgenic plant tissue containing the recombinant vector described in B2); B15) Transgenic plant tissue containing the recombinant vector described in B3); B16) A transgenic plant organ containing the DNA molecule of claim 1; B17) Transgenic plant organs containing the expression cassette described in B1); B18) Transgenic plant organs containing the recombinant vector described in B2); B19) Transgenic plant organs containing the recombinant vector described in B3); The plant in question is Arabidopsis thaliana.
6. Methods for the specific expression of target genes in plant siliques, including: An expression cassette containing the DNA molecule and the target gene as described in claim 1 is introduced into a plant to achieve specific expression of the target gene in the silique of the plant. The plant in question is Arabidopsis thaliana.
7. Methods for the specific expression of target genes in the septum or carpel of plant siliques, including: An expression cassette containing the DNA molecule and the target gene as described in claim 1 is introduced into a plant to achieve specific expression of the target gene in the silique or carpel of the plant. The plant in question is Arabidopsis thaliana.