Application of Rice OsHsfC1a Gene in Regulating Rice Heading Date

Abstract

The present invention discloses the application of the rice OsHsfC1a gene in regulating the heading stage of rice. By mutating the rice OsHsfC1a gene, it is found that inhibiting the expression of the OsHsfC1a gene can prolong the heading stage of rice, while overexpressing the OsHsfC1a gene can shorten the heading stage of rice. At the same time, mutating or overexpressing the OsHsfC1a gene does not reduce the rice yield. Therefore, the OsHsfC1a gene can be used as an effective target for rice genetic breeding to construct mutant rice with delayed or advanced growth periods. In addition, the method of using the CRISPR / Cas9 technology to mutate the OsHsfC1a gene to obtain mutants with slightly delayed growth periods provides an effective approach for rice design breeding, which has stronger purposefulness, less damage to the genome, and can avoid the possible risks brought by transgenic technology compared with mutants obtained by chemical and physical mutagenesis.

Description

Technical Field

[0001] The present invention belongs to the technical field of rice genetic engineering. More specifically, it relates to the application of the rice OsHsfC1a gene in regulating the heading date of rice. Background Art

[0002] Rice (Oryza sativa L.) is one of the most important cereal crops in the world. With the increase in the global population, the sharp reduction of arable land area, serious environmental pollution, and frequent extreme weather, the supply and demand of food have become unbalanced.

[0003] The growth period of rice is an inherent characteristic of rice varieties, which determines the regional adaptability, seasonal adaptability, and appropriate cultivation methods of varieties, and greatly affects its yield, quality, and production efficiency. Among them, the heading date is a key agronomic trait that affects the adaptability and yield of rice in different regions. It is jointly regulated by the external environment and rice flowering genes, and is also one of the important objectives of rice variety breeding. Providing genes that can regulate the heading date of rice is of great significance for rice variety breeding and stabilizing rice yield. For example, the temperature in southern cities of China is relatively low in winter, which is not suitable for rice growth. Adjusting the growth period to advance or delay it can avoid cold weather to ensure rice filling and its yield.

[0004] Florigen is the core factor for initiating flowering and plays an important role in the initiation and formation of rice flower development. Hd3a (Heading date 3a) forms a complex with the florigen receptor protein 14-3-3, and is transported to the nucleus to interact with the OsFD1 transcription factor, activating the expression of downstream flowering regulatory genes OsMADS14, OsMADS15, and OsMADS18, and initiating the floral transition of rice. RFT1 (Rice flowering locus T1) / Hd3a is also called the florigen gene and is an activating factor that promotes rice heading. Under short-day conditions, the function of Hd3a is normal and the expression level of RFT1 is low. When the function of Hd3a is lost, the RFT1 gene will be highly expressed to play a compensatory role and promote the floral transition of rice. When both Hd3a and RFT1 are mutated, they do not flower under short-day conditions, indicating that this gene is indispensable for rice flowering. Under long-day conditions, the expression level of Hd3a is very low or even not expressed, being in a non-functional state; RFT1 is highly expressed in leaves and is transported to the apical meristem to activate the expression of flowering genes OsMADS14 / OsMADS15, promoting rice flowering. However, changes in the expression levels of these major genes regulating flowering usually cause huge changes in the heading date of rice and greatly affect the yield, making it difficult to be used for fine-tuning and improvement of modern rice varieties. Therefore, it is necessary to explore small-effect genes that can regulate the heading date of rice but have little impact on rice yield for fine-tuning the regional adaptability of rice varieties. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the defects and deficiencies of the above-mentioned existing technologies, and to provide a gene capable of regulating the heading stage of rice and its application, namely, the rice OsHsfC1a gene and its application in regulating the heading stage of rice.

[0006] The first object of the present invention is to provide the application of the rice OsHsfC1a gene in regulating the heading stage of rice.

[0007] The second object of the present invention is to provide a method for prolonging the heading stage of rice.

[0008] The third object of the present invention is to provide a method for shortening the heading stage of rice.

[0009] The fourth object of the present invention is to provide the application of a reagent for blocking or inhibiting the expression of the rice OsHsfC1a gene in prolonging the heading stage of rice or creating rice germplasm with a long growth period.

[0010] The fifth object of the present invention is to provide the application of a reagent for promoting the expression of the rice OsHsfC1a gene in shortening the heading stage of rice or creating rice germplasm with a short growth period.

[0011] The above objects of the present invention are achieved by the following technical solutions:

[0012] By mutating the rice OsHsfC1a gene and overexpressing the rice OsHsfC1a gene, the present invention respectively obtained the corresponding mutant strains and found that under the conditions of physiological low temperature and physiological high temperature of rice, reducing the expression of the rice OsHsfC1a gene by mutation can prolong the heading stage of rice, and at the same time can improve the seed setting rate of rice; while overexpressing the rice OsHsfC1a gene can shorten the heading stage of rice, indicating that the rice OsHsfC1a gene can regulate the heading stage of rice and will not reduce the rice yield. By inhibiting or promoting the expression of the rice OsHsfC1a gene, rice germplasm with a long growth period or a short growth period can be created, which is of great significance for fine-tuning the regional adaptability of rice varieties.

[0013] Therefore, the present invention applies for the protection of the application of the rice OsHsfC1a gene in regulating the heading stage of rice.

[0014] Specifically, the rice OsHsfC1a gene described in the present invention is a heat shock transcription factor, and its nucleotide sequence is as shown in SEQ ID NO.1.

[0015] The present invention also provides a method for prolonging the heading stage of rice, and the method is: blocking or inhibiting the expression of the OsHsfC1a gene (shown in SEQ ID NO.1) in rice.

[0016] To block or inhibit the expression of the OsHsfC1a gene in rice, the expression of the OsHsfC1a gene in rice can be inhibited by using RNA interference technology; or functional mutations such as insertions, deletions, or base conversions of a few bases can be introduced into the coding region of the OsHsfC1a gene in rice by using gene editing technology; or the OsHsfC1a gene sequence in rice can be deleted by using gene editing technology.

[0017] Specifically, the gene editing technology is a genome editing system based on CRISPR / Cas9.

[0018] Specifically, the method for blocking or inhibiting the expression of the OsHsfC1a gene in rice is as follows: design a CRISPR / Cas9-based sgRNA sequence for the OsHsfC1a gene in rice, ligate the DNA fragment encoding the sgRNA sequence into a vector carrying CRISPR / Cas9, and transform rice to achieve site-directed mutagenesis of the OsHsfC1a gene in rice.

[0019] Specifically, the vector of CRISPR / Cas9 is pU3-gRNA or pU6-gRNA.

[0020] Specifically, the functional mutation can design a target sequence for Os01g0625300 or LOC_Os01g43590 of the OsHsfC1a gene in rice.

[0021] When using the CRISPR / Cas9 genome editing system to mutate the OsHsfC1a gene in rice, the target sequence recognized by sgRNA conforms to the sequence rules of 5’-Nx-NGC-3’ or 5’-N X -NGT-3’; where N represents any one of A, T, C, and G, x is an integer between 17 and 22, and N X represents X consecutive deoxyribonucleotides.

[0022] As an alternative embodiment, the nucleotide sequence of the target site recognized by the sgRNA is 5’-GCTGCACACGGAGCTCGCGC-3’ (shown in SEQ ID NO.4) or 5’-GCCGCTGCTGCTGCGGCCAGCGT-3’ (shown in SEQID NO.11).

[0023] In addition to using the CRISPR / Cas9 genome editing technology, gene editing technologies such as zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) can also be used to mutate the OsHsfC1a gene in rice.

[0024] Specifically, the method for extending the heading date of rice by mutating the OsHsfC1a gene comprises the following steps:

[0025] S1. Design the sgRNA target sequence and adapter primers;

[0026] S2. Construct the sgRNA vector containing the target sequence fragment: Synthesize the adapter primers, denature the adapter primers and then transfer them to room temperature to cool for annealing; ligate the annealed primer pair to the digested sgRNA vector, and verify the positive plasmid by PCR amplification and sequencing;

[0027] S3. Construct the pCRISPR / Cas9 vector containing the target sequence fragment: Cut the gRNA expression cassette containing the target sequence fragment from the gRNA, and then ligate it to the pCRISPR / Cas9 vector containing the Cas9 expression cassette;

[0028] S4. Transformation: Transform the pCRISPR / Cas9 vector containing the target into rice callus, and through screening, differentiation and rooting to form seedlings, identify the mutant plants;

[0029] S5. Identification of the mutation site: Extract the DNA of the positive plants, design the identification primers to amplify the extracted DNA, after purification, sequence and analyze the mutation situation.

[0030] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.4, the nucleotide sequences of the designed adapter primers are as shown in SEQ ID NO.5 and SEQ ID NO.6.

[0031] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.11, the nucleotide sequences of the designed adapter primers are as shown in SEQ ID NO.12 and SEQ ID NO.13.

[0032] Specifically, the pCRISPR / Cas9 vector is pU3-gRNA or pU6-gRNA.

[0033] Specifically, the primer pair used for identifying the mutation site is as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0034] Specifically, the rice is indica rice.

[0035] More specifically, the rice is the indica rice variety Nanguizhan.

[0036] The present invention also provides a method for shortening the heading date of rice, and the method is: overexpressing the OsHsfC1a gene in rice.

[0037] Specifically, by constructing a recombinant expression vector containing the OsHsfC1a gene and transforming it into rice, overexpression of the OsHsfC1a gene in rice was achieved.

[0038] The present invention also claims the use of a reagent for blocking or inhibiting the expression of the rice OsHsfC1a gene in extending the heading date of rice or creating rice germplasms with a long growth period.

[0039] The present invention also claims the use of a reagent for promoting the expression of the rice OsHsfC1a gene in shortening the heading date of rice or creating rice germplasms with a short growth period.

[0040] Specifically, the rice is indica rice.

[0041] More specifically, the rice is the indica rice variety Nanguizhan.

[0042] In addition, a kit containing a reagent that can mutate the rice OsHsfC1a gene and block or inhibit the expression of the rice OsHsfC1a protein and is useful for extending the heading date of rice or creating rice germplasms with a long growth period should also be within the protection scope of the present invention.

[0043] A kit containing a reagent that can promote the expression of the rice OsHsfC1a gene and is useful for shortening the heading date of rice or creating rice germplasms with a short growth period should also be within the protection scope of the present invention.

[0044] The present invention has the following beneficial effects:

[0045] The present invention provides the application of the rice OsHsfC1a gene in regulating the heading date of rice, providing a new gene source for fine-tuning the regional adaptability of rice varieties. Rice is a typical short-day plant, flowering earlier under short-day conditions and later under long-day conditions. By mutating the rice OsHsfC1a gene, the present invention reduced the expression level of the OsHsfC1a protein in rice plants and found that inhibiting the expression of the OsHsfC1a gene could extend the heading date of rice and delay the growth period; while overexpressing the OsHsfC1a gene could shorten the heading date of rice and advance the growth period. Compared with the wild type, the heading time of the OEHsfC1a plants (rice plants overexpressing the OsHsfC1a gene) decreased by 4 days under both short-day and long-day conditions, the total number of grains per panicle increased, and the seed setting rate did not decrease, indicating that the rice OsHsfC1a gene can regulate the heading date of rice without reducing the rice yield. Therefore, the OsHsfC1a gene can be used as an effective target for rice genetic breeding to construct mutant rice with a delayed / advanced growth period.

[0046] The method of using CRISPR / Cas9 technology to mutate the OsHsfC1a gene to obtain mutants with a slightly delayed growth period provides an effective approach for rice design breeding. Compared with mutants obtained by chemical and physical mutagenesis, it has stronger purposefulness, less damage to the genome, and can avoid the possible risks brought by transgenics. Description of the Drawings

[0047] Figure 1 It is the detection result of the expression level of OsHsfC1a in wild-type rice Nanguizhan and OsHsfC1a gene overexpression plants; *** in the figure indicates extremely significant difference, p < 0.001.

[0048] Figure 2 It is the plant morphology diagram of wild-type rice Nanguizhan, OsHsfC1a gene mutant and overexpression plants; among them, WT is the wild-type rice Nanguizhan plant, CasC1a-8 and CasC1a-14 are OsHsfC1a gene mutant plants, and OEC1a-6 and OEC1a-7 are OsHsfC1a gene overexpression plants.

[0049] Figure 3 It is the statistical result of the heading days and full-heading days of wild-type rice Nanguizhan, OsHsfC1a gene mutant and overexpression plants under the condition of physiological low temperature in rice (the daily maximum temperature is 26 - 28 °C); among them, NGZ is the wild-type rice Nanguizhan plant, CasC1a-8 and CasC1a-14 are OsHsfC1a gene mutant plants, and OEC1a-6 and OEC1a-7 are OsHsfC1a gene overexpression plants; * in the figure indicates significant difference, p < 0.05; ** indicates extremely significant difference, p < 0.01; *** indicates extremely significant difference, p < 0.001.

[0050] Figure 4 It is the statistical result of the heading days and full-heading days of wild-type rice Nanguizhan, OsHsfC1a gene mutant and overexpression plants under the condition of physiological high temperature in rice (the daily maximum temperature is 32 - 36 °C); among them, NGZ is the wild-type rice Nanguizhan plant, CasC1a-8 and CasC1a-14 are OsHsfC1a gene mutant plants, and OEC1a-6 and OEC1a-7 are OsHsfC1a gene overexpression plants; * in the figure indicates significant difference, p < 0.05; ** indicates extremely significant difference, p < 0.01; *** indicates extremely significant difference, p < 0.001.

[0051] Figure 5Statistics of the main panicle length and total number of grains per main panicle per plant for wild-type rice Nanguizhan, OsHsfC1a gene mutants, and overexpressing plants; among them, NGZ is the wild-type rice Nanguizhan plant, CasC1a-8 and CasC1a-14 are OsHsfC1a gene mutant plants, and OEC1a-6 and OEC1a-7 are OsHsfC1a gene overexpressing plants; * in the figure indicates significant difference, p < 0.05; *** indicates extremely significant difference, p < 0.001.

[0052] Figure 6 Statistics of the seed setting rate of wild-type rice Nanguizhan, OsHsfC1a gene mutants, and overexpressing plants; among them, NGZ is the wild-type rice Nanguizhan plant, CasC1a-8 and CasC1a-14 are OsHsfC1a gene mutant plants, and OEC1a-6 and OEC1a-7 are OsHsfC1a gene overexpressing plants; * in the figure indicates significant difference, p < 0.05.

[0053] Figure 7 Statistics of the number of primary branches of wild-type rice Nanguizhan, OsHsfC1a gene mutants, and overexpressing plants; among them, NGZ is the wild-type rice Nanguizhan plant, CasC1a-8 and CasC1a-14 are OsHsfC1a gene mutant plants, and OEC1a-6 and OEC1a-7 are OsHsfC1a gene overexpressing plants; * in the figure indicates significant difference, p < 0.05. Detailed implementation manners

[0054] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0055] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0056] Example 1 Mutating the OsHsfC1a gene

[0057] The OsHsfC1a gene of rice described in the present invention is a heat shock transcription factor, and its nucleotide sequence is shown in SEQ ID NO.1, and it is mutated using the CRISPR / Cas9 technology. The method is as follows:

[0058] 1. Design of the target sequence and adapter primers:

[0059] The target sequence design of the present invention is carried out by using the targetDesign applet (a quick guide - RNA designer for CRISPR / Cas9 / Cpf1 genome editing, http: / / skl.scau.edu.cn / targetdesign / ) (Reference: DOI: http: / / dx.doi.org / 10.1016 / j.molp.2017.06.004).

[0060] The target sequence used in this example is: Target-HsfC1a-U3 (shown in SEQ ID NO.4): 5’-GCTGCACACGGAGCTCGCGC-3’

[0061] The adapter primers are: Target-HsfC1a-U3F (shown in SEQ ID NO.5): 5’-GGCAGCTGCACACGGAGCTCGCGC-3’, Target-HsfC1a-U3R (shown in SEQ ID NO.6): 5’-AAACGCGCGAGCTCCGTGTGCAGC-3’

[0062] 2. Construction of the pU3-gRNA vector containing the Target-HsfC1a-U3 fragment:

[0063] First, synthesize the adapter primers Target-HsfC1a-U3F / R with sticky ends (commissioned by Beijing Ruibo Xingke Biotechnology Co., Ltd.). Denature the adapter primers Target-HsfC1a-U3F / R (heat at 90 °C for 30 s) and then transfer them to room temperature for cooling to complete annealing. Connect the annealed primers to the digested pU3-gRNA vector, and verify the positive plasmid by PCR amplification and sequencing to obtain the pU3-gRNA vector containing the Target-HsfC1a-U3 fragment.

[0064] The primers for PCR amplification to verify the positive plasmid are Target-HsfC1a-U3F / R.

[0065] 3. Construction of the pCRISPR / Cas9 vector containing the Target-HsfC1a-U3 fragment:

[0066] Cut the expression cassette containing the Target-HsfC1a-U3 fragment from the above-mentioned constructed positive plasmid, and then connect it to the pCRISPR / Cas9 vector containing the Cas9 expression cassette. Verify the positive plasmid by PCR amplification and sequencing to obtain the pCRISPR / Cas9 vector containing the Target-HsfC1a-U3 fragment.

[0067] 4. Obtaining of mutant plants:

[0068] The callus of indica rice variety Nanguizhan (NGZ) was transformed with the pCRISPR / Cas9 vector containing the target (Target-HsfC1a-U3) by Agrobacterium tumefaciens-mediated genetic transformation method; after secondary screening, differentiation and rooting to form seedlings, the obtained plants were planted in a screen house, and the mutant plants were identified and screened by sequencing.

[0069] 5. Identification of mutation sites in mutant plants:

[0070] Genomic DNA of positive mutant plants was extracted, and the above genomic DNA was amplified with primers C1aTF (shown in SEQ ID NO.2): 5’-TTGAGGGATTTGACGTGTAG-3’ and C1aTR (shown in SEQ ID NO.3): 5’-ACGAGCAGACGGCCATCGGG-3’. After purification of the product, it was sent to a company for sequencing. The sequencing results were compared with the target sequence of the wild-type plant before transgene to analyze the mutation situation. The reaction conditions were: 98°C for 3 min; 98°C for 30 sec, 58°C for 30 sec, 68°C for 60 sec, 35 cycles; 68°C for 7 min.

[0071] In this example, two different mutant lines were obtained, named CasC1a-8 and CasC1a-14 respectively. The sequencing results of the target sequences in the mutant lines are shown as follows:

[0072] WT (shown in SEQ ID NO.7):

[0073] 5’-TGGACGGGCTGCACACGGAGCTCGCGCTGG-3’

[0074] CasC1a-8 (shown in SEQ ID NO.8):

[0075] 5’-TGGACGGGCTGCACACGGAGCTCG A CGCTGG-3’

[0076] CasC1a-14 (shown in SEQ ID NO.9):

[0077] 5’-TGGACGGGCTGCACACGGAGCTCG T CGCTGG-3’

[0078] Among them, WT represents the target sequence of the wild type; CasC1a-8 and CasC1a-14 represent different mutant lines of OsHsfC1a; "A" and "T" in the sequence represent the inserted bases, and the insertion mutation of the bases indicates the success of the mutation. By comparison, it can be seen that there are base insertion mutations in the target sequence of the mutant lines obtained in this example compared with the wild type, indicating that the OsHsfC1a gene of rice has been successfully mutated in this invention, and the corresponding mutant lines have been obtained.

[0079] Example 2 Mutation of OsHsfC1a Gene

[0080] In this example, the OsHsfC1a gene of rice was mutated using the same method as in Example 1, except that the target sequences used were different.

[0081] 1. Design of target sequence and adapter primers:

[0082] The target sequence used in this example is: Target-HsfC1a-U6 (shown in SEQ ID NO.10): 5’-CTGCTGCTGCGGCCAGCGT-3’

[0083] The adapter primers are: Target-HsfC1a-U6 F (shown in SEQ ID NO.11): 5’-GCCGCTGCTGCTGCGGCCAGCGT-3’, Target-HsfC1a-U6 R (shown in SEQ ID NO.12): 5’-AAACACGCTGGCCGCAGCAGCAG-3’

[0084] 2. Construction of pU6-gRNA vector containing Target-HsfC1a-U6 fragment:

[0085] First, synthesize the adapter primers Target-HsfC1a-U6 F / R with sticky ends; denature the adapter primers Target-HsfC1a-U6 F / R (heat at 90 °C for 30 s) and then move them to room temperature for cooling to complete annealing. Connect the annealed primers to the digested pU6-gRNA vector, and verify the positive plasmid by PCR amplification and sequencing to obtain the pU6-gRNA vector containing the Target-HsfC1a–U6 fragment.

[0086] 3. Construction of pCRISPR / Cas9 vector containing Target-HsfC1a-U6 fragment:

[0087] The expression cassette containing the Target-HsfC1a-U6 fragment was excised from the above-constructed positive plasmid and then ligated to the pCRISPR / Cas9 vector containing the Cas9 expression cassette. The positive plasmid was verified by PCR amplification and sequencing to obtain the pCRISPR / Cas9 vector containing the Target-HsfC1a-U6 fragment.

[0088] 4. Obtaining mutant plants:

[0089] The pCRISPR / Cas9 vector containing the target (Target-HsfC1a-U6) was transformed into the callus of the rice variety Nanguizhan (NGZ) by Agrobacterium-mediated genetic transformation. After secondary screening, differentiation, and rooting to form seedlings, the obtained plants were planted in a net house, and mutant plants were identified and screened by sequencing.

[0090] 5. Identification of mutant sites in mutant plants:

[0091] Genomic DNA of positive mutant plants was extracted, and the above genomic DNA was amplified with primers C1aTF (shown in SEQ ID NO.2): 5’-TTGAGGGATTTGACGTGTAG-3’ and C1aTR (shown in SEQ ID NO.3): 5’-ACGAGCAGACGGCCATCGGG-3’. After purification, the product was sent to a company for sequencing. The sequencing results were compared with the target sequence of the wild-type plant before transgenic transformation to analyze the mutation situation.

[0092] In this example, two different mutant lines were obtained, named CasC1a-3 and CasC1a-4 respectively. The sequencing results of the target sequences in the mutant lines are shown as follows:

[0093] WT (shown in SEQ ID NO.13):

[0094] 5’-TGGCTGCTGCTGCGGCCAGCGTGGGAATGTCGGGA-3’

[0095] CasC1a-3 (shown in SEQ ID NO.14):

[0096] 5’-TGGCTGCTGCTGCGGCCAGC C GTGGGAATGTCGGGA-3’

[0097] CasC1a-4 (shown in SEQ ID NO.15):

[0098] 5’-CGGGCTGCACACGGAGCTCG A CGCTGGGGCTGATCG-3’

[0099] Among them, WT represents the target sequence of the wild type; CasC1a-3 and CasC1a-4 represent different mutant lines of OsHsfC1a; "A" and "C" in the sequence represent inserted bases, and the insertion mutation of the bases indicates the success of the mutation. By comparison, it can be seen that there are base insertion mutations in the target sequence of the mutant line obtained in this example compared with the wild type, indicating that the OsHsfC1a gene of rice has been successfully mutated in the present invention, and the corresponding mutant line has been obtained.

[0100] Example 3 Overexpression of OsHsfC1a Gene

[0101] Take the leaf part of the seedlings of rice variety ZH11, extract the total RNA of the leaves with TriZol Reagent (Invitrogen, its catalog number is: 15596026), detect the purity and concentration of the extracted total RNA with an ultraviolet spectrophotometer, and use 1 μg of total RNA for the initial reverse transcription reaction. The reverse transcriptase used is AMV (TAKARA), and the steps of the reverse transcription reaction refer to the instruction manual of this reverse transcriptase.

[0102] Design primers according to the cDNA sequence of the OsHsfC1a gene provided by NCBI (http: / / www.ncbi.nlm.nih.gov / ). The designed primer sequences are as follows:

[0103] OEC1aF: GGGTACCGGCGCGCCAAGATGGACGGGCTGCACACGGA

[0104] OEC1aR: ATCTTTGTAGTCCATACG AAAGAAAGCTTGACCAAGTA

[0105] Using the reverse transcription product as a template, perform PCR amplification with this pair of primers. The polymerase used in the PCR reaction is KODFX (Toyobo). The reaction system is 50 μL, and the PCR reaction system is prepared according to the instruction manual of KOD FX. The reaction conditions are: 98°C for 3 min; 98°C for 30 sec, 58°C for 30 sec, 68°C for 60 sec, 35 cycles; 68°C for 7 min. A fragment of about 1047 bp is obtained by PCR amplification.

[0106] After recovering the amplified fragments by agarose gel electrophoresis, the fragments and the pCambia1300 vector were double digested with Hind III+Mlu I respectively. After digestion, the target fragments and vector fragments were recovered respectively. They were ligated at 50 °C for 15 min with a homologous recombination enzyme (Nanjing Novoprotein Co., Ltd.). The ligation system was as follows: 5 μL of homologous recombination enzyme, 1 μL (50 ng) of C1a gene fragment, 2 μL (100 ng) of pCambia1300 vector, and made up to 10 μL with water. Take 10 μL of the ligation product and transform it into Escherichia coli DH5α by heat shock transformation. The transformed product was spread on LB solid medium with kanamycin resistance; cultured overnight at 37 °C, pick 10 monoclonal colonies for plasmid extraction and enzyme digestion identification; after enzyme digestion identification, select two positive clones for sequencing detection, and transform the positive plasmid with accurate sequencing results into rice Nanguizhan to obtain overexpression lines.

[0107] Extract total RNA from the flag leaves at the flowering stage of 2 overexpression lines (OEC1a-6 and OEC1a-7), and perform fluorescence quantitative PCR on the reverse transcribed cDNA to detect the expression level of the target gene OsHsfC1a in the overexpression lines. Using the wild type (WT, Nanguizhan) as a control, the detection results of the expression level of OsHsfC1a in the wild type rice Nanguizhan and the OsHsfC1a gene overexpressing plants are as Figure 1 shown. From Figure 1 it can be seen that the target gene OsHsfC1a is highly expressed in the homozygous lines after transgenic, while it is less expressed in the wild type rice lines, indicating that the overexpression lines of the present invention have been successfully obtained.

[0108] The primers used for fluorescence quantitative PCR were:

[0109] qC1Af: TTCTTCAAGCACGGCAACTTC

[0110] qC1aR: CGGCGATTGAATGATACTGAC

[0111] Example 4 Trait Identification

[0112] Cultivate the identified mutant plants and overexpressing plants in Examples 1 and 3 until maturity under natural light conditions in the field, and compare them with the plant morphology, heading days, full heading days, main panicle length per plant, total number of grains per main panicle per plant, seed setting rate and number of primary branches of the wild type rice Nanguizhan for trait identification.

[0113] The plant morphology diagrams of the wild type rice Nanguizhan, OsHsfC1a gene mutants and overexpressing plants are as Figure 2Shown; where WT is the wild-type rice Nanguizhan plant, CasC1a-8 and CasC1a-14 are OsHsfC1a gene mutant plants, and OEC1a-6 and OEC1a-7 are OsHsfC1a gene overexpression plants. From Figure 2 it can be seen that the plant morphologies of OsHsfC1a mutant plants and OsHsfC1a overexpression plants are the same as those of the wild-type Nanguizhan, and all show normal phenotypes.

[0114] The statistical results of the heading days and full-heading days of wild-type rice Nanguizhan, OsHsfC1a gene mutant and overexpression plants under the condition of physiological low temperature in rice (the daily maximum temperature is 26-28 °C) are as Figure 3 shown; the statistical results of the heading days and full-heading days of wild-type rice Nanguizhan, OsHsfC1a gene mutant and overexpression plants under the condition of physiological high temperature in rice (the daily maximum temperature is 32-36 °C) are as Figure 4 shown; in the attached figure, NGZ is the wild-type rice Nanguizhan plant, CasC1a-8 and CasC1a-14 are OsHsfC1a gene mutant plants, and OEC1a-6 and OEC1a-7 are OsHsfC1a gene overexpression plants. From Figure 3 and Figure 4 the results shown, it can be seen that under natural conditions, mutating the OsHsfC1a gene and reducing the expression level of OsHsfC1a protein can extend the heading stage and full-heading stage of rice plants. The heading stage is extended by about 4 days, delaying the growth period of rice, while overexpressing the OsHsfC1a gene can shorten the heading stage and full-heading stage of rice plants. The heading stage is shortened by about 2 days, indicating that the OsHsfC1a gene can regulate the heading stage of rice.

[0115] The statistical results of the main panicle length per plant and the total number of grains per main panicle of wild-type rice Nanguizhan, OsHsfC1a gene mutant and overexpression plants are as Figure 5 shown; the statistical results of the seed setting rate of wild-type rice Nanguizhan, OsHsfC1a gene mutant and overexpression plants are as Figure 6 shown; the statistical results of the number of primary branches of wild-type rice Nanguizhan, OsHsfC1a gene mutant and overexpression plants are as Figure 7 shown; in the figure, NGZ is wild-type rice Nanguizhan, CasC1a-8 and CasC1a-14 are OsHsfC1a gene mutant plants, and OEC1a-6 and OEC1a-7 are OsHsfC1a gene overexpression plants. From Figures 5 to 7It can be seen that under natural conditions, although the mutated OsHsfC1a gene will affect the length of the main panicle per plant and the total number of grains per panicle of the plant, the mutated or overexpressed OsHsfC1a gene will not affect the seed setting rate of rice plants, that is, it will not affect the rice yield. From the above results, it can be seen that the OsHsfC1a gene described in the present invention can be used to create rice germplasms with long growth periods or short growth periods, and fine-tune the regional adaptability of rice varieties.

[0116] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and shall be included in the protection scope of the present invention.

Claims

1. Application of the gene in extending the heading stage of rice OsHsfC1a ​ It is characterized in that Blocking or inhibiting the expression of OsHsfC1a gene in rice to extend the heading stage of rice; the OsHsfC1a gene has a nucleotide sequence as shown in SEQ ID NO.

1.

2. Rice OsHsfC1a Application of the gene in shortening the heading stage of rice It is characterized in that Overexpression in rice OsHsfC1a gene, shortening the heading date of rice; the OsHsfC1a nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. A method for prolonging the heading stage of rice, It is characterized in that The method is as follows: blocking or inhibiting the expression of OsHsfC1a gene in rice, and the OsHsfC1a gene has a nucleotide sequence as shown in SEQ ID NO.

1.

4. According to the method described in claim 3, It is characterized in that The method is as follows: using RNA interference technology to inhibit the expression of rice OsHsfC1a genes; or using gene editing technology to generate functional mutations with insertions, deletions or base conversions of a few bases in the coding region of rice OsHsfC1a genes; or using gene editing technology to delete the rice OsHsfC1a gene sequence.

5. According to the method described in claim 4, It is characterized in that The gene editing technology is a genome editing system based on CRISPR / Cas9.

6. A method for shortening the heading stage of rice, It is characterized in that The method is as follows: overexpress OsHsfC1a gene in rice, and the OsHsfC1a gene has a nucleotide sequence as shown in SEQ ID NO.

1.

7. According to the method described in claim 6, It is characterized in that The method is as follows: construct a recombinant expression vector containing OsHsfC1a gene and transform it into rice.

8. Use of a reagent for blocking or inhibiting rice OsHsfC1a gene expression in extending the heading stage of rice or creating rice germplasm with a long growth period It is characterized in that The said OsHsfC1a The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

9. Application of reagents for promoting rice OsHsfC1a gene expression in shortening the heading date of rice or creating rice germplasm with short growth periods It is characterized in that The OsHsfC1a nucleotide sequence of the gene is shown in SEQ ID NO.

1.

10. According to any one of the applications described in claims 1, 2, 8, 9 or the method described in claim 3 or 6, It is characterized in that The rice is indica rice.

Images