A single-cell full-length transcript library construction and sequencing method

Abstract

The present invention discloses a single-cell full-length transcript library construction and sequencing method. The present invention provides a single-cell full-length transcript library construction and sequencing method, comprising the following steps: A) single-cell labeling and U combination labeling are performed on the mRNA of a single cell; B) the double-labeled cDNA is pre-amplified, sheared, and the library is constructed to obtain a single-cell full-length transcript library; C) the single-cell full-length transcript library is sequenced to achieve single-cell full-length transcript library construction and sequencing. The present invention uses cytosine and methylated cytosine or hydroxymethylated cytosine can be converted under the action of bisulfite or deaminase to change the base (become T), and the original RNA molecule is marked by the position combination of methylated cytosine or hydroxymethylated cytosine added to cDNA during reverse transcription, and the label is used to determine whether the sequencing sequence is from the same RNA molecule, thereby assembling a full-length transcript.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a single-cell full-length transcript library construction and sequencing method. Background Art

[0002] Single-cell transcriptome sequencing is the sequencing of the transcriptome of a single cell. It is one of the most widely used technologies in high-throughput sequencing technology. It can perform high-throughput sequencing on RNA transcribed by tissues or cells at a specific time or functional state. Single-cell transcriptome sequencing allows the study of cell heterogeneity, cell development, tumor microenvironment, etc. from mixed cells to the level of single cells, which can further reveal the law of change at the cellular level of organisms and bring great progress to precision medicine. Single-cell transcriptome technology can classify cells into different types, and can also distinguish cells of the same type into different subtypes. Moreover, it is already possible to use technologies or products such as microporous chips or oil-in-water droplets to achieve transcriptome library sequencing of thousands of single cells at a time, such as 10xgenomics' single-cell RNA sequencing products or BD's corresponding products. The emergence of high-throughput single-cell transcriptome sequencing technology allows researchers to conduct large-scale transcriptome analysis of cells from different tissues of more different species, construct cell maps, study the differences between cell groups and individual cells, and better understand the functions and changes of cells in different tissues. However, the commonly used high-throughput single-cell transcriptome sequencing schemes can only obtain information on the 3' end of mRNA and can only analyze the expression of genes, but cannot obtain information on the full-length transcripts. A large amount of information is lost, making it impossible to conduct in-depth research on the variable splicing of genes and their isoforms. High-throughput single-cell full-length transcriptome sequencing technology can simultaneously perform full-length transcriptome sequencing on a large number of single cells to obtain complete information on mRNA in each cell. In addition to gene expression, it can also analyze the expression form of the same gene in different cells, and further analyze the cell groups that were previously distinguished by the difference in the expression of different genes. Having a complete RNA sequence of the transcript can reveal how the RNA is processed (for example, through selective splicing of the coding part) and whether the RNA is produced by the mother's or the father's gene copy (allele).

[0003] There are currently two solutions to the above problems:

[0004] 1. Mature high-throughput single-cell RNA library construction technology combined with single-molecule sequencing:

[0005] For example, the single-cell RNA library construction kit of 10X Genomics is used to obtain the full-length cDNA library of a single cell, which is then constructed using the library construction technology of the Pacbio platform or the ONT platform. The full-length transcripts of single cells are then measured using single molecules. By studying the transcript characteristics of different subpopulations of cells, subpopulation-specific transcripts are discovered, which studies cell heterogeneity from another perspective. Specific scheme for single-cell RNA library construction combined with single-molecule sequencing: Use the existing smart-seq or smart-seq2 method to obtain the full-length cDNA in a single cell, that is, use a reverse transcription primer with oligo-dT to hybridize with the polyA on the mRNA in a single cell, and the MMLV reverse transcriptase used can add 3 C bases to the 5' end of the cDNA after completing the reverse transcription of the full-length RNA, and then use the TSO (Template switch oligo) primer for template conversion. The TSO primer 3' consists of 3 guanine ribonucleotides (rGrGrG) and the same primer at 5'. After completing the reverse transcription, the full-length double-stranded cDNA can be amplified using universal primers, and then the library is constructed according to the library construction technology corresponding to the single-molecule sequencing platform used (such as Pacbio and ONT), and then the full-length cDNA library is sequenced to obtain the full-length transcript of the single cell.

[0006] The construction of a single-cell RNA library combined with single-molecule sequencing has, to a certain extent, solved the problem of not being able to obtain full-length transcripts of single cells. However, the current costs of high-throughput single-cell RNA library construction reagents and single-molecule sequencing are very high. When the two are combined, the cost increases exponentially, making this method difficult to promote on a large scale. Moreover, the sequencing accuracy of current single-molecule sequencing is relatively low. When the transcripts are quantified, the accuracy of quantification will be reduced. In order to increase the accuracy, the amount of data needs to be increased, which further increases the sequencing cost. Therefore, although the scheme of single-cell RNA library construction combined with single-molecule sequencing can obtain complete full-length transcripts, the cost is very high; at the same time, due to the low accuracy of single-molecule sequencing, it will affect the accuracy of transcript analysis. If data with high sequencing accuracy is required, the sequencing amount needs to be increased, which further increases the sequencing cost. Therefore, a low-cost single-cell full-length transcript solution is needed.

[0007] 2. Smart-seq3 technology enables low-cost single-cell full-length transcriptome

[0008] Based on smart-seq2, the improved smart-seq3 technology is a low-cost single-cell full-length transcriptome solution. The transcripts obtained in this way are certainly not as long and complete as the full-length transcripts obtained by the three major methods such as Pacbio, but compared with the ordinary single-cell transcriptome, the transcript length has been greatly increased, providing the characteristics of the transcriptome at the single-cell level. Smart-seq3 library construction method: Its library construction method is basically the same as smart-seq2, except that: the Tn5 transposase embedding sequence contains a unique tag sequence (UMI). Its library construction process is to first hybridize the mRNA containing the polyA tail through the oligo-dT primer, and use reverse transcriptase for reverse transcription. After the full-length RNA is reverse transcribed, the reverse transcriptase adds 3 C bases to the 5' end of the cDNA, and then uses TSO primers for template conversion. The TSO primers are composed of 3 guanine ribonucleotides (rGrGrG) and UMI sequences and Tag sequences and Tn5 universal sequences. After the reverse transcription is completed, the full-length cDNA library is synthesized. Then, the reverse transcribed sequence is amplified by PCR to amplify multiple sequences with the same tag. Tn5 transposase is then used to break and label the sequence to construct a library for sequencing, and then the library is sequenced on both ends. The obtained double-end sequence selects reads with unique tag sequences to construct extended transcripts. In the process of constructing the transcriptome, the double-end sequence of the 5' end UMI sequence is mainly selected. For reads from the same transcript, the UMI sequence of the 5' end reads is consistent, but the sequence of the 3' end is inconsistent. Therefore, the sequence of the 5' end with the same UMI can be merged with the sequence of different 3' ends to extend the transcript and obtain a longer transcript ( Figure 1 , Reference: Hagemann-Jensen, M., et al. (2020). "Single-cell RNA counting at allele andisoform resolution using Smart-seq3." Nat Biotechnol 38(6):708-714.).

[0009] Although the library construction method of Smart-seq3 can obtain longer transcripts, the utilization rate of data is low. The reads in the middle of the mRNA cannot be mapped to the corresponding transcripts because there is no corresponding 5' UMI information, resulting in data waste. In addition, different lengths of libraries are required to ensure the length of the extended transcripts, resulting in uneven library lengths, affecting the sequencing quality. In addition, since the sequencing difficulty of overly long libraries will also increase, the length and integrity of the final transcript will be limited. Due to the above problems, this method will waste more data when applied to high-throughput single-cell RNA sequencing, and it is difficult to obtain the complete full-length transcript length.

[0010] Therefore, choosing a more suitable high-throughput single-cell full-length transcriptome sequencing technology has become a research hotspot. Summary of the invention

[0011] One object of the present invention is to provide a single-cell full-length transcript library construction and sequencing method.

[0012] The method provided by the present invention comprises the following steps:

[0013] A) Dual labeling and C conversion of mRNA from a single cell to obtain dual labeled cDNA;

[0014] The double labeling includes single cell labeling and U combination labeling;

[0015] The single cell labeling is to capture the mRNA using a PolyT oligo primer with a single cell labeling sequence;

[0016] The U combination labeling is to perform reverse transcription and template switching reaction on the mRNA under the action of template switching TSO primer and reverse transcriptase, and to add methylated C or hydroxymethylated C during the reaction to achieve re-labeling, thereby forming cDNA with methylated C and unmethylated C combination labeling;

[0017] The reverse transcription and template switching reaction system includes methylated C or hydroxymethylated C, template switching TSO primer and reverse transcriptase;

[0018] The C conversion is to convert the methylated C or unmethylated C in the cDNA carrying the single cell marker sequence and the combined markers of methylated C and unmethylated C into U, so as to obtain cDNAs with combined markers of U bases at different positions and unmethylated C or cDNAs with combined markers of U bases at different positions and methylated C, which are recorded as double-labeled cDNAs;

[0019] The above-mentioned single cell labeling and U combination labeling can be implemented in one system, or single cell labeling can be performed first and then U combination labeling can be performed.

[0020] B) pre-amplifying, shearing, and library construction of the double-labeled cDNA to obtain a single-cell full-length transcript library;

[0021] C) sequencing the single-cell full-length transcript library to achieve single-cell full-length transcript library construction and sequencing.

[0022] In the above method, the method of double labeling and C conversion of mRNA of a single cell may be:

[0023] 1) Firstly lyse the single-cell mRNA, and then use the PolyT oligo primer with a single-cell marker sequence to capture the mRNA to obtain the mRNA with the single-cell marker;

[0024] The microdroplet method can be used to obtain and capture single-cell mRNA. In the embodiment of the present invention, the single-cell mRNA is specifically lysed, and then the DNBelab C series single-cell RNA library preparation kit (Shenzhen MGI Intelligent Manufacturing Technology Co., Ltd., product number 1000021082) is used to lyse the single cell and the magnetic beads with PolyT oligo primers in the kit are used to separate and label the single cells;

[0025] 2) subjecting the mRNA with the single cell marker to reverse transcription and template switching reaction under the action of the template switching TSO primer and reverse transcriptase, and adding methylated C or hydroxymethylated C during the reaction to achieve re-labeling, thereby obtaining cDNA with the single cell marker sequence and a combination of methylated C and unmethylated C markers;

[0026] 3) converting the methylated C in the cDNA carrying the single cell marker sequence and the combination of methylated C and unmethylated C markers into U, to obtain cDNAs with combination markers of U bases and unmethylated C at different positions, which are recorded as double-labeled cDNAs;

[0027] Alternatively, the unmethylated C in the cDNA carrying the single cell marker sequence and the combined markers of methylated C and unmethylated C is converted to U to obtain cDNAs with combined markers of U bases and methylated C at different positions, which are recorded as double-labeled cDNAs.

[0028] The single cell labeling and U combined labeling of the mRNA of a single cell described in step A above can also be achieved by the following method:

[0029] 1) Lysing the mRNA of a single cell as a template, performing reverse transcription and template switching reaction under the action of the PolyT oligo primer and the template switching TSO primer, and adding methylated C or hydroxymethylated C in the reverse transcription and template switching reaction to obtain cDNA with a single cell marker sequence and a combined marker of methylated C and unmethylated C;

[0030] 2) converting the methylated C in the cDNA carrying the single cell marker sequence and the combination marker of methylated C and unmethylated C into U, to obtain cDNAs with combination markers of U bases and unmethylated C at different positions, which are recorded as double-labeled cDNAs;

[0031] Alternatively, the unmethylated C in the cDNA carrying the single cell marker sequence and the combined markers of methylated C and unmethylated C is converted to U to obtain cDNAs with combined markers of U bases and methylated C at different positions, which are recorded as double-labeled cDNAs.

[0032] The above method for converting methylated C in cDNA into U in an embodiment of the present invention is: using TET enzyme and pyridine borane to convert methylated C into U, but it is not limited to this method, and other methods that can achieve this purpose are also acceptable.

[0033] Alternatively, the unmethylated C in the cDNA labeled with a combination of methylated C and unmethylated C is converted to U to obtain cDNA labeled with a combination of U bases and methylated C at different positions, which is recorded as double-labeled cDNA.

[0034] The above-mentioned method for converting unmethylated C in cDNA into U in an embodiment of the present invention is: using cytosine dioxygenase (TET) and T4β-glucosyltransferase to treat cDNA, and then using deaminase APOBEC to deaminize the C base to convert the unmethylated C into U. It is not limited to this method, and other methods that can achieve this purpose are also acceptable.

[0035] In the above method, the PolyT oligo primer includes a universal primer sequence, a linker sequence, a cell marker sequence, a UMI, PolyT and NV nucleotides;

[0036] Specifically: the universal primer sequence is TTGTCTTCCTAAGGAA;

[0037] The adapter sequence is CGACATGGCTACGATTCTGCG (corresponding to the DNBSEQ platform of MGI); if the Illumina sequencing platform is used, the adapter sequence uses the adapter sequence corresponding to Illumina.

[0038] Cell barcodes are known fixed sequence combinations, the number of which can reach hundreds of thousands, and their purpose is to mark individual cells, with n cells marked with n cell barcode sequences. In the embodiment of the present invention, the cell barcode sequences are those in the DNBelab C series single cell RNA library preparation kit MGI, 1000021082.

[0039] The UMI sequence consists of 6 to 12 random bases, which serve to uniquely mark the mRNA molecule and distinguish different transcripts.

[0040] PolyT may be composed of 10-30 Ts, and in the embodiment of the present invention, 21 Ts are specifically used as an example.

[0041] N is any of the four bases A / T / C / G, and V is any of the three bases A / C / G.

[0042] The template switching TSO primer includes the universal primer sequence and three consecutive rGs, specifically CGACATGGCTACGAT (universal primer) / rG / rG / rG.

[0043] In the above step B, the double-labeled cDNA is pre-amplified, sheared, and library constructed to obtain a single-cell full-length transcript library; specifically as follows:

[0044] The double-labeled cDNA was pre-amplified using the CGACATGGCTACGAT primer corresponding to the universal primer, and the cDNA was sheared using a shearing enzyme (the shearing enzyme in the high-throughput single-cell RNA library preparation kit of MGI in the embodiment of the present invention), end-repaired, end-repaired AT, linkers added, PCR amplified, single-stranded circularized, and enzyme digested to obtain a sequencing library.

[0045] The present invention provides a single cell full-length transcript library construction method, which is steps A)-B) of the above method.

[0046] Another object of the present invention is to provide a kit for constructing a library and sequencing the full-length transcripts of a single cell.

[0047] The kit provided by the present invention comprises the following substances:

[0048] 1) the oligo primer of PolyT;

[0049] 2) the template switching TSO primer;

[0050] 3) A reagent for converting methylated C to U or a reagent for converting unmethylated C to U.

[0051] The application of the above method in single-cell full-length transcript library construction and sequencing is also within the scope of protection of the present invention;

[0052] Or the application of the above method in library construction and sequencing of spatially transcribed full-length transcripts is also within the scope of protection of the present invention.

[0053] The application of the above kit in single-cell full-length transcript library construction and sequencing is also within the scope of protection of the present invention;

[0054] Alternatively, the application of the above-mentioned kit in library construction and sequencing of spatially transcribed full-length transcripts is also within the scope of protection of the present invention.

[0055] The technical solution of the present invention solves the extremely high sequencing cost and low sequencing accuracy caused by using single-molecule sequencing, and can solve the problem that Smart-seq3 cannot use the middle part of RNA reads, resulting in data waste and incomplete transcript length, as well as its inability to be used for high-throughput single-cell sequencing.

[0056] The present invention utilizes the fact that cytosine and methylated cytosine or hydroxymethylated cytosine can be transformed under the action of bisulfite or deaminase to cause base changes (to T), and can use the position and frequency of methylated cytosine or hydroxymethylated cytosine incorporation to mark the cDNA molecules after reverse transcription when the RNA molecules are reverse transcribed. After the cDNA after labeling is interrupted and sequenced, these labels can be used to determine whether the reads are from the same RNA molecule, so that these reads can be mapped back to the source RNA molecules and assembled into complete transcripts. Among them, RNA can be from a single cell and RNA with a single cell label, such as single cell RNA that is separated and labeled by using oil-in-water droplets. In this way, after sequencing, the cell source of the RNA molecule can be determined by the double-end sequencing reads of reads1 with a single cell label (cell barcode) and reads2 with a label of a base change (C to T) at a specific position, thereby achieving high-throughput single-cell full-length transcript sequencing.

[0057] The present invention labels the full-length RNA molecule and then constructs a library for sequencing, and then uses a second-generation sequencing platform for sequencing, which reduces the sequencing cost and increases the sequencing accuracy compared to the single-molecule sequencing platform; and because the entire molecule including the middle part is labeled, the data measured in the middle part of the RNA can also be used to assemble transcripts, increasing the length and integrity of the assembled transcripts, and reducing data waste. At the same time, it can also be combined with the current high-throughput single-cell library construction technology to achieve high-throughput single-cell full-length transcriptome sequencing, thereby increasing the scope of application.

[0058] The present invention uses cytosine and methylated cytosine or hydroxymethylated cytosine to mark the original RNA molecule based on the fact that cytosine and methylated cytosine or hydroxymethylated cytosine can be converted under the action of bisulfite or deaminase to change the base (become T). The methylated cytosine or hydroxymethylated cytosine is added to the cDNA during reverse transcription to mark the original RNA molecule. The mark is used to determine whether the sequencing sequence is from the same RNA molecule, thereby assembling a full-length transcript. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1Schematic diagram of the Smart-seq3 full-length transcript sequencing method.

[0060] Figure 2 Schematic diagram of the full-length transcript library construction and sequencing process based on cytosine conversion, where A\B\C represent different mRNA transcripts, and A1\A2\A3 represent the copies obtained after mRNA reverse transcription amplification. DETAILED DESCRIPTION

[0061] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0062] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0063] Example 1: Establishment of a single-cell full-length transcriptome sequencing method

[0064] The specific steps of the single-cell full-length transcriptome sequencing method of the present invention are as follows: Figure 2 ):

[0065] The DNBelab C series single cell RNA library preparation kit MGI, 1000021082 or Chromium Next GEM Single Cell 3′Kit v3.1 (10x Genomics, 1000268) can be used to obtain and capture single cell mRNA, and further perform transcription sequencing;

[0066] Alternatively, the cells can be lysed first and then the corresponding primers can be used for capture transcription sequencing, which will be described separately below.

[0067] (I) Single-cell full-length transcriptome sequencing using the microdroplet method

[0068] 1. Microdroplet method to obtain and capture single-cell mRNA

[0069] The details are as follows:

[0070] Single cells were isolated and obtained, and MGI's high-throughput single-cell RNA library preparation kit (DNBelab C series single-cell RNA library preparation kit, Shenzhen MGI Intelligent Manufacturing Technology Co., Ltd., product number 1000021082) was used to lyse and separate and label the single cells. The reagents used for single cell lysis were the reagents in the kit; the magnetic beads with PolydT oligo in the kit were used for single cell separation and labeling; droplets (containing single-cell labeled magnetic beads after demulsification) were collected into PCR tubes, and the droplets contained mRNA and lysate bound to oligo primers with PolydT.

[0071] The purpose of the magnetic beads with PolydT oligo in the above kit is to capture mRNA, wherein the PolyT oligo primer includes, from 5' to 3' end: universal primer sequence, adapter sequence, cell marker sequence, UMI, PolyT and NV nucleotides (N is any one of the four bases A / T / C / G, and V is any one of the three bases A / C / G);

[0072] The universal primer sequence was TTGTCTTCCTAAGGAA (sequence 1);

[0073] The adapter sequence is CGACATGGCTACGATTCTGCG (sequence 2, corresponding to the DNBSEQ platform of MGI); if the Illumina sequencing platform is used, the adapter sequence uses the adapter sequence corresponding to Illumina.

[0074] The purpose of the cell barcode is to mark a single cell, and n cells are marked with n cell barcode sequences. In the embodiment of the present invention, it is the cell barcode sequence in the DNBelab C series single cell RNA library preparation kit MGI, 1000021082.

[0075] The UMI sequence consists of 6 to 12 random bases, which serve to uniquely mark the mRNA molecule and distinguish different transcripts.

[0076] PolyT may be composed of 10-30 Ts, and in the embodiment of the present invention, 21 Ts are specifically used as an example.

[0077] 2. Reverse transcription and template switching of single-cell mRNA

[0078] 1. Design and synthesize relevant primers ( Figure 2 (shown)

[0079] The TSO primer used for template switching includes, from 5' to 3' end: a universal primer sequence and three consecutive rGs;

[0080] The specific sequence is TSO: CGACATGGCTACGAT (universal primer) / rG / rG / rG

[0081] 2. Reverse transcription and template switching

[0082] Principle: When mRNA is reverse transcribed, methylated C is added so that some positions of the cDNA that should have been C bases will be randomly replaced by methylated 5mC or 5hmC. The position combination of C replaced in the cDNA reverse transcribed from each RNA molecule is almost unique and can be used as a marker for the RNA molecule. Each RNA molecule will have a combination of non-methylated C and methylated C at different positions as a marker (similar to the haploid type of the genome). In addition, when using M-MLV reverse transcription for reverse transcription, three Cs will be added to the 3' end of the cDNA that has completed reverse transcription. The three rGrGrG on TSO will hybridize with these three Cs. At this time, the reverse transcription enzyme will continue to use TSO as a template for reverse transcription, thus adding a universal sequence to the 3' end of the cDNA.

[0083] Methods: Using the different single-cell mRNAs captured by the above-mentioned oligo primer magnetic beads with PolyT as templates, template-converting TSO primers were added to reverse transcribe and template-convert mRNA with PolyA, and a certain proportion of 5mdCTP or 5hmCTP was incorporated into the reaction system to obtain cDNA. The cDNA of each single cell will have a combination of unmethylated C and methylated C at different positions as markers.

[0084] Prepare the following system according to the table:

[0085] Table 1 is the RT reaction buffer system

[0086] Components Single reaction volume (μL) 5x First Strand Buffer (BGI, 01E022MM with reverse transcriptase) 10μL 25mM dNTP Solution Mix(ENZYMATICS,N2050-25) 2μL 10mM 5-methyl-dCTP(NEB,N0356S) 11.25μL 1M MgCl2 0.375μL 100mM DTT (BGI, 01E022MM comes with reverse transcriptase) 2.5μL 5M Betaine (Sigma, B0300) 10μL Molecular grade water 6.125μL Total volume 41.25μL

[0087] Table 2 shows the RT enzyme mix system

[0088] Components Single reaction volume (μL) Alpha Reverse Transcriptase(BGI,01E022MM) 2.5μL RNase inhibitor (BGI, 01E019MM) 1.25μL Total volume 3.75μL

[0089] Table 3 shows the RT Primer Mix system.

[0090] Components Single reaction volume (μL) PolyT oligo primer 2.5μL Template switching TSO primer 2.5μL Total volume 5μL

[0091] The reverse transcription and template switching steps are as follows:

[0092] Add 41.25 μL of the RT reaction buffer in Table 1, 3.75 μL of the RTenzyme mix in Table 2, and 2.5 μL of the 100 μM concentration template switching TSO primer to the PCR tube of the 2.5 μL volume droplet collected above (containing mRNA bound to the oligo primer with PolydT) to obtain a reverse transcription and template replacement system, mix the system briefly, centrifuge it, and immediately place it on ice. The final concentration of the template switching TSO primer in the reverse transcription and template replacement system is 5 μM.

[0093] Then place the PCR tube containing the reverse transcription and template replacement system on a PCR instrument, perform the reaction according to the procedure in Table 4 below, and then separate the magnetic beads to obtain cDNA after reverse transcription and template replacement.

[0094] Table 4 shows the degree of reverse transcription and template displacement

[0095]

[0096]

[0097] 3. Conversion of C into U

[0098] Use any of the following methods:

[0099] 1. Convert methylated C in cDNA into U

[0100] The cDNA obtained in the above two steps is converted so that the methylated C in the cDNA is converted into U, thereby obtaining a cDNA containing U, so that the molecular marker of the cDNA becomes a combination marker of U bases at different positions and non-methylated C.

[0101] The method for converting methylated C in cDNA into U is as follows: the methylated C is converted into U using TET enzyme and pyridine borane.

[0102] 2. Convert unmethylated C in cDNA to U

[0103] The cDNA obtained in the above two steps is converted so that the non-methylated C in the cDNA is converted into U, thereby obtaining a cDNA containing U, so that the molecular marker of the cDNA becomes a combination of U bases at different positions and a combination marker of methylated C.

[0104] The method for converting unmethylated C in cDNA into U is as follows: cDNA is treated with cytosine dioxygenase (TET) and T4β-glucosyltransferase, and then deaminase APOBEC is used to deaminize the C base to convert the unmethylated C into U.

[0105] 4. cDNA Pre-amplification

[0106] Using the U-containing cDNA obtained in any of the three ways as a template, PCR amplification is performed using PCR primers corresponding to the universal sequence, so that the original cDNA molecule will be amplified into multiple cDNA double-stranded molecules with the same combination of tags.

[0107] The sequence of the above PCR primer is as follows: CGACATGGCTACGAT.

[0108] 5. Interrupt database construction

[0109] 1. Cutting cDNA

[0110] The cDNA was sheared using the shearing enzyme in the MGI high-throughput single-cell RNA library preparation kit to obtain sheared cDNA.

[0111] 2. Establish sequencing library

[0112] The above-mentioned interrupted cDNA is subjected to terminal repair, A addition, sequencing adapter addition, PCR amplification, etc. in sequence to obtain a sequencing library.

[0113] The sequencing adapters can be adapter sequences of different sequencing platforms, such as DNBSEQ and Illumina platforms. The library construction steps are completed according to the requirements of different sequencing platforms.

[0114] 6. Sequencing

[0115] After the library is built, use the corresponding sequencing platform for double-end sequencing. The sequencing length can be adjusted according to the library length, generally 50bp to 250bp.

[0116] VII. Sequencing Data Analysis

[0117] After sequencing is completed, the sequencing data is filtered and aligned, and the reads with the same combination are continuously assembled using the T base combination molecular labels in the reads that cannot be aligned with the reference genome. Finally, the full-length transcriptome is assembled, and then reads1 with cell barcode and UMI are selected to determine the cells and expression levels of the assembled full-length transcriptome, thereby achieving high-throughput single-cell full-length transcriptome sequencing.

[0118] (II) Single cell lysis followed by primer capture and transcription sequencing for single cell full-length transcriptome sequencing Method 1: Single cell lysis to release mRNA

[0119] Different single cells to be sequenced are separated into separate tubes and lysed to obtain lysates containing different single cell mRNAs.

[0120] 2. Single-cell mRNA capture, reverse transcription, and template switching

[0121] The primers are the same as those in (I) above. PolyT oligo primers are used to achieve capture, and TSO primers are used to achieve reverse transcription and template switching. The specific steps are as follows:

[0122] The lysate containing different single cell mRNA obtained above, the RT reaction buffer system in Table 1, the RT enzyme mix system in Table 2, and the RT Primer Mix system in Table 3 were mixed to obtain a reaction, the system was briefly mixed and centrifuged, and immediately placed on ice. The final concentration of the PolyT oligo primer in the reaction system was 5 μM, and the final concentration of the TSO primer was 5 μM.

[0123] Then place the PCR tube containing the above reaction system on a PCR instrument, perform the reaction according to the program in Table 4, and then separate the magnetic beads to obtain cDNA after reverse transcription and template replacement.

[0124] 3 to 7. Steps 3 to 7 are the same as above (a).

[0125] Example 2: Single-cell full-length transcriptome sequencing of mouse kidney tissue

[0126] The samples in the following examples were purchased from kidney tissues of C57BL / 6 mice. The experiment was repeated twice, one named M-1 and the other named M-2.

[0127] 1. Microdroplet method to obtain and capture single-cell mRNA

[0128] 1. Isolation of single cells from mouse kidney tissue

[0129] 1) Carefully remove the kidney tissue from the mouse after dissection and place it in a culture dish. Place the culture dish on ice to keep it low throughout the process. Add 2 ml of pre-cooled PBS to rinse the tissue to remove blood stains, discard the liquid, and repeat the washing once.

[0130] 2) Place the rinsed tissue in a new culture dish, place the dish on the back of the ice box, add 2 ml of pre-cooled PBS (10010031 Gibco) to the dish, and use scissors to cut the tissue into pieces of 0.5 mm. 3 about.

[0131] 3) Prepare a 15 ml centrifuge tube, mark it, and use a rubber-tipped dropper to transfer the chopped tissue together with the culture medium to the 15 ml centrifuge tube. Add 1 ml of pre-cooled PBS to the culture dish, rinse and resuspend the remaining tissue, transfer it to the centrifuge tube, add pre-cooled PBS to 4 ml in the centrifuge tube, and add 4 ml of 10% universal collagenase (C0130 Sigma-Aldrich Collagenasefrom Clostridium histolyticum).

[0132] 4) After adding, slowly invert to mix, put into 37℃ oven on mixer, digest for 60min at 15r / min

[0133] 5) Take 30μm Pre-Separation Filters (Meitianni, 130-041-407) and put them into a 15ml centrifuge tube, rinse with 1ml pre-cooled PBS, and after rinsing, use a rubber-tipped dropper to pass all samples in the tube through the 30μm Pre-Separation Filter. After the liquid has passed through the 30μm Pre-Separation Filter, rinse the dissociation centrifuge tube with 2ml PBS, pass through the 30μm Pre-Separation Filter, and collect the cell suspension.

[0134] 6) Centrifuge at 300g for 7 min, remove the supernatant, and immediately lyse the red blood cells.

[0135] 7) Add 300 μl PBS to the cell pellet, then add 3 ml red blood cell lysis buffer (Biyuntian C3702-120 ml), mix by pipetting, and let stand at room temperature for 10 min.

[0136] 8) Add 7 ml of PBS and gently invert to mix, centrifuge at 300g for 7 min, remove the supernatant, and add 3 ml of PBS to resuspend to obtain a single cell resuspension of kidney tissue.

[0137] 2. Single cell lysis and single cell separation and labeling

[0138] According to step 1 of Example 1 (i), the above-mentioned renal tissue single cell resuspension was lysed and single cells were separated and labeled, and the droplets (containing the demulsified single cell labeled magnetic beads) were collected into a PCR tube.

[0139] Among them, the oligo primer of PolyT includes from 5' to 3' end: TTGTCTCCTAAGGAA (universal sequence) CGACATGGCTACGATTCTGCG (linker sequence) cell barcode sequence NNNNNNNNNNNN (UMI) TTTTTTTTTTTTTTTTTTTTTTTVN

[0140] 2. Reverse transcription and template switching of single-cell mRNA

[0141] Follow step 2 in Example 1 (a):

[0142] 1. Design and synthesize relevant primers

[0143] Template switching oligo TSO primer: CGACATGGCTACGAT (universal sequence) / rG / rG / rG (3 ribonucleotide modified Gs).

[0144] 2. Reverse transcription and template replacement

[0145] 1) Add 41.25 μL of the RT reaction buffer in Table 1, 3.75 μL of the RTenzymemix in Table 2, and 2.5 μL of the template switching TSO primer at a concentration of 100 μM to the PCR tube containing the 2.5 μL droplets collected above (containing the mRNA bound to the oligo primer with PolydT) to obtain a reverse transcription and template replacement system, mix the system briefly, centrifuge it, and immediately place it on ice. The final concentration of the template switching TSO primer in the reverse transcription and template replacement system is 5 μM. Then place the PCR tube containing the reverse transcription and template replacement system on a PCR instrument and react according to the procedure in Table 4 below.

[0146] 2) After the reaction is completed, centrifuge briefly to collect the liquid in the PCR tube to the bottom of the tube.

[0147] 3) After instant centrifugation, place the PCR tube on a magnetic rack and let it stand for 5 minutes until the liquid becomes clear. Use a pipette to aspirate and discard the supernatant.

[0148] 4) Add 200ul 75% ethanol to the PCR tube and let stand for 30s to wash the magnetic beads.

[0149] 5) Repeat the previous step. Try to drain the liquid in the tube. If there is a small amount of liquid left on the tube wall, centrifuge the PCR tube instantly, separate it on the magnetic rack, and use a small-range pipette to drain the liquid at the bottom of the tube.

[0150] 6) Keep the PCR tube fixed on the magnetic rack, open the tube cover, and dry it at room temperature until the surface of the magnetic beads is non-reflective and free of cracks.

[0151] 7) Remove the PCR tube from the magnetic stand, add 30 μL of molecular grade water for elution, and gently pipette 10 times to mix thoroughly.

[0152] 8) Transfer 28 μL of supernatant to a new 200 ul PCR tube to obtain cDNA after reverse transcription and template switching connected to magnetic beads.

[0153] 3. Conversion of C into U

[0154] According to step 3 in (a) of Example 1, the methylated C in the cDNA is converted into U, as follows:

[0155] The reagents in the NEBNext Enzymatic Methyl-seq Kit (NEB, E7120S) were used to convert the 5mC added to the cDNA after reverse transcription and template conversion of the magnetic beads connected to the above two.

[0156] After the transformation is completed, the purified DNA is transferred to a new 200ul PCR tube to obtain cDNA containing U connected to magnetic beads, so that the molecular marker of the cDNA becomes a combination marker of U bases at different positions and unmethylated C.

[0157] 4. cDNA Pre-amplification

[0158] The cDNA containing U connected to the magnetic beads obtained above is used as a template and PCR primers are used to perform PCR amplification to obtain a cDNA pre-amplification product, in order to increase the amount of cDNA.

[0159] The sequence of the above PCR primer is as follows: CGACATGGCTACGAT.

[0160] The above pre-amplification system is shown in Table 5 below:

[0161] Table 5 is the preparation of cDNA amplification reaction solution

[0162]

[0163] Here are the steps:

[0164] 1) Add the prepared cDNA amplification reaction solution in Table 5 to the PCR tube containing U cDNA connected to magnetic beads obtained in the above three, mix and centrifuge briefly, place it on a PCR instrument, and react according to the reaction conditions in Table 6 below.

[0165] Table 6 shows the extent of pre-amplification reaction

[0166]

[0167]

[0168] 2) Add 30ul of purified magnetic beads (from DNBelab C Series Single Cell RNA Library Preparation Kit MGI, 1000021082) to the centrifuge tube, pipette 10 times to mix thoroughly, and incubate at room temperature for 10 minutes.

[0169] 3) After instant centrifugation, place the 1.5 mL centrifuge tube on a magnetic stand and let it stand for 5 minutes until the liquid becomes clear. Use a pipette to aspirate and discard the supernatant.

[0170] 4) Add 200ul 75% ethanol to a 1.5mL centrifuge tube and let stand for 30s to wash the magnetic beads.

[0171] 5) Repeat the previous step. Try to drain the liquid in the tube. If there is a small amount of liquid left on the tube wall, centrifuge the 1.5mL centrifuge tube instantly, separate it on the magnetic rack, and drain the liquid at the bottom of the tube with a small-range pipette.

[0172] 6) Keep the 1.5 mL centrifuge tube fixed on the magnetic rack, open the cap of the 1.5 mL centrifuge tube, and dry it at room temperature until the surface of the magnetic beads is non-reflective and free of cracks.

[0173] 7) Remove the 1.5 mL centrifuge tube from the magnetic stand, add 22 μL of molecular grade water to elute the DNA, and gently pipette 10 times to mix thoroughly.

[0174] 8) Incubate at room temperature for 5 min.

[0175] 9) Centrifuge briefly, place the 1.5 mL centrifuge tube on a magnetic rack, let stand for 5 min until the liquid becomes clear, transfer 20 μL of the supernatant to a new 200 ul PCR tube to obtain the cDNA pre-amplification product.

[0176] 5. Interrupt database construction

[0177] 1. Enzymatic disruption

[0178] Prepare 200 ng of the above four prepared cDNA pre-amplification products into a 0.2 mL PCR tube, use NF Water to make up the volume to 45 μL, and place the PCR tube on ice. Use the fragmentation enzyme from the DNBelab C series single cell RNA library preparation kit to fragment the cDNA.

[0179] The specific steps are as follows:

[0180] 1) Take out Frag Enzyme (from DNBelab C Series Single Cell RNA Library Preparation Kit MGI, 1000021082), gently invert and mix 10 times, centrifuge briefly and place on ice for later use.

[0181] 2) Prepare the interruption reaction solution on ice according to Table 7.

[0182] Table 7 is the interruption reaction solution

[0183]

[0184]

[0185] 3) Use a pipette to draw 15 μL of the prepared disruption reaction solution and add it to the PCR tube containing the cDNA pre-amplification product obtained in the above four steps. Vortex for 3 times, each time for 3 seconds, and centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0186] 4) When the temperature of the PCR instrument drops to 4°C, place the PCR tube on the PCR instrument and react according to the conditions in Table 8 below.

[0187] Table 8 is the interruption reaction program

[0188] temperature time 105℃ hot cover On 4℃ 1min 30℃ 15min 72℃ 10min 4℃ Hold

[0189] 5) Centrifuge briefly to collect the reaction solution at the bottom of the tube, transfer all the liquid to a new 1.5 mL centrifuge tube, and add TE to 100 μL.

[0190] 6) Take out the DNA Clean Beads in advance, place them at room temperature for at least 30 minutes, and shake them thoroughly before use.

[0191] 7) Use a pipette to pipette 70 μL DNA Clean Beads (from DNBelab C Series Single Cell RNA Library Preparation Kit MGI, 1000021082) into a new 1.5 mL centrifuge tube and gently pipette at least 10 times to mix thoroughly. The last time, make sure that all the liquid and magnetic beads in the tip are pipetted into the centrifuge tube.

[0192] 8) Incubate at room temperature for 10 minutes, then briefly centrifuge and place the tube on a magnetic rack for 2 to 5 minutes until the liquid becomes clear. Use a pipette to carefully pipette the supernatant into a new 1.5 mL centrifuge tube.

[0193] 9) Use a pipette to draw 20 μL of DNA Clean Beads into a new 1.5 mL centrifuge tube and gently pipette at least 10 times to mix thoroughly. Make sure that all the liquid and magnetic beads in the pipette tip are pipetted into the centrifuge tube during the last pipette.

[0194] 10) Keep the centrifuge tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and the tube wall, let it stand for 30 seconds, carefully aspirate and discard the supernatant.

[0195] 11) Repeat the previous step and try to dry the liquid in the tube. If there is a small amount of liquid left on the tube wall, centrifuge the tube instantly. After separation on the magnetic rack, use a small-range pipette to dry the liquid at the bottom of the tube.

[0196] 12) Keep the centrifuge tube fixed on the magnetic rack, open the cap of the centrifuge tube, and dry it at room temperature until the surface of the magnetic beads is non-reflective.

[0197] 13) Remove the centrifuge tube from the magnetic stand, add 32 μL TE Buffer to elute the DNA, and gently pipette at least 10 times to mix thoroughly.

[0198] 14) Incubate at room temperature for 5 minutes, then centrifuge briefly, place the centrifuge tube on a magnetic rack, let stand for 2-5 minutes until the liquid becomes clear, transfer 30 μL of the supernatant to a new 0.2 mL PCR tube to obtain fragmented cDNA.

[0199] 2. End repair

[0200] 1) Perform a subsequent end repair reaction on the fragmented cDNA obtained in 1 above using reagents in the MGIEsay Whole Genome Methylation Library Preparation Kit (MGI, 1000005251).

[0201] Prepare the end repair reaction solution on ice according to the recipe in Table 9 below, based on the number of reactions required.

[0202] Table 9 is the end repair reaction solution

[0203] Components Single reaction volume ER Buffer Mix 7.3μL ER Enzyme Mix 2.7μL Total volume 10μL

[0204] 2) Use a pipette to draw 10 μL of the prepared end repair reaction solution and add it to the PCR tube containing the fragmented cDNA obtained in 1 above. Vortex and shake three times for 3 seconds each time, and centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0205] 3) Place the PCR tube on a PCR instrument and perform the reaction according to the conditions in Table 10 below.

[0206] Table 10 shows the end repair reaction conditions (reaction system 40 μL)

[0207] temperature time 65℃ hot cover On 25℃ 30min 4℃ Hold

[0208] 4) After the reaction is completed, centrifuge instantly to collect the reaction solution to the bottom of the tube.

[0209] 5) Use a pipette to draw 6 μL of ER Stop Buffer into a 0.2 mL PCR tube, vortex 3 times for 3 seconds each time, centrifuge briefly to collect the reaction solution at the bottom of the tube, and let it stand for 2 minutes.

[0210] 6) Place the above 0.2 mL PCR tube in a PCR instrument preheated to 75° C. for 20 minutes to terminate the reaction.

[0211] 7) After the reaction is completed, centrifuge instantly to collect the reaction solution to the bottom of the tube to obtain the end-repaired product.

[0212] 3. Terminal repair AT

[0213] 1) Prepare the end repair AT reaction solution shown in Table 11 on ice.

[0214] Table 11 is the end repair AT reaction solution

[0215]

[0216]

[0217] 2) Use a pipette to draw 4 μL of the prepared end-repair reaction solution and add it to the PCR tube containing the end-repair product in 2 above. Vortex 3 times for 3 seconds each time, and centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0218] 3) Place the PCR tube on a PCR instrument and perform the reaction according to the conditions in Table 12 below.

[0219] Table 12 shows the AT reaction conditions (reaction system 50 μL)

[0220] temperature time 65℃ hot cover On 25℃ 30min 4℃ Hold

[0221] 4) After the reaction is completed, centrifuge instantly to collect the reaction solution to the bottom of the tube to obtain the end-repaired AT product.

[0222] 4. Add connector

[0223] 1) Add 5 μL of the corresponding methylated DNA Adapter (MGIEsay Whole Genome Methylation Library Preparation Kit (MGI, 1000005251)) to the PCR tube containing the end-repaired AT product obtained in 3 above, vortex for 3 times, each time for 3 seconds, and centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0224] 2) Prepare the linker ligation reaction solution on ice according to the formula in Table 13 below, based on the number of reactions required.

[0225] Table 13 is the linker connection reaction solution

[0226]

[0227] 3) Use a pipette to slowly draw 25 μL of the prepared adapter ligation reaction solution into the PCR tube in 1) above, vortex for 6 times, 3 seconds each time, and centrifuge briefly to collect the reaction solution at the bottom of the tube.

[0228] 4) Place the above PCR tube on a PCR instrument and perform the reaction according to the conditions in Table 14 below.

[0229] Table 14 shows the reaction conditions for the linker connection (reaction system 80 μL)

[0230] temperature time 25℃ hot cover On 23℃ 30min 4℃ Hold

[0231] 5) After the reaction is completed, centrifuge the reaction solution to the bottom of the tube and transfer all of it to a new 1.5 mL centrifuge tube.

[0232] 6) Take out the DNA Clean Beads in advance, place them at room temperature for at least 30 minutes, and shake them thoroughly before use. Pipette 40μL of DNA Clean Beads into a new 1.5mL centrifuge tube from the previous step, and gently pipette at least 10 times until all the magnetic beads are suspended. The last time, make sure that all the liquid and magnetic beads in the pipette tip are pipetted into the centrifuge tube.

[0233] 7) Incubate at room temperature for 10 min.

[0234] 8) Centrifuge the centrifuge tube briefly, place it on a magnetic rack, and let it stand for 2 to 5 minutes until the liquid becomes clear. Use a pipette to carefully aspirate the supernatant and discard it.

[0235] 9) Keep the centrifuge tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and the tube wall. After standing for 30 seconds, carefully aspirate the supernatant and discard it.

[0236] 10) Repeat the previous step and try to drain the liquid in the tube. If there is a small amount of liquid left on the tube wall, centrifuge the tube instantly. After separation on the magnetic rack, use a small-range pipette to drain the liquid at the bottom of the tube.

[0237] 11) Keep the centrifuge tube on the magnetic rack, open the tube cover, and dry it at room temperature until the surface of the magnetic beads is non-reflective.

[0238] 12) Remove the centrifuge tube from the magnetic stand, add 22 μL TE Buffer to elute the DNA, and gently pipette at least 10 times until all the magnetic beads are suspended.

[0239] 13) Incubate at room temperature for 10 min.

[0240] 14) Centrifuge the centrifuge tube instantaneously, place it on a magnetic rack, and let it stand for 2 to 5 minutes until the liquid becomes clear. Use a pipette to transfer 20 μL of the supernatant to a new 1.5 mL centrifuge tube to obtain the linker-added product.

[0241] 5. PCR amplification

[0242] 1) Prepare PCR reaction solution on ice.

[0243] Table 15 is the PCR reaction solution

[0244]

[0245] PCR Primer Mix(primer1: / 5Phos / GAACGACATGGCTACGATCCGAC-3'

[0246] Primer2: TGTGAGCCAAGGAGTTG)

[0247] 2) Use a pipette to draw 30 μL of the prepared PCR reaction solution and add it to the 0.2 mL PCR tube containing the adapter product in step 4. Vortex 3 times for 3 seconds each time, and centrifuge briefly to collect the reaction solution at the bottom of the tube.

[0248] 3) Use a pipette to draw 30 μL of the prepared PCR reaction solution into the PCR tube, vortex 3 times for 3 seconds each time, and centrifuge briefly to collect the reaction solution at the bottom of the tube.

[0249] 4) Place the PCR tube on a PCR instrument and perform PCR reaction according to the conditions in Table 16 below.

[0250] Table 16 shows the PCR reaction

[0251]

[0252] 5) After the reaction is completed, centrifuge briefly to collect the reaction solution to the bottom of the tube, add 50 μL TE Buffer to a total system of 100 μL, and transfer all to a new 1.5 mL centrifuge tube.

[0253] 6) Pipette 60 μL DNA Clean Beads into a 1.5 mL centrifuge tube and gently pipette at least 10 times until all the magnetic beads are suspended. The last time, make sure that all the liquid and magnetic beads in the pipette tip are pipetted into the centrifuge tube.

[0254] 7) Incubate at room temperature for 5 minutes, then briefly centrifuge and place the tube on a magnetic rack. Let stand for 2 to 5 minutes until the liquid becomes clear. Use a pipette to carefully aspirate the supernatant and discard it.

[0255] 8) Keep the centrifuge tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and the tube wall. After standing for 30 seconds, carefully aspirate the supernatant and discard it.

[0256] 9) Repeat the previous step and try to dry the liquid in the tube. If there is a small amount of liquid left on the tube wall, centrifuge the tube instantly. After separation on the magnetic rack, use a small-range pipette to dry the liquid at the bottom of the tube.

[0257] 10) Keep the centrifuge tube on the magnetic rack, open the tube cover, and dry it at room temperature until the surface of the magnetic beads is non-reflective.

[0258] 11) Remove the centrifuge tube from the magnetic stand, add 32 μL TE Buffer to elute the DNA, and gently pipette at least 10 times to mix thoroughly.

[0259] 12) Incubate at room temperature for 5 min.

[0260] 13) Centrifuge the centrifuge tube instantaneously, place it on a magnetic rack, and let it stand for 2 to 5 minutes until the liquid becomes clear. Use a pipette to transfer 30 μL of the supernatant to a new 1.5 mL centrifuge tube.

[0261] 14) Use The PCR product was quantified using the dsDNA HS Assay Kit, and 360 ng of the PCR product was transferred to a new 0.2 mL PCR tube, which was supplemented with TE Buffer to a total volume of 48 μL to obtain the PCR product.

[0262] 6. Single-chain cyclization

[0263] 1) Place the PCR tube containing the PCR product obtained in step 5 above on a PCR instrument and react according to the conditions in Table 17 below to denature the double-stranded DNA into a single strand.

[0264] Table 17 is the conditions for denaturation of double-stranded DNA into single-stranded DNA

[0265] temperature time 105℃ hot cover On 95℃ 3min

[0266] 2) After the reaction is completed, immediately place the PCR tube on ice and let it stand for 2 minutes.

[0267] According to the number of reactions, prepare the single-stranded circularization reaction solution on ice according to the recipe in Table 18 below.

[0268] Table 18 is the single-chain cyclization reaction solution

[0269] Components Single reaction volume Splint Buffer 11.6μL DNA Rapid Ligase 0.5μL Total volume 12.1μL

[0270] 3) Use a pipette to draw 12.1 μL of the prepared single-stranded circularization reaction solution and add it to the PCR tube in 2). Vortex for 3 times, each time for 3 seconds, and centrifuge briefly to collect the reaction solution at the bottom of the tube.

[0271] 4) Place the PCR tube on a PCR instrument and perform the reaction according to the conditions in Table 19 below.

[0272] Table 19 shows the PCR reaction conditions

[0273] temperature time 75℃ hot cover On 37℃ 30min 4℃ Hold

[0274] 5) After the reaction is completed, centrifuge the PCR tube instantly and place it on ice before proceeding to the next step of the reaction.

[0275] 7. Enzyme Digestion

[0276] 1) Prepare the enzyme digestion reaction solution on ice in advance according to the recipe in Table 20 below.

[0277] Table 20 is the enzyme digestion reaction solution

[0278] Components Single reaction volume Digestion Buffer 1.4μL Digestion Enzyme 2.6μL Total volume 4μL

[0279] 2) Use a pipette to draw 4 μL of the prepared enzyme digestion reaction solution and add it to the PCR tube obtained in step 6 above. Vortex and shake three times for 3 seconds each time, and centrifuge briefly to collect the reaction solution at the bottom of the tube.

[0280] 3) Place the PCR tube on a PCR instrument and perform the reaction according to the conditions in Table 21 below.

[0281] Table 21 shows the restriction enzyme digestion conditions

[0282] temperature time 75℃ hot cover On 37℃ 30min 4℃ Hold

[0283] 4) After the reaction is completed, centrifuge instantly to collect the reaction solution to the bottom of the tube.

[0284] 5) Immediately add 7.5 μL Digestion Stop Buffer to the PCR tube, vortex for 3 times, 3 seconds each time, centrifuge briefly to collect the reaction solution to the bottom of the tube, and transfer all the reaction solution to a new 1.5 mL centrifuge tube.

[0285] 6) Take out the DNA Clean Beads in advance, place them at room temperature for at least 30 minutes, and shake them thoroughly before use. Pipette 170 μL of DNA Clean Beads into the digested product, and gently pipette at least 10 times until all the magnetic beads are suspended. The last time, make sure that all the liquid and magnetic beads in the pipette tip are pipetted into the centrifuge tube.

[0286] 7) Incubate at room temperature for 10 min.

[0287] 8) Centrifuge the centrifuge tube briefly, place it on a magnetic rack, and let it stand for 2 to 5 minutes until the liquid becomes clear. Use a pipette to carefully aspirate the supernatant and discard it.

[0288] 9) Keep the centrifuge tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads and the tube wall. After standing for 30 seconds, carefully aspirate the supernatant and discard it.

[0289] 10) Repeat the previous step and try to drain the liquid in the tube. If there is a small amount of liquid left on the tube wall, centrifuge the tube instantly. After separation on the magnetic rack, use a small-range pipette to drain the liquid at the bottom of the tube.

[0290] 11) Keep the centrifuge tube on the magnetic rack, open the tube cover, and dry it at room temperature until the surface of the magnetic beads is non-reflective.

[0291] 12) Remove the centrifuge tube from the magnetic stand, add 22 μL TE Buffer to elute the DNA, and gently pipette at least 10 times until all the magnetic beads are suspended.

[0292] 13) Incubate at room temperature for 10 min.

[0293] 14) Centrifuge the centrifuge tube instantaneously, place it on a magnetic rack, and let it stand for 2 to 5 minutes until the liquid becomes clear. Use a pipette to transfer 20 μL of the supernatant to a new 1.5 mL centrifuge tube.

[0294] 15) Use ssDNA Assay Kit fluorescent quantitative kit, according to the operating instructions of the quantitative kit to quantify the product after enzyme digestion and purification.

[0295] Obtain a sequencing library.

[0296] 6. Sequencing

[0297] Sequencing was performed using the MGISEQ-2000 sequencer, and DNB production and sequencing were performed using the MGISEQ-2000 High-Throughput Sequencing Reagent Set (PE100) (MGI, catalog number 1000012536) according to the instructions.

[0298] VII. Analysis of Sequencing Results

[0299] After the sequencing is completed, the sequencing data is filtered and aligned, and the reads with the same combination are continuously assembled using the T base combination molecular labels in the reads that cannot be aligned with the reference genome. Finally, the full-length transcriptome is assembled, and then reads1 with cellbarcode and UMI are selected to determine the cells from which the assembled full-length transcriptome comes and its expression level, thereby achieving high-throughput single-cell full-length transcriptome sequencing.

[0300] 1. Database construction results

[0301] use The dsDNA HS Assay Kit was used to detect the cDNA yield (the result of the cDNA pre-amplification product in step 4);

[0302] use dsDNA HS Assay Kit reagent to detect PCR library yield (the result of step 5);

[0303] use ssDNA HS Assay Kit reagent detects the yield of single-stranded circular DNA library (the result of step 5, step 7, is the result of the single-stranded circular DNA library after single-strand circularization digestion);

[0304] use Use the ssDNA HS Assay Kit to detect DNB concentration (the concentration can be measured using a reagent for measuring single-stranded DNA concentration, the result of step six).

[0305] The results are shown in Table 22, which shows that the database was successfully built.

[0306] Table 22 shows the results of database construction

[0307]

[0308] 2. Analysis results

[0309] After filtering the sequencing data and comparing it with the reference sequence (mm10, GCA_000001635.2, 2011.12), the transcript expression was analyzed and the full-length transcripts were assembled. Sufficient transcripts were detected in each cell. In addition to accurately quantifying each transcript, most of the transcripts with higher expression levels were fully assembled, achieving high-throughput single-cell full-length transcriptome sequencing (as shown in Table 23).

[0310] Table 23 shows the results of single-cell full-length transcriptome sequencing

[0311] SEQUENCE LISTING <110> Shenzhen MGI Technology Co., Ltd. <120> A single-cell full-length transcript library construction and sequencing method <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 16 <212> DNA <213> Artificial sequence <400> 1 ttgtcttcct aaggaa 16 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <400> 2 cgacatggct acgattctgc g 21

Claims

1. A single-cell full-length transcript library construction and sequencing method, comprising the following steps: A) Dual labeling and C conversion of mRNA from a single cell to obtain dual labeled cDNA; The double labeling includes single cell labeling and U combination labeling; The single cell labeling is to capture the mRNA using a PolyT oligo primer with a single cell labeling sequence; The U combination labeling is to perform reverse transcription and template switching reaction on the mRNA under the action of template switching TSO primer and reverse transcriptase, and to add methylated C or hydroxymethylated C during the reaction to achieve re-labeling, so as to form cDNA with methylated C and unmethylated C combination labeling; The C conversion is to convert the methylated C in the cDNA carrying the single cell marker sequence and the combined markers of methylated C and unmethylated C into U, so as to obtain cDNA with combined markers of U bases and unmethylated C at different positions, which is recorded as double-labeled cDNA; Or the C conversion is to convert the unmethylated C in the cDNA carrying the single cell marker sequence and the combined labeling of methylated C and unmethylated C into U, so as to obtain cDNA with combined labeling of U bases and methylated C at different positions, which is recorded as double-labeled cDNA; B) pre-amplifying, shearing, and library construction of the double-labeled cDNA to obtain a single-cell full-length transcript library; C) sequencing the single-cell full-length transcript library to achieve single-cell full-length transcript library construction and sequencing.

2. The method according to claim 1, characterized in that: Step A is implemented as follows: 1) Lysing single cell mRNA, and then using the PolyT oligo primer to capture the mRNA to obtain mRNA bound by the PolyT oligo primer; 2) subjecting the mRNA with the single cell marker to reverse transcription and template switching reaction under the action of the template switching TSO primer and reverse transcriptase, and adding methylated C or hydroxymethylated C during the reaction to achieve re-labeling, thereby obtaining cDNA with the single cell marker sequence and a combination of methylated C and unmethylated C markers; 3) converting the methylated C in the cDNA carrying the single cell marker sequence and the combination of methylated C and unmethylated C markers into U, to obtain cDNAs with combination markers of U bases and unmethylated C at different positions, which are recorded as double-labeled cDNAs; Alternatively, the unmethylated C in the cDNA carrying the single cell marker sequence and the combined markers of methylated C and unmethylated C is converted to U to obtain cDNAs with combined markers of U bases and methylated C at different positions, which are recorded as double-labeled cDNAs.

3. The method according to claim 1, characterized in that: The step A is implemented as follows: 1) Lysing the mRNA of a single cell as a template, performing reverse transcription and template switching reaction under the action of the PolyT oligo primer and the template switching TSO primer, and adding methylated C or hydroxymethylated C in the reverse transcription and template switching reaction to obtain cDNA with a single cell marker sequence and a combined marker of methylated C and unmethylated C; 2) converting the methylated C in the cDNA carrying the single cell marker sequence and the combination of methylated C and unmethylated C markers into U, to obtain cDNAs with combination markers of U bases and unmethylated C at different positions, recorded as double-labeled cDNA; Alternatively, the unmethylated C in the cDNA carrying the single cell marker sequence and the combined markers of methylated C and unmethylated C is converted to U to obtain cDNAs with combined markers of U bases and methylated C at different positions, which are recorded as double-labeled cDNAs.

4. The method according to claim 2 or 3, characterized in that: The oligo primer of PolyT includes a universal primer sequence, a linker sequence, a cell marker sequence, a UMI, PolyT and NV nucleotides; The N in the NV nucleotide is any one of the four bases A / T / C / G, and the V is any one of the three bases A / C / G; The template switching TSO primer includes the universal primer sequence and three consecutive rGs.

5. A method for constructing a single cell full-length transcript library, comprising steps A) to B) of any one of claims 1 to 4.

6. Application of the method according to any one of claims 1 to 5 in single cell full-length transcript library construction and sequencing; Or the use of the method according to any one of claims 1 to 5 in library construction and sequencing of spatially transcribed full-length transcripts.

Images