An epigenetic marker for screening and / or detecting sperm motility of bulls and its application

Abstract

The present invention belongs to the technical field of epigenetic markers associated with bull sperm motility, and specifically relates to an epigenetic marker for screening and / or detecting high and low sperm motility in bulls and its application. The present invention focuses on the differences in DNA methylation in the sperm genomes of full-sib Holstein bulls with high and low sperm motility and their functions. Simplified methylation sequencing and transcriptome sequencing were performed on the genomic DNA and total RNA of the sperm, respectively, to explore the molecular mechanism by which DNA methylation plays a role in bull sperm motility. It was determined that high methylation levels in the exon 29 region of the PBRM1 gene are associated with high sperm motility in bulls. It was further determined that the methylation levels of the exon 29 region of the PBRM1 gene regulate gene expression and function by altering alternative splicing patterns, laying the foundation for screening bulls with high sperm motility and for genetic breeding of dairy cows, and therefore has excellent practical application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of epigenetic markers related to bull sperm motility, and particularly relates to an epigenetic marker for screening and / or detecting the motility of bull sperm and an application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Semen quality is a crucial factor in assessing bull fertility. Common parameters used to assess semen quality include semen volume per ejaculation, sperm concentration, sperm motility, post-thaw cryopreservation sperm motility, and sperm deformity rate. Sperm motility is the primary indicator used to evaluate bull semen quality and determine whether semen is suitable for freezing, impacting bull semen yield and economic returns. Sperm motility is influenced by numerous factors, including genetic and epigenetic influences. Therefore, individual differences in semen quality must be accurately identified.

[0004] Although bull semen quality can be assessed using phenotypic and functional parameters, accurately predicting bull fertility remains a significant challenge. Recently, increasing attention has focused on identifying potential reproductive markers and the molecular mechanisms underlying their regulation. One potential mechanism is DNA methylation, which may explain phenotypic differences among full-sib bulls. In bull breeding programs, many full-sib Holstein bulls are derived through superovulation and embryo transfer. Despite their genomic similarity, full-sib bulls often exhibit distinct semen quality phenotypes. Epigenetic regulation may play an irreplaceable role in semen quality. DNA methylation is a stable epigenetic modification of the genome that regulates gene expression and plays a role in cell reprogramming, tissue differentiation, and disease. When evaluating complex traits, twin experimental designs are crucial for studying environmentally induced epigenetic effects. Of course, full-sib individuals cannot completely exclude the influence of genetic components, as they may have different gene combinations. Nevertheless, full-sib Holstein bulls are an ideal model for studying the relationship between DNA methylation and semen quality.

[0005] High-throughput genomic analyses, such as reduced genome methylation sequencing (RRBS), methylated DNA immunoprecipitation sequencing (MeDIP-seq), or whole-genome bisulfite sequencing (WGBS), allow for the investigation of sperm DNA methylation from a genome-wide perspective. The relationship between DNA methylation patterns and sperm quality, including motility, morphology, and DNA fragmentation, has been investigated in human and bovine sperm. Abnormalities in sperm DNA methylation are closely associated with semen quality (sperm morphology, motility) and fertility in bulls. Several studies have revealed hypomethylation patterns in the sperm genome of bulls. Furthermore, recent studies have shown that sperm DNA methylation in bulls is closely associated with sperm motility. However, functional evidence for the mechanisms by which DNA methylation influences spermatogenesis and sperm motility has not yet been found. Summary of the Invention

[0006] In view of the deficiencies of the above-mentioned prior art, the inventors, after long-term technical and practical exploration, provide an epigenetic marker for screening and / or detecting the high or low sperm motility of bulls and its application. The present invention focuses on the differences in DNA methylation in the sperm genome of full-sib Holstein bulls with high and low sperm motility and their functions, and carries out simplified methylation sequencing (RRBS) and transcriptome sequencing (RNA-seq) on the genomic DNA and total RNA of the sperm, respectively, to explore the molecular mechanism by which DNA methylation plays a role in bull sperm motility. It was determined that the high methylation level in the 29th exon region of the PBRM1 gene is associated with high sperm motility in bulls. It was further determined that the methylation level of the 29th exon of the PBRM1 gene regulates the expression and function of the gene by changing the alternative splicing pattern. Based on the above research results, the present invention was completed.

[0007] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0008] The first aspect of the present invention provides the use of the PBRM1 gene as an epigenetic marker for screening and / or detecting sperm motility of bulls.

[0009] Wherein, the PBRM1 gene includes the 29th exon of the PBRM1 gene.

[0010] The second aspect of the present invention provides the use of a substance for detecting the above-mentioned epigenetic markers in the preparation of a product for screening and / or detecting the motility of sperm in bull breeders.

[0011] A third aspect of the present invention provides a product for screening and / or detecting sperm motility in bull breeders, wherein the product comprises a substance for detecting epigenetic markers.

[0012] A fourth aspect of the present invention provides a system for screening and / or detecting sperm motility in bull breeders, the system comprising at least:

[0013] An acquisition module is configured to: acquire the methylation level of the epigenetic marker in the test bull sample;

[0014] an evaluation module configured to: determine the sperm motility level of the tested bull according to the methylation level of the marker obtained by the acquisition module;

[0015] An output module is configured to output an evaluation result according to the evaluation module.

[0016] Wherein, in the acquisition module, the test bull sample is a sperm sample of the test bull.

[0017] The specific evaluation process of the evaluation module includes: when the methylation rate of the marker is higher than 35%, it is determined to be high-motility sperm; when the methylation rate of the marker is lower than 13%, it is determined to be low-motility sperm.

[0018] A fifth aspect of the present invention provides applications of the above-mentioned applications, products, and systems in any one or more of the following:

[0019] (a) Select bulls with high sperm motility;

[0020] (b) Dairy cattle breeding.

[0021] A sixth aspect of the present invention provides a method for screening bulls with high sperm motility, the method comprising using the above-mentioned product or system to judge the sperm motility of the bulls, thereby screening bulls with high sperm motility.

[0022] A seventh aspect of the present invention provides a method for breeding dairy cows, comprising selecting bulls with high sperm motility for genetic breeding using the method described in the sixth aspect.

[0023] Compared with the existing technical solutions, the above one or more technical solutions have the following beneficial effects:

[0024] 1. The above technical solution screens differentially methylated regions and genes at the genomic level by performing RRBS sequencing on sperm genomic DNA of full-sib Holstein bulls with high and low sperm motility. BSP verification shows that the high methylation level of exon 29 of the PBRM1 gene is associated with bull sperm motility, and that methylation in this region can affect gene expression by regulating the alternative splicing pattern of the gene, providing a reliable basis for screening epigenetic markers for bulls with high and low sperm motility.

[0025] 2. The detection method provided by the above technical solution is reasonably designed and can screen out DNA methylation molecular markers that affect the variable splicing pattern of genes in bull sperm. It also reveals the molecular mechanism by which DNA methylation in the exon region of genes plays a regulatory role in bull sperm motility, and therefore has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0027] Figure 1 : Heat map analysis of differential DNA methylation genes in sperm of bulls with high and low sperm motility in Example 1 of the present invention.

[0028] Figure 2 : Detection of DNA methylation level of exon 29 of PRBM1 gene in bull sperm with high and low sperm motility in Example 1 of the present invention.

[0029] Figure 3 : Schematic diagram of the variable splicing of exon 29 of the bull testis PRBM1 gene in Example 2 of the present invention.

[0030] Figure 4 : In Example 2 of the present invention, RT-PCR was used to detect the expression of the alternative splicing transcript of exon 29 of the PRBM1 gene in bull testis.

[0031] Figure 5 : In Example 2 of the present invention, qRT-PCR was used to detect the expression of PBRM1 transcripts in bull testis.

[0032] Figure 6 : Detection of PBRM1 protein isoforms in bull testicles and sperm in Example 2 of the present invention. DETAILED DESCRIPTION

[0033] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0034] It should be noted that the terms used herein are intended only to describe specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof. In addition, the molecular biology methods not described in detail in the examples are all conventional methods in the art. For specific operations, please refer to the molecular biology guide or product manual. In the present invention, bull sperm motility refers to the motility of fresh bull semen.

[0035] As previously mentioned, sperm motility is a key indicator for evaluating bull semen quality and determining whether it can be frozen, impacting bull semen yield and economic returns. Prior research indicates that DNA methylation plays a regulatory role in bull spermatogenesis. This study, using RRBS and BSP methods, identified significant differences in methylation levels within the exon 29 region of PBRM1 between high- and low-motility bull sperm, suggesting that PBRM1 could be used as an epigenetic marker for detecting bull sperm motility.

[0036] In view of this, a typical embodiment of the present invention provides the use of the PBRM1 gene as an epigenetic marker for screening and / or detecting sperm motility of bulls.

[0037] In another specific embodiment of the present invention, the PBRM1 gene includes exon 29 of the PBRM1 gene.

[0038] The present invention uses RRBS technology to detect differences in DNA methylation in the sperm genome of full-sib Holstein bulls with high and low sperm motility, screening for differentially methylated regions and genes associated with bull sperm motility. The DNA methylation level of exon 29 of the key gene PBRM1 was verified by bisulfite sequencing (BSP), confirming that high methylation levels in the exon 29 region of the PBRM1 gene were associated with high sperm motility in bulls. It was further determined that the methylation level of exon 29 of the PBRM1 gene regulates gene expression and function by altering the alternative splicing pattern. This provides a more detailed mechanism study and reliable basis for the application of the PBRM1 gene as an epigenetic marker for screening bull sperm motility.

[0039] In another embodiment of the present invention, there is provided the use of a substance for detecting the above-mentioned epigenetic markers in the preparation of a product for screening and / or detecting sperm motility of bull breeders.

[0040] The substance for detecting the above-mentioned epigenetic marker is specifically a substance for detecting the methylation level of the above-mentioned epigenetic marker; more specifically, the substance includes but is not limited to substances used in sequencing after bisulfite treatment, clone sequencing method or real-time fluorescence quantitative PCR method;

[0041] The products include but are not limited to primers, probes, gene chips, nucleic acid preparations, kits, and related devices and equipment for detecting the methylation expression level of the marker.

[0042] The PBRM1 methylation level is the DNA methylation level in the exon 29 region of the PBRM1 gene.

[0043] In another specific embodiment of the present invention, the methylation site is chr22:48830591bp-48830747bp.

[0044] In another embodiment of the present invention, a product for screening and / or detecting sperm motility of bull breeders is provided, wherein the product comprises a substance for detecting epigenetic markers.

[0045] In a specific embodiment of the present invention, the substance is a substance for detecting the methylation level of the exon 29 region of the PBRM1 gene;

[0046] In a specific embodiment of the present invention, the product includes but is not limited to primers, probes, gene chips, nucleic acid preparations, kits, and related devices and equipment for detecting the methylation expression level of the marker.

[0047] In another embodiment of the present invention, a system for screening and / or detecting sperm motility of bulls is provided, the system comprising at least:

[0048] An acquisition module is configured to: acquire the methylation level of the epigenetic marker in the test bull sample;

[0049] an evaluation module configured to: determine the sperm motility level of the tested bull according to the methylation level of the marker obtained by the acquisition module;

[0050] An output module is configured to output an evaluation result according to the evaluation module.

[0051] Wherein, in the acquisition module, the test bull sample is a sperm sample of the test bull.

[0052] The specific evaluation process of the evaluation module includes: when the methylation rate of the marker is higher than 35%, it is determined to be high-motility sperm; when the methylation rate of the marker is lower than 13%, it is determined to be low-motility sperm.

[0053] In another embodiment of the present invention, the application of the above-mentioned application, product, or system in any one or more of the following is provided:

[0054] (a) Select bulls with high sperm motility;

[0055] (b) Dairy cattle breeding.

[0056] In another specific embodiment of the present invention, a method for screening bulls with high sperm motility is provided, wherein the method comprises using the above-mentioned product or system to determine the sperm motility of the bulls, thereby screening bulls with high sperm motility.

[0057] In another specific embodiment of the present invention, a method for breeding dairy cows is provided, the method comprising screening bulls with high sperm motility by the above method for genetic breeding.

[0058] The present invention is further described below with reference to specific examples. The following examples are intended only to illustrate the present invention and are not intended to limit its contents. If the specific experimental conditions are not specified in the examples, conventional conditions or conditions recommended by the sales company are generally followed; unless otherwise specified in the present invention, all can be purchased through commercial channels.

[0059] Example 1: Screening of key methylated genes in spermatozoa of full-sib bulls with high and low sperm motility 1. Collection and processing of semen samples from full-sib Holstein bulls

[0060] Using bull material from the Shandong Aokes Bull Station, three pairs of full-sib Holstein adult bulls with high and low sperm motility were selected based on semen collection records from the past two years. The three bulls with an average fresh semen motility >68% were defined as the high-motility group (H group, H1, H2, and H3), while the three bulls with an average fresh semen motility <58% were defined as the low-motility group (L group, L1, L2, and L3). Fresh semen was collected from the bulls, washed with PBS, and divided into two parts: one for sperm genomic DNA extraction for simplified methylation sequencing and BSP experiments, and the other for sperm total RNA extraction for transcriptome sequencing. Sperm DNA was extracted using the high-salt method, and sperm total RNA was extracted using Trizol.

[0061] 2. Identification of differentially methylated regions in sperm DNA from full-sib Holstein bulls with high and low sperm motility

[0062] Bull sperm genomic DNA was extracted using a high-salt method. Sperm genomic DNA was digested separately with the restriction endonuclease MspI, which specifically recognizes and cleaves C|CGG sequences and is insensitive to methylation modifications. Overhangs of varying sizes were blunt-ended using T4 DNA polymerase and Klenow enzyme. 300-400 bp DNA fragments were screened and purified using magnetic beads. A single base was added to the blunt end of the sequence. DNA fragments with sticky ends were ligated to methylated linker sequences using a paired-end DNA sample preparation kit and purified. Therefore, 40-220 bp enzyme fragments were recovered by gel electrophoresis and treated with bisulfite, converting unmethylated Cs to Ts while preserving methylated Cs. The fragments were quantified by real-time PCR and sequenced on an Illumina HiSeq4000 sequencer. Reads were converted using Bismark software. The available sequencing data were aligned to the bovine reference genome (Bos_TaurusUMD3.1) using the Bowtie program in the BSgenome software package to map the distribution of DNA methylation across bovine chromosomes. Differentially methylated regions (DMRs) between the H and L groups were analyzed using the Methylkit software package and Edmr software. GO and KEGG enrichment pathways were also performed on the differentially methylated genes to identify differentially methylated genes associated with sperm motility.

[0063] The DNA methylation profiles of sperm from full-sib bulls with high and low sperm motility were compared, and 2,308 DMRs were identified (P < 0.05, |log2(FC)| ≥ 1). Of these, 948 DMRs were located in gene regions, termed gDMRs, of which 471 gDMRs were upregulated and 477 gDMRs were downregulated. Approximately 28% of gDMRs were located in gene promoter regions, 41% were located in gene exon regions, and approximately 31% were located in gene intron regions. The heat map based on gDMRs showed that the DNA methylation patterns of the three individuals in the same group were similar, showing good repeatability, and the overall gene methylation pattern of the H group was significantly different from that of the L group ( Figure 1 GO enrichment analysis showed that gDMR-related genes (DMGs) were involved in multiple molecular functions, including RNA transcription (GO:0006351), cell adhesion (GO:0007155), cell differentiation (GO:000154), and calmodulin binding (GO:0005516). KEGG pathway analysis revealed that differentially methylated genes were enriched in focal adhesion, MAPK, and calcium signaling pathways.

[0064] 4. RNA-seq Sequencing Analysis

[0065] A cDNA library was constructed from sperm samples of full-sib Holstein bulls and sequenced using the Illumina HiSeq 2500 platform. FastQC software was used to process and filter the data to obtain valid data, which were then aligned to the bull genome using Tophat2 software. Cufflinks software was used to analyze the resulting alignment data for differentially expressed genes, identifying genes differentially expressed between high and low sperm motility groups. Potential functions of the assembled differentially expressed genes were predicted and annotated using the GO and KEGG protein databases. Transcriptome sequencing data were then analyzed to compare gene expression in sperm from bulls with high and low sperm motility, identifying 442 differentially expressed genes.

[0066] ASprofile software was used to classify and analyze expression levels of alternative splicing (AS) events using known gene models and Cufflinks-predicted gene models. AS events were compared in the sperm transcriptomes of bulls in groups H and L, yielding a total of 1,876 AS events.

[0067] Joint analysis of gDMRs and AS-timed gene regions revealed that 89% of gDMRs harbored AS events, including genes related to spermatogenesis and sperm motility, such as SMAD2, KIF17, RAB22A, CCDN1, and PBRM1. This suggests that sperm motility-related gDMRs may be associated with gene alternative splicing.

[0068] Example 2 Detection of DNA methylation molecular markers affecting the alternative splicing pattern of the key gene PBRM1 1. Detection of DNA methylation level in exon 29 of the PBRM1 gene

[0069] PBRM1, encoding the PBRM1 protein, is a subunit of the ATP-dependent chromatin remodeling complex and is required for maintaining the stability of the SWI / SNF chromatin remodeling complex, which is involved in mouse spermatogenesis. Therefore, PBRM1 may play an important role in bovine spermatogenesis, but its mechanism of action has not been reported.

[0070] In this study, RRBS revealed a differentially methylated region (DMR) in exon 29 of the bovine PBRM1 gene (NM_001305012.1, chr22:488300591-48830747). This gDMR was highly methylated (74%) in sperm from group H bulls. Based on the DNA sequence of the differentially methylated region in exon 29 of the PBRM1 gene, BSP primers were designed using Methyl PrimerExpress software v1.0:

[0071] PBRM1-BSP-F: TTGTTGTGTTTTTTAAGGTATGATG (SEQ ID NO. 1);

[0072] PBRM1-BSP-R: AAATAAATAAAAATAAAATTCTTACCC (SEQ ID NO. 2).

[0073] The PCR reaction system was as follows: 0.25 μL LA Taq (5 U / μL), 2.5 μL 10× LA Taq Buffer II (Mg 2+ Plus), 4 μL dNTP Mixture (2.5 mM), 1 μL BS-treated genomic DNA, 15.25 μL ddH2O, total volume 20 μL. PCR procedure, step 1: (1) 94°C denaturation for 5 min. (2) 35 thermal cycles, including 98°C denaturation for 10 s, 68°C annealing for 15 s, and 72°C extension for 15 s. (3) 72°C extension for 10 min, stored at 4°C. The PCR product was detected by agarose gel electrophoresis, and the PCR product was purified by gel recovery and purification kit. The PCR fragment was ligated to the pEASY-T3 vector by T4 ligase, transformed into Escherichia coli competent cells (DH5α), plated, cloned, and sequenced. The sequenced sequences were analyzed using BiQ Analyzer software. The results showed that the methylation level in the region of exon 29 in group H (~35%) was higher than that in group L (~14%) (P < 0.05, Figure 2 ), which is consistent with the results obtained by RRBS.

[0074] 2. Identification and expression analysis of alternative splicing of exon 29 of the PBRM1 gene

[0075] The bovine PBRM1 gene contains 32 exons and 31 introns. An exon skipping event near exon 29 of the bovine PBRM1 gene was observed in the NCBI database ( Figure 3 We hypothesized that DNA methylation of exon 29 would affect the alternative splicing of PBRM1.

[0076] In this example, primers PBRM1-AS-F / R were designed based on the bovine PBRM1 gene mRNA sequence (GenBank, NM_001305012.1). The sequence is as follows:

[0077] PBRM1-AS-F: CCGCTACAACGAGAGTGACA (SEQ ID NO.3);

[0078] PBRM1-AS-R:TTGGCTGCTGTATGACAGGG (SEQ ID NO. 4).

[0079] By RT-PCR experiments, three transcripts were identified in bull testes at all stages of sexual maturity, namely, the complete PBRM1 transcript, PBRM1-SV1 (exon 28 deleted), and PBRM1-SV2 (exon 28–29 deleted) ( Figure 4 Based on the sequence characteristics of different transcripts, fluorescent quantitative primers were designed, PBRM1-qcompl-F / R, to detect the expression of the complete PBRM1 transcript. The sequence is as follows:

[0080] PBRM1-qcompl-F: GAAGAGCGGGCAGCTAAAGT (SEQ ID NO.5);

[0081] PBRM1-qcompl-R: ACACCTGGCGGAAGATGGTG (SEQ ID NO. 6).

[0082] PBRM1-SV1-F / R is used to detect the expression of PBRM1-SV1. The sequence is as follows:

[0083] PBRM1-SV1-F: AGAATATGAAGATGATGGGTGGCT (SEQ ID NO. 7);

[0084] PBRM1-SV1-R: GGAGGCCCCAGAACACCTAC (SEQ ID NO. 8).

[0085] PBRM1-SV2 is used to detect the expression of PBRM1-SV2. The sequence is as follows:

[0086] PBRM1-SV2-F: ATATGAAGTGTGATGAACCAAGGA (SEQ ID NO.9);

[0087] PBRM1-SV2-R: CAATGTATTTTAGGTAGGCCTCTG (SEQ ID NO. 10).

[0088] qRT-PCR results showed that PBRM1-SV1 was the major transcript in the testis, and PBRM1-SV2 was expressed at the highest level in adult bovine testis. In all stages of bull testis, the mRNA expression of PBRM1 was significantly increased in the testis of sexually mature bulls compared with that of newborn bulls ( Figure 5 ).

[0089] Western Blot analysis of PBRM1 protein expression in bull testes and sperm using an antibody against PBRM1 (ab196022, Abcam) revealed the presence of two protein isoforms, PBRM1-isoform 1 and PBRM1-isoform 2, in bovine testes and sperm. SMS2 prediction (http: / / www.detaibio.com / sms2 / protein_mw.html) revealed that PBRM1-SV1 and PBRM1-SV2 corresponded to PBRM1-isoform 1 (~194 kDa) and PBRM1-isoform 2 (~185 kDa), respectively. Furthermore, PBRM1-isoform 1 was more expressed in bull testes than PBRM1-isoform 2. However, PBRM1-isoform 2 expression was significantly higher in adult testes than in newborn calves. Both PBRM1-isoform 1 and PBRM1-isoform 2 were present in sperm, but there was no significant difference between the two isoforms. Figure 6 These results indicate that the expression of PBRM1 spliced transcripts may be associated with testicular development and spermatogenesis in bulls, and suggest that hypermethylation of exon 29 of the PBRM1 gene in sperm from bulls with high sperm motility may regulate bull sperm motility by promoting the production of PBRM1-SV2.

[0090] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. Detection PBRM1 Application of substances that measure gene methylation levels in the preparation of products for screening and / or detecting sperm motility in bull breeders; wherein, described PBRM1 The methylation level is PBRM1 DNA methylation level in exon 29 of the gene; PBRM1 The gene is NM_001305012.1; the methylation site is chr22: 48830591bp - 48830747bp; the bull is a Holstein bull; The method for judging the motility of bull sperm is as follows: PBRM1 When the gene methylation level is higher than 35%, it is judged as high-motility sperm; PBRM1 A gene methylation level lower than 13% is considered to be low sperm motility.

2. The use according to claim 1, characterized in that The substances include substances used in bisulfite treatment-based sequencing, clone sequencing, or real-time fluorescence quantitative PCR methods; The product includes primers, probes, gene chips and kits for detecting the methylation expression level of the marker.

3. A system for screening and / or detecting sperm motility of bulls, characterized in that: The system comprises at least: The acquisition module is configured to: obtain PBRM1 Gene methylation levels; an evaluation module configured to: determine the sperm motility level of the tested bull according to the methylation level of the marker obtained by the acquisition module; The method for judging the motility of bull sperm is as follows: PBRM1 When the gene methylation level is higher than 35%, it is judged as high-motility sperm; PBRM1 A gene methylation level lower than 13% was considered as low-motility sperm; an output module, configured to: output an evaluation result according to the evaluation module; Among them, the PBRM1 The methylation level is PBRM1 DNA methylation level in exon 29 of the gene; PBRM1 The reference sequence of the gene is NM_001305012.1; the methylation site is chr22: 48830591bp-48830747bp; and the bull is a Holstein bull.

4. Use of the system according to claim 3 in preparing a product for screening bulls with high sperm motility.

Images