A regulatory fusion protein and its application

Abstract

The present invention discloses a regulatable fusion protein and its application. The fusion protein is PGLYRP2, and the amino acid sequence of PGLYRP2 is as shown in SEQ ID NO: 1; the fusion protein is designed to be expressed in immune cells under regulation. After the regulatable expression of the PGLYRP2 fusion protein is designed to be in immune cells, it expresses a chimeric antigen receptor and can specifically recognize the tumor cell surface antigen targeted; and the regulatable expression of the PGLYRP2 protein in immune cells can enhance the infiltration ability of immune cells and the killing ability against tumors.

Description

Technical Field

[0001] The present invention relates to the technical field of engineered immune cell modification, and particularly to a regulatory fusion protein and its application. Background Art

[0002] A tumour is a neogrowth formed by the hyperplasia of local tissue cells under the action of various tumourigenic factors. Since this neogrowth often appears as a mass-like protrusion occupying space, it is also called a neoplasm. Among them, malignant tumours are prone to metastasis, recurrence after treatment, and are extremely difficult to cure under certain special microenvironments.

[0003] The tumour microenvironment (TME) consists of abnormal tumour blood vessels, extracellular matrix components, endothelial cells, pericytes, tumour-associated fibroblasts, smooth muscle cells, and immune cells. The TME plays a crucial role in the occurrence, growth, and metastasis of tumours. The abnormal tumour vascular system, extracellular matrix components, and abundant stromal cells in the TME affect the distribution and penetration of drugs in tumour tissues. Its immunosuppressive state is also one of the important reasons for the failure of various anti-tumour treatments, including immunotherapy. In recent years, many studies have been devoted to improving the treatment effect by targeting and remodelling the TME.

[0004] Peptidoglycan recognition protein 2 (PGLYRP2) is a receptor sensitive to bacterial peptidoglycan, which is mainly highly expressed in the liver and can also be induced to express in keratinocytes and epithelial cells. PGLYRP2 has N-acetylmuramic acid-L-alanine amidase activity, acts on the linkage between N-acetylmuramic acid and L-alanine residues, and can hydrolyze bacterial PNG, playing a scavenging role. This is also the key mechanism by which the PGLYRP2 protein can play an anti-inflammatory role. At the same time, some studies have pointed out that a basic function of PGLYRP2 in hepatocytes is to inhibit tumour development by stimulating anti-tumour immune responses. PGLYRP2 can bind to the untranslated region of genes to regulate the expression of proteins such as the chemokine CCL5 in cells. The expression of such chemokines in the tumour microenvironment can recruit different immune cells such as NK cells and T cells to infiltrate into the tumour, thereby overcoming the inhibitory effect of the tumour microenvironment.

[0005] Pathogen antigens stimulate T cells by binding to the T cell receptor (TCR), activate the signal transduction cascade, promote T cell proliferation and differentiation, and finally clear the pathogen. After the TCR is activated, tyrosine kinases are phosphorylated, thereby activating downstream signal transduction pathways. In response to activation, T cells reorganize their cytoskeletons, change their metabolism, and gene expression.

[0006] The three main pathways for controlling gene expression (transcription) through TCR are the MAPK (mitogen-activated protein kinase), NF-kB (nuclear factor kappa-B), and calcium pathways. The TCR-dependent MAPK pathway first activates Ras, leading to the activation of downstream Erk and the formation of the dimer activator protein 1 (AP-1). After the AP-1 dimer binds to the AP-1 response element (AP-1-RE), it increases the transcription and expression of genes related to T cell activation. In addition, TCR can transmit signals through the LAT—SPL76 complex, thereby activating PKC0. Similarly, the co-stimulatory factor CD28 can also activate PKC0 by sending signals through PI3K and PDK1. Activated PKC0 causes IKK activation, further leading to the phosphorylation of IxBα, resulting in the ubiquitination and degradation of IkBα, thus enabling the nuclear translocation of NF-KB, which binds to the NF-KB response element (NF-KBRE) and causes gene transcription activation. Nuclear factor of activated T cell (NFAT) is a class of transcription factors related to the calcium signaling pathway. Activated NFAT binds to the NFAT response element (NFAT-RE) and can further regulate the development, activation, and gene expression of lymphocytes. Summary of the Invention

[0007] Based on the above problems, the problem to be solved by the present invention is to provide a regulatory fusion protein and its application.

[0008] The technical solution of the present invention is as follows:

[0009] A regulatory fusion protein of PGLYRP2, which contains the amino acid sequence shown in SEQ ID NO:1.

[0010] The above PGLYRP2 protein includes the amino acid sequence shown in SEQ ID NO:1, specifically as follows:

[0011] MAQGVLWILLGLLLWSDPGTASLPLLMDSVIQALAELEQKVPAAKTRHTASAWLMSAPNSGPHNRLYHFLLGAWSLNATELDPCPLSPELLGLTKEVARHDVREGKEYGVVLAPDGSTVAVEPLLAGLEAGLQGRRVINLPLDSMAAPWETGDTFPDVVAIAPDVRATSSPGLRDGSPDVTTADIGANTPDATKGCPDVQASLPDAKAKSPPTMVDSLLAVTLAGNLGLTFLRGSQTQSHPDLGTEGCWDQLSAPRTFTLLDPKASLLTMAFLNGALDGVILGDYLSRTPEPRPSLSHLLSQYYGAGVARDPGFRSNFRRQNGAALTSASILAQQVWGTLVLLQRLEPVHLQLQCMSQEQLAQVAANATKEFTEAFLGCPAIHPRCRWGAAPYRGRPKLLQLPLGFLYVHHTYVPAPPCTDFTRCAANMRSMQRYHQDTQGWGDIGYSFVVGSDGYVYEGRGWHWVGAHTLGHNSRGFGVAIVGNYTAALPTEAALRTVRDTLPSCAVRAGLLRPDYALLGHRQLVRTDCPGDALFDLLRTWPHFTATVKPRPARSVSKRSRREPPPRTLPATDLQHHHHHH。

[0012] The fusion protein is designed to be expressed in immune cells under regulation, that is, in immune cells under the regulation of a regulatory promoter, the PGLYRP2 fusion protein can be expressed in a regulatable manner, and the immune cells simultaneously express a chimeric antigen receptor.

[0013] The immune cells designed with PGLYRP2 have low expression of PGLYRP2 before approaching tumor antigens and high expression of PGLYRP2 after approaching tumor antigens. In immune cells, the promoter of the PGLYRP2 protein is a regulatory promoter, and the PGLYRP2 protein can improve the infiltration effect of immune cells and the killing effect on tumors under the regulation of the regulatory promoter.

[0014] The above-mentioned fusion protein is designed to be expressed in immune cells under regulation, which is achieved by a regulatory promoter, and the regulatory sequence of the regulatory promoter is one or several of NFAT, NF-KB, and AP-1.

[0015] Among them, the NFAT regulatory sequence includes three repeated NFATs (i.e., 3×NFAT); the NFAT includes the nucleotide sequence shown in SEQ ID NO:2, specifically as follows:

[0016] GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGT.

[0017] Any one of the regulatory sequences NFAT, NF-KB, and AP-1 can constitute the corresponding nucleic acid molecule.

[0018] The genes of the PGLYRP2 fusion protein and the chimeric antigen receptor are delivered by constructing an expression cassette (i.e., an expression box), and the number of constructed expression cassettes is one or more. Further, when constructing the expression cassette, the vector delivery methods include lentivirus, retrovirus, ordinary plasmid, episome, nano-delivery system, electroporation, or transposon.

[0019] The corresponding recombinant vector can contain any one of the nucleic acid molecules of the regulatory sequences NFAT, NF-KB, and AP-1 or the expression cassette constructed by the genes of the PGLYRP2 fusion protein and the chimeric antigen receptor.

[0020] In one embodiment, the chimeric antigen receptor is expressed as a chimeric antigen receptor targeting one or more targets; among them, the targets of the chimeric antigen receptor include one or more of CLDN18.2, GPC3, HER2, TAA, GD2, MSLN, EGFR, NY-ESO-1, MUC1, PSMA, and EBV.

[0021] In one embodiment, the binding region between the chimeric antigen receptor and the target can be scFv, Fab, or the combination region of scFv and Fab; among them, the scFv region structure can be replaced by any one or more of the single-chain antibodies, single-chain variable fragments (scFv), and Fab fragments of any target.

[0022] In one embodiment, the chimeric antigen receptor includes a leader sequence, an scFv that recognizes tumor-associated antigens, a hinge region and a transmembrane domain, an intracellular co-stimulatory domain, and an intracellular activation signal CD3Zeta; among them, the scFv is the scFv of an anti-idiotypic antibody; the hinge region and the transmembrane domain are CD28, or the CD8 hinge region and the transmembrane domain; the intracellular co-stimulatory domain is CD28, CD137 (4-1BB), or the ICOS intracellular co-stimulatory domain.

[0023] In one embodiment, the binding region between the chimeric antigen receptor and the target can be a bispecific antibody that binds to one target or two targets, or can be formed by two or more chimeric antigen receptors that span the membrane and recognize different targets respectively.

[0024] In one embodiment, the structure of the chimeric antigen receptor includes one or more of signal peptide CD8SP, transmembrane domains CD8Hinge, CD8TM, intracellular activation element 4-1BB, and CD3Zeta.

[0025] In one embodiment, the vectors for transfecting the genes of immune cells into chimeric antigen receptors include lentivirus, retrovirus, ordinary plasmid, episome, nano-delivery system, electroporation, transposon, or other delivery systems.

[0026] The above-mentioned immune cells can be one of T cells, NK cells, NKT cells, macrophages, γ-δ T cells, TIL cells, TCR-T cells, or other tumor-killing cells. In the recombinant cell lines constructed from these immune cells, there are included the above-mentioned fusion proteins, nucleic acid molecules, expression cassettes, or recombinant vectors, etc.

[0027] The present invention also provides a recombinant vector containing the above-mentioned nucleic acid molecule or expression cassette.

[0028] The present invention also provides a biological material, which contains an expression cassette, a recombinant vector, a recombinant protein, a recombinant microorganism, or a recombinant cell line constructed from a nucleic acid sequence or an amino acid sequence, and the nucleic acid sequence or the amino acid sequence is derived from the above-mentioned regulatable fusion protein. This biological material can also be made into a biological preparation, and this biological preparation is a pharmaceutically acceptable carrier, diluent, or excipient. This biological preparation or biological material can be used in drugs for treating and / or preventing cancer or tumors.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] After the regulatable expression PGLYRP2 fusion protein provided by the present invention is designed into immune cells, it expresses a chimeric antigen receptor and can specifically recognize the tumor cell surface antigen targeted; while the regulatable expression PGLYRP2 protein in immune cells can enhance the infiltration ability of immune cells and the killing ability against tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is a design diagram of the nucleic acid molecular structure of CAR-T cells;

[0032] Figure 2 It is a growth curve of CAR-T amplification;

[0033] Figure 3 Flow cytometry plot of CLDN18.2 expression in HGC-27-CLDN18.2

[0034] Figure 4 Expression results of PGLYRP2 before and after stimulation with tumor antigen

[0035] Figure 5 Results of in vitro recruitment of T cells by CAR-T cells

[0036] Figure 6 Survival curve of CAR-T animal experiment Detailed implementation manners

[0037] The following will further describe in detail the preferred embodiments of the present invention in conjunction with the accompanying drawings.

[0038] The present invention provides a regulatable expression of PGLYRP2 regulatory protein, which is designed into immune cells and regulated for expression, that is, under the regulation of a regulatory promoter, immune cells can regulatably express the PGLYRP2 fusion protein, and the immune cells simultaneously express a chimeric antigen receptor.

[0039] The immune cells designed with the PGLYRP2 regulatory protein have low expression of PGLYRP2 before approaching the tumor antigen and high expression of PGLYRP2 after approaching the tumor antigen; the promoter of the PGLYRP2 protein in the immune cells is a regulatory promoter, and the PGLYRP2 protein can improve the infiltration ability of immune cells and the killing effect on tumors under the regulation of the regulatory promoter. Among them, the regulatory sequence of the regulatory promoter is one or more of NFAT, NF-KB, and AP-1.

[0040] In one embodiment, it also relates to a nucleic acid molecule, which contains any one or more of the regulatory sequences NFAT, NF-KB, and AP-1.

[0041] In one embodiment, immune cells express a chimeric antigen receptor, such as CAR cells. The expression of the chimeric antigen receptor can be a chimeric antigen receptor targeting one or more targets; such as CAR cells.

[0042] In one embodiment, the targets of the chimeric antigen receptor can also be one or more of idiotype CLDN18.2, GPC3, HER2, TAA, GD2, MSLN, EGFR, NY-ESO-1, MUC1, PSMA, and EBV.

[0043] The binding region between the chimeric antigen receptor and the target can be scFv, Fab, or a combination of scFv and Fab; among them, the scFv region structure can be replaced by any one or more of the single-chain antibodies, single-chain variable fragments (scFv), and Fab fragments of any target.

[0044] The above chimeric antigen receptor comprises a leader sequence, a scFv that recognizes a tumor-associated antigen, a hinge region and a transmembrane domain, an intracellular co-stimulatory domain, and an intracellular activation signal CD3ζ; wherein, the scFv is a scFv of an anti-idiotypic antibody; the hinge region and the transmembrane domain are the hinge region and transmembrane domain of CD28 or CD8; the intracellular co-stimulatory domain is the intracellular co-stimulatory domain of CD28 or CD137 (4-1BB) or ICOS.

[0045] The binding region between the chimeric antigen receptor and the target can be a bispecific antibody that binds to one target, or a bispecific antibody that binds to two targets, or can be formed by two or more chimeric antigen receptors that span the membrane and recognize different targets respectively.

[0046] In one embodiment, the structure of the chimeric antigen receptor includes one or more of a signal peptide CD8SP, a transmembrane domain CD8Hinge, CD8TM, an intracellular activation element 4-1BB, and CD3Zeta.

[0047] The genes of the PGLYRP2 fusion protein and the chimeric antigen receptor are delivered by constructing an expression cassette, that is, an expression box, and the number of expression cassettes constructed is one or more; the vector delivery methods for constructing the expression cassette include lentivirus, retrovirus, ordinary plasmid, episome, nano-delivery system, electroporation, or transposon; that is to say, the vectors for transferring the genes of immune cells into the chimeric antigen receptor include lentivirus, retrovirus, ordinary plasmid, episome, nano-delivery system, electroporation, transposon, or other delivery systems. Among them, the recombinant vector for constructing the expression cassette can be a nucleic acid molecule containing regulatory sequences NFAT, NF-KB, or AP-1, or can be an expression cassette constructed by fusing the genes of the PGLYRP2 fusion protein and the chimeric antigen receptor.

[0048] The immune cells of the present invention can be one of T cells, NK cells, NKT cells, macrophages, gamma-delta T cells, TIL cells, TCR-T cells, or other tumor-killing cells, preferably T cells. In the recombinant cell lines constructed from these immune cells, the above-mentioned fusion proteins, nucleic acid molecules, expression cassettes, or recombinant vectors are included.

[0049] The above-mentioned immune cells that regulatively express the PGLYRP2 protein can be made into a biomaterial; the biomaterial contains an expression cassette, a recombinant vector, a recombinant protein, a recombinant microorganism, or a recombinant cell line constructed from a nucleic acid sequence or an amino acid sequence, and the nucleic acid sequence or the amino acid sequence is derived from the above-mentioned regulative fusion protein.

[0050] The above-mentioned biological material can also be made into a biological preparation, which is a pharmaceutically acceptable carrier, diluent or excipient; and the biological preparation can be administered in any convenient way, including by spraying, injection, swallowing, infusion, implantation or transplantation. The biological preparation can be applied to drugs for preventing and / or treating solid tumors.

[0051] The immune cells that regulatively express PGLYRP2 provided by the present invention express a chimeric antigen receptor and can specifically recognize the antigen on the surface of the targeted tumor cells; these immune cells regulatively express the PGLYRP2 protein to enhance the infiltration ability of the immune cells and the killing ability against tumors.

[0052] The following takes CAR-T as a specific example for detailed description. For immune cells, any one of NK cells, NKT cells, macrophages, gamma-delta T cells, TIL cells, etc. can also be used.

[0053] Example 1 Preparation of lentiviral vector

[0054] 1. Design and synthesize the CAR nucleic acid molecular structure

[0055] 1). The NFAT-P2-EF1α-CAR molecule formed by tandem connection of 3×NFAT (nucleotide sequence as shown in SEQ ID NO: 2), minP (weak promoter), PGLYRP2 (amino acid sequence as shown in SEQ ID NO: 1) and the CAR molecule. The designed and synthesized CAR nucleic acid molecular structure containing the promoter minP is as shown in Figure 1 Part A.

[0056] The amino acid sequence of PGLYRP2 is as shown in SEQ ID NO: 1:

[0057] .

[0058] 2) The nucleotide sequence of 3×NFAT is shown in SEQ ID NO: 2:

[0059] GGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGTGGAGGAAAAACTGTTTCATACAGAAGGCGT.

[0060] 3) NF-KB-P2-EF1α-CAR molecules are formed by 3×NF-KB response elements, minP (weak promoter), PGLYRP2 and CAR molecules in series. The structure of the designed and synthesized CAR nucleic acid molecule containing the promoter minP is as follows Figure 1 As shown in part B.

[0061] 4) AP-1-P2-EF1α-CAR molecules are formed by tandem use of 3×AP-1 response elements, minP, PGLYRP2 and CAR molecules. The structure of the designed and synthesized CAR nucleic acid molecule containing the promoter minP is as follows:Figure 1 As shown in part C.

[0062] 5) The EF1α-CAR molecule formed by the tandem nucleic acid sequences of the EF1α promoter, CD8α signal peptide, anti-CLDN18 single-chain antibody, CD8α transmembrane domain, 4-1BB, and CD3ζ. The CAR nucleic acid molecule structure without the promoter minP was designed and synthesized as shown in Figure 1 part D.

[0063] The Figure 1 CAR molecule synthesized in part A, the regulatory promoter, and the PGLYRP2 molecule were constructed into the lentiviral expression vector p161 to form the pNFAT-P2-EF1α-CAR plasmid; the Figure 1 CAR molecule synthesized in part D was constructed into the lentiviral expression vector p161 to form the pEF1α-CAR plasmid.

[0064] 2. Construction of the CLDN18.2 molecular nucleic acid sequence

[0065] The synthesized CLDN18.2 molecular nucleic acid sequence was constructed into p161 to form the pCLDN18.2 plasmid, as shown in Figure 1 part E.

[0066] Example 2 Packaging of recombinant lentivirus

[0067] The three plasmids, pEF1α-CAR prepared in Example 1, the lentiviral envelope plasmid pMD2.G (Addgene, Plasmid#12259), and the lentiviral packaging plasmid psPAX2 (Addgene Plasmid#12260), were transfected into 293T cells using Lipofectamine3000 to prepare the complete lentiviral expression vector LV-EF1α-CAR.

[0068] The three plasmids, pNFAT-P2-EF1α-CAR, the lentiviral envelope plasmid pMD2.G (Addgene, Plasmid#12259), and the lentiviral packaging plasmid psPAX2 (Addgene Plasmid#12260), were transfected into 293T cells using Lipofectamine3000 to prepare the complete lentiviral expression vector LV-NFAT-P2-EF1α-CAR.

[0069] The lentiviral complete expression vector LV-CLDN18.2 was prepared by transfecting three plasmids, pCLDN18.2, lentiviral envelope plasmid pMD2.G (Addgene, Plasmid#12259), and lentiviral packaging plasmid psPAX2 (Addgene Plasmid#12260), into 293T cells using Lipofectamine 3000.

[0070] The supernatants of the above three viruses were collected at 48 h and 72 h respectively, and the collected virus supernatants were ultracentrifuged and concentrated (Merck Millipore) to obtain three concentrated viruses, namely, LV-EF1α-CAR, LV-NFAT-P2-EF1α-CAR, and LV-CLDN18.2.

[0071] Example 3 Preparation of CAR-T Cells with Regulated Expression of PGLYRP2

[0072] 1. Obtaining T Cells

[0073] Mononuclear cells were isolated from the donor's peripheral blood, density gradient centrifugation was performed using the ficoll method, and T cells were enriched using a T cell sorting kit, such as CD3 MicroBeads, human-lyophilized, or 130-097-043, and T cells were activated, cultured, and amplified using magnetic beads conjugated with anti-CD3 / anti-CD28.

[0074] 2. Amplification of T Cells

[0075] When culturing T cells, TexMACS GMP Medium (Miltenyi Biotec, 170-076-309) was used, and the medium contained 10% FBS, 2 mM L-glutamine, and 100 IU / ml rhIL2. The cells were cultured in a constant temperature incubator at 37 °C and 5% CO2 during cell culture.

[0076] The concentrated recombinant lentiviruses LV-EF1α-CAR and LV-NFAT-P2-EF1α-CAR were used to infect the activated T cells respectively to obtain CAR-T cells that only express CAR (CAR-T-CLDN18.2) and CAR-T cells that express CAR and simultaneously regulate the expression of PGLYRP2 (CAR-T-CLDN18.2-P2). The proliferation of the two obtained CAR-Ts is as Figure 2 shown; when cultured to the 12th day respectively, the proliferation amplification multiples of CAR-T-CLDN18.2 and CAR-T-CLDN18.2-P2 cells were 1958 times and 2221 times respectively.

[0077] Example 4 Construction of CLDN18.2-expressing cell line

[0078] The concentrated virus LV-CLDN18.2 in Example 2 was used to infect HGC-27 cells, and finally the HGC-27 cell line overexpressing CLDN18.2 was obtained, named HGC-27-CLDN18.2. The expression results of CLDN18.2 are as Figure 3 shown.

[0079] Example 5 Expression of CAR-T cell PGLYRP2

[0080] Take the two kinds of CAR-T cells prepared in Example 3, resuscitate and culture them in fresh T cell medium for 24 hours, and collect the resuscitated CAR-T cells; take the HGC-27-CLDN18.2 overexpressing cell line constructed in Example 4 and co-culture it with the resuscitated CAR-T cells for 24h, and collect the cell supernatant; use ELISA to detect the PGLYRP2 expression of each cell, and the results are as Figure 4 shown; CAR-T-CLDN18.2 cells do not secrete PGLYRP2 fusion protein (that is, the secretion amount of PGLYRP2 fusion protein is 0), while CAR-T-CLDN18.2-P2 cells secrete 300 pg / ml PGLYRP2 fusion protein.

[0081] Example 6 In vivo function evaluation of CAR-T cells

[0082] Take 24 6-8-week-old NSG mice (body weight 18-22 g). After one week of adaptive feeding, subcutaneously inoculate the tumor cell line positive for HGC-27-CLDN18.2, and inoculate 1*10 7 tumor cells per mouse. Closely observe the animal status, and measure the tumor volume of the mice with a vernier caliper every three days. When the tumor volume reaches 100 mm 3 , after randomly grouping according to the mouse body weight and tumor size, infuse CAR-T cells or control T cells via the tail vein. The detailed administration method, dosage and administration route are shown in Table 1.

[0083] Table 1 Animal experiment protocol

[0084]

[0085] As Figure 5 The results show that CAR-T cells with regulated expression of PGLYRP2 can significantly prolong the survival time of mice. As Figure 6 shown, CAR-T cells with regulated expression of PGLYRP2 can significantly increase the tumor-infiltrating CAR-T cells (CAR-T-CLDN18.2: 3.5%; CAR-T-CLDN18.2-P2: 6.2%).

[0086] The above embodiments prove that the CAR-T cells with regulated expression of PGLYRP2 have stronger proliferation ability and antitumor activity in vitro and in vivo against tumors compared with CAR-T cells that do not express other proteins.

[0087] It should be understood that the above description of the preferred embodiments of the present invention is relatively detailed, and it should not be considered as a limitation on the scope of patent protection of the present invention. The scope of patent protection of the present invention shall be subject to the appended claims.

Claims

1. An expression cassette, characterized in that, The expression cassette contains a CAR structure and a regulatory protein; the CAR structure is a nucleic acid sequence of an EF1α promoter, a CD8α signal peptide, a single-chain antibody against CLDN18.2, a CD8 hinge region, a CD8α transmembrane domain, 4-1BB, and CD3ζ connected in series in sequence; the regulatory protein is a reaction element, a weak promoter, and a regulatory fusion protein connected in series in sequence; the fusion protein is connected to the EF1α promoter in the CAR; wherein, the fusion protein is PGLYRP2, and the amino acid sequence of PGLYRP2 is as shown in SEQ ID NO:1; the reaction element is one or more of NFAT, NF-KB, and AP-1.

2. The expression cassette according to claim 1, wherein The NFAT response element includes three repeated NFATs; the three repeated NFATs include the nucleotide sequence as shown in SEQ ID NO:

2.

3. A recombinant vector, characterized in that, The recombinant vector contains the expression cassette according to claim 1.

4. A recombinant cell line, characterized in that, The recombinant cell line contains the expression cassette according to claim 1, or contains the recombinant vector according to claim 3.

5. A biological preparation, characterized in that, The biological agent contains the expression cassette according to claim 1, or contains the recombinant vector according to claim 3, or contains the recombinant cell line according to claim 4.

6. Use of the biological agent according to claim 5 in the preparation of a drug for treating CLDN18.2-positive gastric cancer.

Images