A method for improving the quality of soy sauce

Abstract

The present invention discloses a method for improving the quality of soy sauce, belonging to the technical fields of enzyme engineering and fermentation engineering. In the present invention, a salt-tolerant glutaminase derived from Lactobacillus reuteri is expressed in Bacillus subtilis, and the expression level of the salt-tolerant glutaminase in Bacillus subtilis is increased by regulating through the RBS sequence, which is 5.61 times higher than that of the control. After immobilizing the recombinant Bacillus subtilis, the immobilized enzyme or immobilized cells are put into the brewing of high-salt dilute-state soy sauce in the present invention, effectively improving the amino acid nitrogen in soy sauce, which is increased from 0.783±0.003 g / 100 ml to 0.841±0.002 g / 100 ml, and the glutamic acid content is increased from 5.0152±0.048 g / l to 7.319±0.068 g / l, providing an efficient and economical method for soy sauce production.

Description

Technical Field

[0001] The present invention relates to a method for improving the quality of soy sauce, belonging to the technical fields of enzyme engineering and fermentation engineering. Background Art

[0002] L-Glutaminase (EC 3.5.1.2) catalyzes the hydrolysis of L-glutamine into L-glutamic acid and ammonia, and is widely distributed in microorganisms such as bacteria, yeasts, and fungi. This enzyme has great application potential in the food and pharmaceutical fields. The L-glutamic acid produced by the reaction is the main substance responsible for the fresh taste of food. Approximately 46% of the glutamic acid in brewed soy sauce is produced from L-glutamic acid during the soy sauce fermentation process. However, due to the high-salt environment in soy sauce, the activity of L-glutaminase in Aspergillus is inhibited, which results in the production of more tasteless pyroglutamine rather than the flavor substance glutamic acid. Therefore, it is necessary to explore salt-tolerant L-glutaminase to increase the content of L-glutamic acid in soy sauce. The L-glutaminase of Bacillus sp. LKG-01 (MTCC 10401) isolated from the Gangotri district of Uttarakhand in the Himalayas is also relatively stable in relative enzyme activity at a salt concentration of 25%. The L-glutaminase from Micrococcus luteus K-3 shows the maximum enzyme activity in the presence of 1.71 M NaCl, and in the presence of 3.08 M NaCl, it shows more than 90% activity. However, the source of the enzyme is related to food safety, and gene sources that do not meet food safety standards are generally considered potentially unsafe. Summary of the Invention

[0003] The present invention provides a recombinant Bacillus subtilis for producing L-glutaminase, which expresses the L-glutaminase shown in SEQ ID NO.1.

[0004] In one embodiment, the recombinant Bacillus subtilis uses plasmid pMA5 as an expression vector and expresses the L-glutaminase gene shown in SEQ ID NO.2.

[0005] In one embodiment, the 15-20 bp region upstream of the L-glutaminase gene is replaced with the RBS sequence shown in any one of SEQ ID NOs. 3-10.

[0006] In one embodiment, the sequence at 20 bp upstream of the L-glutaminase gene is replaced with the RBS sequence shown in SEQ ID NO.4.

[0007] The present invention also provides an immobilized cell of L-glutaminase.

[0008] In one embodiment, the preparation method of the immobilized cell is as follows:

[0009] (1) Culture the recombinant Bacillus subtilis and collect the bacterial cells in the cell culture broth;

[0010] (2) Mix the bacterial cells collected in step (1) with the sodium alginate solution to prepare immobilized cells.

[0011] In one embodiment, the recombinant Bacillus subtilis is cultured in a fermentation medium; the fermentation medium contains 25 g / L of sucrose, 40 g / L of yeast extract, 4 g / L of NH4Cl, 1.125 g / L of KH2PO4, 1.875 g / L of K2HPO4·3H2O, 2 g / L of CaCl2, and 2 g / L of L-sodium glutamate.

[0012] In one embodiment, feeding is also carried out during the culturing process.

[0013] In one embodiment, the medium for feeding contains: sucrose, 500 g / L; K2HPO4, 2.612 g / L; KH2PO4, 2.041 g / L; MgSO4·7H2O, 1.845 g / L; NaCl, 5 g / L.

[0014] The present invention also provides the application of the recombinant Bacillus subtilis or the immobilized cells in the production of soy sauce.

[0015] In one embodiment, the application includes, but is not limited to, increasing the content of amino acids in soy sauce.

[0016] In one embodiment, the amino acids include, but are not limited to, glutamic acid.

[0017] In one embodiment, the application is to add the recombinant Bacillus subtilis or the immobilized cells to the soy sauce fermentation system.

[0018] In one embodiment, the recombinant Bacillus subtilis is added to the soy sauce fermentation system in the form of a crude fermentation enzyme solution, whole cells, or immobilized cells.

[0019] In one embodiment, the immobilized cells are added to the soy sauce fermentation system at a ratio of 500 mL of fermentation broth equivalent: 1 L of soy sauce.

[0020] Beneficial effects:

[0021] (1) The present invention constructs a food-grade recombinant Bacillus subtilis by expressing L-glutaminase with improved salt tolerance and thermal stability and expressing the enzyme in Bacillus subtilis.

[0022] (2) The present invention also improves the enzyme activity of the food-grade recombinant strain BSW3 by optimizing the free energy of 5'-UTR and the synthetic biology application of the alrA gene, enabling the strain to achieve an enzyme production capacity of 1535.24 ± 20.83 U / ml during fermentation in a 5-L bioreactor, which is the highest reported yield to date.

[0023] (3) The food-grade recombinant strain constructed in the present invention can be used as a whole-cell catalyst in the soy sauce brewing process, increasing the important flavor substance glutamate in soy sauce by 47%. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Protein overexpression with 5'-UTR; (A) The planar structure of the MFE of 5'-UTR and its corresponding minimum free energy value are shown as a bar chart; (B) The protein expression levels of different 5'-utr structures located before the ATG start codon.

[0025] Figure 2 Fermentation process curve of fed-batch fermentation of recombinant strain BSW3 in a 5-L bioreactor.

[0026] Figure 3 Levels of amino acid nitrogen, glutamate, and glutamine in soy sauce produced by different groups; each experimental data point represents the average of 3 independent experiments, and the error bars represent the standard deviation. DETAILED DESCRIPTION OF THE INVENTION

[0027] Fermentation medium (by mass-volume percentage, i.e., "%" represents g / 100 mL): sucrose 2.5%, yeast extract 4%, NH4Cl 0.4%, KH2PO4 0.1125%, K2HPO4·3H2O 0.1875%, CaCl2 0.2%, sodium L-glutamate 0.2%, adjust the pH to 7.0, sterilize at 115°C under high temperature and high pressure for 25 minutes.

[0028] Fed-batch medium: sucrose, 500 g / L; K2HPO4, 2.612 g / L; KH2PO4, 2.041 g / L; MgSO4·7H2O, 1.845 g / L; NaCl, 5 g / L.

[0029] Example 1 Construction of a recombinant strain expressing a glutaminase mutant

[0030] Synthesize the nucleotide sequence encoding the glutaminase mutant H105K as shown in SEQ ID NO.2. Amplify the mutant gene glsA shown in SEQ ID NO.2 using primers pma5-lreu-F and p5-lreu-his-R; amplify the plasmid pMA5 using primers p5fanpi-R and p5fanpi-F; assemble the linearized pMA5 plasmid and the glsA gene to form the recombinant plasmid pMA5-glsA.

[0031] pma5-lreu-F: aaaaggagcgatttacatATGAATCTGAACGATGCCATCCAA;

[0032] p5-lreu-his-R: tcgacctctagaacgcgtTTAatgatgatgatgatgatgGTAGCGGAACACGTCCAGCTT;

[0033] p5fanpi-R: atgtaaatcgctcctttttaggtggcacaa;

[0034] p5fanpi-F: acgcgttctagaggtcgaaattca;

[0035] Transform the plasmid pMA5-glsA into competent Escherichia coli JM109 cells by chemical transformation. After purification by agarose gel extraction, introduce the plasmid into competent Bacillus subtilis cells, select positive transformants for sequencing to verify the sequence correctness.

[0036] Referring to the strategy of "Construction of a new food-grade expression system for Bacillussubtilis based on theta replication plasmids and auxotrophic complementation", based on the principle that the Cre recombinase specifically recognizes the loxP site and catalyzes the deletion, inversion or exchange of the fragment between two lox sites, the alrA gene was knocked out using the Cre / loxP site-specific gene operating system.

[0037] Reverse PCR was performed on plasmid pMA5-glsA using primers pma5-fanpi-kanR-R and pma5-fanpi-kanR-F. The alrA gene with the nucleotide sequence shown in Gene ID: 939942 was amplified using primers alrA-F and alrA-R. The PMA5-△kanR-alrA-glsA plasmid obtained in this way through homologous recombination was used to construct a recombinant plasmid by chemical transformation and transformed into Escherichia coli JM109. Then, the plasmid pMA5-ΔkanR-alrA-glsA was extracted and transformed into Bacillus subtilis 168 by chemical transformation to obtain strain BSW1.

[0038] pma5-fanpi-kanR-R tcccttttcagataattttagatttgctt;

[0039] pma5-fanpi-kanR-F acgatgacctctaataattgttaatc;

[0040] alrA-F: aatctaaaattatctgaaaagggaatgagcacaaaacctttttacagagata;

[0041] alrA-R: catgattaacaattattagaggtcatcgtttaattgcttatatttacctgcaataaaggatttcttac.

[0042] Example 2 Optimization of RBS to Increase the Expression Level of Glutaminase

[0043] The 5'-UTR sequences shown in Table 1 were designed and the region of 15 - 20 bp upstream of the glsA gene was replaced by plasmid reverse PCR method. The recombinant plasmids obtained were named pMA5-UTRx-glsA (where x represents the UTR number). The recombinant plasmids were constructed by chemical transformation and transformed into Escherichia coli JM109. Then, the plasmids were extracted and transformed into Bacillus subtilis 168 by chemical transformation to obtain strains BSW2 - BSW9 (corresponding to UTR-2 to UTR-9 respectively). Strain BSW1 with the unmodified RBS region was used as a control.

[0044] Table 1 RBS and Sequence List

[0045]

[0046] The strain BSW3 and the strain BSW1 constructed in Example 1 were fermented at 30 °C and 220 rpm for 30 h. The results showed that driven by the new RBS (UTR-3 was located 20 bp upstream of the L-glutaminase gene), the activity of L-glutaminase in the fermentation broth of strain BSW3 increased by 5.61 times compared with BSW1, increasing from 16.32 ± 0.56 U / ml to 91.56 ± 2.43 U / mL.

[0047] Example 3 Production of glutaminase by recombinant bacterium BSW3 in a 5 L fermenter

[0048] The strain BSW3 constructed in Example 2 was used for fermentation in a 5-L bioreactor. The recombinant strain was subjected to two-stage seed expansion culture, specifically:

[0049] The first stage: Inoculate a single colony into the fermentation medium and culture at 37 °C for 12 h to obtain a seed solution with an OD of 3 - 4.

[0050] The second stage: Transfer the seed solution cultured in the first stage to a 5-L bioreactor containing 2 L of fermentation medium with 100 mL of the seed culture solution and culture at 30 °C for 72 h.

[0051] Fermentation was carried out using a DO-stat fed-batch fermentation strategy. During the fermentation process, the DO was controlled at 35%. During the fermentation process, when the DO was higher than 40%, NH4OH (30% v / v) and the feeding medium were started to be fed at a rate of 15 ml / h. When the DO began to rise, the feeding flow rate was increased to 15 mL / h. After 72 h, the L-glutaminase activity reached 1535.24 ± 20.83 U / mL, and the OD600 reached 56.91. Regarding the production of the enzyme, by exploring the bacterial growth curve and the kinetics of enzyme production, it was found that L-glutaminase was a growth-related product in bioreactor culture, and the average yield per unit OD 600 was 26.98 U / ml.

[0052] Example 4 Application of recombinant bacterium BSW3 in soy sauce production

[0053] Preparation of immobilized cells: Collect 500 mL of the fermentation broth from Example 3, centrifuge and discard the supernatant. Wash the centrifuged bacterial sludge with PBS and then mix it with an equal volume of sodium alginate solution with a concentration of 25 g / L. Drop the mixture into a 100 g / L CaCl2 solution through a syringe to obtain 38.82 g of immobilized capsules with a particle size of 3 - 5 mm.

[0054] Preparation of crude enzyme solution: 500 mL of the fermentation broth prepared according to the method of Example 3 was collected, and the supernatant was discarded by centrifugation. After washing and centrifuging with PBS, 30 μL of lysozyme (200 mg / mL) was added to the cells, and ultrasonic disruption was carried out: disrupted at 400 w for 2 s and stopped for 5 s for 30 min. After disruption, centrifugation was carried out at 4 °C and 12,000 rpm for 20 min. The supernatant and precipitate after cell wall disruption were separated, and the supernatant was filtered through a 0.45-μm filter membrane to obtain the supernatant after cell wall disruption, and an enzyme solution with an enzyme activity of 1535 U / mL was obtained.

[0055] Preparation of whole cells: 500 mL of the fermentation broth prepared according to the method of Example 3 was collected, and the supernatant was discarded by centrifugation. After washing and centrifuging with PBS, all the bacterial cells were obtained.

[0056] Soy sauce brewing was carried out according to the following process:

[0057] The soybeans were washed and separated, soaked for 8 h, and then steamed at 125 °C for 15 min. The cooked soybeans were naturally cooled to 40 °C, and then the soybeans and flour were mixed at a mass ratio of 4:1, 0.05% of koji starter was added by mass, and then cultured at 28 - 30 °C for 44 h to obtain koji. During the koji-making process, attention should be paid to turning the koji in time to control the temperature not exceeding 30 °C. After 44 h, the finished product was obtained. The finished koji was mixed with brine (24 Be / 20 °C) at a mass ratio of 1:2.2, and the mixture was placed at 37 °C for fermentation. The crude enzyme solution, whole cells or immobilized cells (separately prepared from the same batch of 500 mL of fermentation broth) were each divided into six equal parts, and one part was added to a 1-L soy sauce fermentation system every 20 days. After 120 days, the soy sauce was sampled and filtered to obtain raw soy sauce, and finally heat-treated at 90 °C for 30 min to obtain sterilized soy sauce.

[0058] The amino acid nitrogen content was determined by the formaldehyde method, and the free amino acid content was determined by HPLC. According to the Chinese Soy Sauce Hygiene Standard (GB / T 18186 - 2000), in the control group without additives, the amino acid nitrogen content of the soy sauce was 0.783 ±

[0059] 0.003 g / 100 mL, reaching the first-class standard. The soy sauce fermented with immobilized cells could reach the special-class standard, and the amino acid nitrogen content was 0.841 ± 0.002 g / 100 mL.

[0060] Regarding the glutamic acid content, the addition of three forms of glutamic acid enzymes all increased the glutamic acid content. In the soy sauce fermented with immobilized cells, the glutamic acid content increased from 5.0152 ± 0.048 g / L to 7.319 ± 0.068 g / L, an increase of 45.9%. The group adding the crude enzyme solution increased by 42.2%, and the group adding whole cells increased by 36.7%.

[0061] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone skilled in this technology can make various modifications and refinements without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A recombinant Bacillus subtilis for producing L - glutaminase, using plasmid pMA5 as an expression vector to express the L - glutaminase gene shown in SEQ ID NO.

2.

2. The recombinant Bacillus subtilis according to claim 1, characterized in that, The 15 - 20 bp region upstream of the L - glutaminase gene is replaced with the RBS sequence shown in any one of SEQ ID NOs. 3 - 5, 7 - 9.

3. Immobilized cells for producing L-glutaminase, characterized in that, The amino acid sequence of the L - glutaminase is as shown in SEQ ID NO.

1.

4. A method for preparing the immobilized cells according to claim 3, characterized in that, It includes the following steps: (1) Culturing the recombinant Bacillus subtilis according to claim 1 or 2, and collecting the bacterial cells in the cell culture solution; (2) Mixing the bacterial cells collected in step (1) with the sodium alginate solution to prepare immobilized cells.

5. The method according to claim 4, wherein During the culturing process in step (1), feeding was also carried out.

6. The method according to claim 5, characterized in that, The medium for feeding contains: sucrose, K2HPO4, KH2PO4, MgSO4·7H2O, NaCl.

7. The application of the recombinant Bacillus subtilis according to claim 1 or the immobilized cells according to claim 3 in soy sauce production.

8. The application according to claim 7, wherein The said application includes increasing the content of amino acids in soy sauce.

9. The application according to claim 8, wherein The said application is adding the recombinant Bacillus subtilis according to claim 1 or 2 or the immobilized cells according to claim 3 into the soy sauce fermentation system.

Images