The GNBP3 gene of Gram-negative bacteria recognition protein of Coptotermes nigrotermes and its application

Abstract

The invention discloses a targeted silencing black-winged termite Gram-negative bacteria recognition protein GNBP3 The invention relates to a dsRNA of a gene and its application in termite control. Specifically, black-winged termite GNBP3 The nucleotide sequence of the gene is SEQ ID NO: 1. This patent is the first to use the technology of bacterial amplification of dsRNA to synthesize the black-winged termite GNBP3 dsRNA, a feeding method was established to test the black-winged termite GNBP3 RNA interference system, first discovered using black-winged termites alone GNBP3 dsRNA has a high lethality rate against termites. GNBP3 The combination of dsRNA and biocontrol bacteria can significantly improve the control effect of biocontrol bacteria. The present invention lays a theoretical foundation for the development of immunosuppressants that are safe for humans and animals, and provides a new theory for biological control of pests, ultimately providing new strategies and new ways of pest control for my country's green agricultural production and sustainable development.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a protein for recognizing gram-negative bacteria of black-winged termites GNBP3 Genes and their applications. Background Art

[0002] Termites are one of the most famous pests in the world. They are social insects with strong reproductive and survival abilities. They mainly harm houses, agricultural and forestry crops, reservoir dams, cable bridges, transportation facilities, etc. They also often bore non-cellulose materials. Black-winged earth termites belong to higher termites and are a type of earth termites. They spend most of their time underground. They mainly harm the bark and shallow wood layer, as well as the roots, with worker ants. They cause large ant trails to form outside the damaged tree trunks, and their growth declines. When they invade the wood, the trunks wither; especially for seedlings, they are very likely to cause death. When feeding and damaging, they make mud blankets and mud lines. In severe cases, the mud blankets surround the entire trunk to form mud sheaths, which are very obvious. Black-winged earth termites are the main pests of reservoirs and river dams, and can often cause dam leakage, landslides and breaches (Li Dong et al., 2001; Cai Banghua et al., 1965; Xu Zhenhai, 2004; Xu Zhide et al., 2007). Because the nests of black-winged termites are very hidden, the damage they cause is not easy to detect. When they are discovered, the damage is already very huge. In addition, black-winged termites have a diverse diet and a wide range of damage, including more than 100 species of plants including camphor, fir, magnolia, maple poplar, etc. (Huang Qiuying et al.; 2005).

[0003] At present, the control of black-winged termites still mainly relies on traditional chemical pesticides, but problems such as pesticide residues are becoming increasingly serious, posing a potential threat to human and animal health and the ecological environment. Therefore, it is imperative to discover new biological control methods and explore new strategies for the control of black-winged termites. RNA interference (RNAi) refers to the phenomenon in which double-stranded RNA (ds RNA) induces homologous mRNA degradation in eukaryotic organisms, silencing target gene expression. In the study of insect gene function, gene interference is generally carried out by introducing exogenous dsRNA or small interfering RNA (si RNA). RNAi can achieve sustainable control of pest populations by selectively interfering with the expression of key insect genes, and is highly anticipated in the field of pest control. Gram-negative binding proteins GNBPs, also known as β-1, 3-glucan recognition proteins (βGRPs), are members of the same family. They were first discovered and named in silkworms. They are mainly responsible for fungal recognition (Beaulaton et al., 1979) and play an important role in subsequent immune signal transduction and initiating antimicrobial peptide gene expression. Silencing this gene can reduce the ability of termites to resist infection by pathogenic microorganisms, ultimately leading to their death. Therefore, it is expected that RNA interference technology can be used to target termites. GNBP3 Genetically designed dsRNA for the control of black-winged termites. Summary of the invention

[0004] The object of the present invention is to provide a black-winged termite GNBP3 The application of dsRNA of genes in termite control. Among them, black-winged termites GNBP 3 The gene was first discovered by the applicant. Based on the gene, dsRNA is designed and introduced into termites, which can effectively prevent and control black-winged termites.

[0005] Specifically, the present invention proposes a black-winged termite Gram-negative bacteria recognition protein GNBP 3 Gene, the GNBP 3 The nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the corresponding amino acid sequence is shown in SEQ ID NO: 2.

[0006] The present invention further proposes GNBP3 The application of genes in termite control.

[0007] At the same time, the present invention proposes a method for preventing and controlling termites. GNBP3 The dsRNA is transcribed from the nucleotide sequence shown in SEQ ID NO:1.

[0008] The present invention also provides a DNA encoding the above-mentioned dsRNA.

[0009] Furthermore, the present invention provides a recombinant expression vector comprising the above-mentioned DNA encoding dsRNA.

[0010] The present invention also provides a host bacterium for transforming the recombinant expression vector.

[0011] In another aspect, the present invention provides a method for controlling termites, comprising the following steps: GNBP3 The dsRNA is fed to termites, and the dsRNA is transcribed from the nucleotide sequence shown in SEQ ID NO: 1.

[0012] As another method of controlling termites, you can use GNBP3 dsRNA and Serratia marcescens SM1 are co-fed to termites, wherein the GNBP3 The dsRNA is transcribed from the nucleotide sequence shown in SEQ ID NO:1.

[0013] Beneficial effect: The present invention is based on immune recognition protein GNBP 3 The dsRNA was designed by gene, and the feeding method was established to kill black-winged termites GNBP3 RNA interference system, and concluded that feeding had a significant gene silencing effect in black-winged termites. GNBP3 The application of RNAi technology provides a theoretical basis. At the same time, by using the HT115 strain to construct a dsRNA expression system, the interference cost is reduced. The present invention successfully interferes with the immune recognition protein using this system. GNBP 3 Gene expression and found GNBP3 The gene-silenced black-winged termites were significantly more sensitive to the SM1 strain of Serratia marcescens. GNBP3 When dsRNA and SM1 were used together, the mortality rate of termites was significantly increased, indicating that it can improve the control effect of biocontrol bacteria; it was also found that when used alone GNBP3 dsRNA can also control black-winged termites, and its effect is comparable to that of SM1 alone. GNBP3 It provides a theoretical basis for the application of dsRNA in termite control. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the electrophoresis diagram of total RNA of Coptotermes nigropteroides;

[0015] Figure 2 for GNBP3 The cloned sequence and deduced amino acid sequence of

[0016] Figure 3 Treating black-winged termites with Serratia marcescens GNBP3 Expression level;

[0017] Figure 4 For L4440-ds GNBP3 and L4440-ds GFP The electrophoresis results of the recombinant plasmid, where 1 is L4440-ds GFP , 2 is L4440-ds GNBP3 ;

[0018] Figure 5 is the result of dsRNA digestion electrophoresis, where 1 is ds GFP , 2 is ds GNBP3 ;

[0019] Figure 6 Relative expression levels of target genes sampled at different times after dsRNA feeding, where: Note: Different lowercase letters indicate significant differences among treatments; ABCD are 3, 6, 12, and 24 h, respectively;

[0020] Figure 7 is the survival analysis after 6 h of dsRNA treatment, where ABCDEF are 11, 16, 21, 26, 31, and 36 h, respectively; G is the survival analysis graph, and the dotted line is the time of SM1 treatment. DETAILED DESCRIPTION

[0021] The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials and reagents used are commercially available unless otherwise specified.

[0022] Experimental materials and methods involved in the examples:

[0023] (1) Test insects: Black-winged termites were collected from Jurong City, Jiangsu Province. After the ant nests were collected, they were placed in an insect incubator under dark conditions at 27 ℃ for breeding.

[0024] (2) Cultivation of Serratia marcescens SM1:

[0025] Culture medium: Bacterial basal medium (g / L): peptone 10 g, beef extract 20 g, NaCl 2 g, K2HPO42 g, agar 18 g pH 7.2~7.4.

[0026] Bacterial seed medium (g / L): peptone 10 g, yeast extract 20 g, NaCl 2 g, K2HPO4 2 g.

[0027] Bacterial fermentation medium (g / L): peptone 10 g, soybean oil 30 g, NaCl 2 g, K2HPO4 2 g.

[0028] The isolated Serratia marcescens strain SM1 was transferred to the bacterial basal medium and cultured in the dark at 27 °C for 24 h. After streaking, a single colony was obtained. A single colony was taken out and placed in a sterilized 250 mL conical flask containing 50 mL seed culture medium. It was cultured in a constant temperature shaker at 30 °C and 200 r / min for 12 h for seed liquid culture. Then 70 mL of the cultured seed liquid was added to 250 mL of fermentation medium, and cultured in a shaking incubator at 200 r / min at 30 °C for 36 h. After culture, it was taken out for use.

[0029] (3) Determination of concentration of Serratia marcescens SM1 fermentation broth:

[0030] Within a certain range, as the number of bacteria in the fermentation broth of Serratia marcescens SM1 increased, its OD 600 The value of also increases.

[0031] The present invention is further described in detail below in conjunction with specific embodiments. The embodiments will help to understand the present invention, but the protection scope of the present invention is not limited to the following embodiments.

[0032] Example 1 GNBP3 Gene cloning

[0033] (1) Primer design: Based on transcriptome data GNBP3 Primers were designed using Primer5 software:

[0034] GNBP3 F:TCAAAGAAAGCGACATGCGGTCT;

[0035] GNBP3 R: GTCGGCAGCTTTATAAAGCCCAAAC.

[0036] (2) cDNA amplification and TA cloning:

[0037] The total RNA of termites was extracted by Trizol method.

[0038] The total RNA extraction results of black-winged termites (such as Figure 1 ). The nucleic acid detector detects the OD of RNA 260 / OD 280 The ratio is 1.855, which is between 1.8 and 2.0, indicating that the RNA quality is acceptable and the next step of the experiment can be carried out.

[0039] Total RNA was used as a template and reverse transcription was performed according to the instructions of First Strand cDNA Synthesis Kit of TaKaRa Company to synthesize cDNA. The reverse transcription system is shown in Table 1.

[0040] Table 1

[0041]

[0042] Using cDNA as template and primers GNBP3 F. GNBP3 R, amplified, and obtained a 1143 bp fragment, the sequence of which is shown in SEQ ID NO.1. The full-length sequence contains an open reading frame of 1119 bp, encoding a 372 amino acid polypeptide, such as Figure 2 The PCR amplification reaction system is shown in Table 2. The PCR amplification reaction conditions are: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30s, 64.5℃ annealing for 30s, 72℃ extension for 30s, for a total of 35 cycles; 72℃ final extension for 10 min. The PCR amplification product was detected by 1% agarose gel electrophoresis and photographed under the gel imaging system. The correct PCR product was purified and recovered by gel recovery kit. The TA cloning conditions are shown in Table 3. The gel recovery product was connected with pClone007 at room temperature for 1-5min, and the connection product was transformed into E.coli DH5α competent cells. The transformation steps of the connection product are as follows:

[0043] (1) Take out the E. coli DH5α competent cells from the −80°C refrigerator and dissolve them in ice water;

[0044] (2) Use a pipette to add 10 μL of the ligation product to 100 μL of E. coli DH5α competent cells and place on ice for 30 minutes;

[0045] (3) Heat shock in a 42°C water bath for 45 seconds, then immediately place in ice water for 2 minutes;

[0046] (4) Add SOC or LB liquid culture medium and culture at 37°C and 200 rpm for 1 h;

[0047] (5) Spread 200uL of bacterial solution on LB solid medium containing Amp penicillin (final concentration 50μg / mL) and culture inverted in a 37°C incubator overnight.

[0048] The transformation product was cultured in LB (Amp + ) solid medium for 12-16 h. The positive clones were selected and identified by bacterial liquid PCR. The recombinant plasmid containing the correct insertion fragment was named pClone007- GNBP3 , sent to the company for sequencing.

[0049] Table 2

[0050]

[0051] Table 3

[0052]

[0053] Example 2 Effect of Serratia marcescens SM1 on black-winged termites GNBP3 Inducible expression of

[0054] Toxic experiment: First, filter paper was placed on the bottom of each 9 cm culture dish and moistened with water. Then, 20 black-winged termite workers with good vitality and development were placed in the culture dish. The fermentation medium of Serratia marcescens SM1 was used as a control. Each concentration (2.139×10 11 cells / mL, 2.139×10 10 cells / mL, 2.139×10 9 The bacterial solution of 100 cells / mL was dripped on the black-winged termites with a 0.12 μL micropipette, and each group was repeated three times. After dripping, it was placed in a dark environment at 25 ℃ for observation and sampling. The samples were collected at 3, 6, 12, and 24 hours, and stored at -80 ℃.

[0055] like Figure 3 As shown in the fluorescence quantitative experiment, it was found that the concentration of 2.139×10 9 After treating black-winged termites with SM1 of cells / mL, GNBP3 At 3 h, 6 h, 12 h and 24 h of treatment, the expression of β-catenin was significantly upregulated. 10 After treating black-winged termites with SM1 of cells / mL, GNBP3 At 3 h, 6 h and 12 h of treatment, the expression of 11 After treating black-winged termites with SM1 of cells / mL, GNBP3 The expression levels were up-regulated at 3 h and 6 h, and significantly down-regulated at 12 h and 24 h.

[0056] Example 3 Termites GNBP3 Synthesis and induced expression of dsRNA of genes.

[0057] (1) Termites GNBP3 Primer design for dsRNA of genes.

[0058] Prediction by online software GNBP3There are potential RNAi target sites at 250 bp~710 bp of the cloned GNBP3 Primers were designed using Primer5 software:

[0059] ds GNBP3 F: ATTT GCGGCCGCCTGTTCATCAAACCGACCCT;

[0060] ds GNBP3 R: CCC AAGCTTTCTGAAGTCTTCTCAAAGTGGG,

[0061] And introduce restriction sites NotⅠ and HindⅢ in the upstream and downstream (bold letters are restriction sites, italic letters are protected bases). GFP The primers are:

[0062] ds GFP F: ATCG GAGCTCAGTTGAACGGATCCATCTTCA;

[0063] ds GFP R: CCC AAGCTTAGAACTTTTCACTGGA,

[0064] And the restriction sites (SacI) and HindⅢ were introduced upstream and downstream. All primers were synthesized by Tianjin Qingke Biotechnology Co., Ltd.

[0065] (2) Termites GNBP3 Synthesis of dsRNA of genes.

[0066] Using sequencing to GNBP3 Full-length plasmid pClone007- GNBP3 As a template, the upstream and downstream primers designed for synthesizing dsRNA were used. GNBP3 F and ds GNBP3 R was used for PCR amplification; the PCR amplification reaction conditions were: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 30 s, for a total of 35 cycles; 72 ℃ final extension for 10 min. The PCR amplification products were detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. The correct PCR products were purified and recovered using a gel recovery kit.

[0067] (3) Construction of dsRNA expression vector.

[0068] At the same time, the GFP protein nucleic acid sequence already available in the laboratory was used as a template to clone a 500 bp fragment. The target fragment and the L4440 vector were digested and linked, and L4440-ds was successfully constructed. GNBP3 and L4440-ds GFP Recombinant plasmid. L4440-ds GNBP3 and L4440-ds GFP The results of recombinant plasmid electrophoresis are as follows Figure 4 shown.

[0069] Specifically, L4440-ds GNBP3 As an example, the above PCR product was double-digested with NotⅠ and HindⅢ to recover the target fragment; at the same time, the expression vector L4440 was double-digested with these two enzymes to recover the target vector. The double-digestion system of the target fragment and the double-digestion system of the vector are shown in Table 4 and Table 5, respectively. The target fragment and the target vector were connected at 16℃ for 16 h under the action of T4 DNA ligase. The ligation product was transformed into E. coli DH5α competent cells and cultured in LB (ampicillin and tetracycline double resistance) solid medium for 12 h. After selecting the positive clones and identifying them by enzyme digestion, the recombinant plasmid containing the correct inserted fragment was named L4440-ds GNBP3 , sent to the company for sequencing.

[0070] Table 4

[0071]

[0072] Table 5

[0073]

[0074] (4) Induced expression and extraction of dsRNA.

[0075] Containing L4440-ds GNBP3 and L4440-ds GFP The recombinant plasmid was expressed by induced dsRNA in HT115 strain, and the total RNA after induced expression was digested with DNaseⅠ and RNase A. The electrophoresis results showed that the bacterial DNA and RNA were degraded, and the target bands were 461 bp and 500 bp, which were consistent with ds GNBP3 and ds GFP The expected size is consistent, and the interference vector is successfully constructed ( Figure 5 ).

[0076] L4440-ds GNBP 3 For example, the sequenced L4440-ds GNBP3 The recombinant plasmid was transformed into HT115 (DE3) competent bacteria and spread on a plate containing ampicillin (50 μg∙mL -1) and tetracycline (12.5 μg∙mL -1 ) on LB solid medium with dual antibodies and inverted culture at 37 °C overnight. Pick a single clone and inoculate it in a medium containing ampicillin (50 μg∙mL -1 ) and tetracycline (12.5 μg∙mL -1 ) in LB liquid medium with double antibodies, 37 ℃, 220 r∙min -1 The culture was shaken until the bacterial solution OD 600 When the concentration was about 0.5-0.6, IPTG (final concentration 0.8 mM) was added and the mixture was incubated at 37 °C and 220 r∙min. -1 Continue shaking the culture for 3 h, then use TaKaRa RNAiso Plus to extract dsRNA. Use RNAse H and DNAse I to digest dsRNA. Use Eppendorf Bio Spectrometer basic for quantification to a final concentration of 1 μg / μL. Store in a -80℃ ultra-low temperature freezer for later use.

[0077] Example 4 After RNAi GNBP3 Detection of gene expression.

[0078] First, GNBP 3 The dsRNA was mixed with Nile Blue, and then 800 uL was dripped onto the filter paper at the bottom of a 7 cm culture dish. GNBP3 The control group was ds GFP and 20% Nile Blue aqueous solution. 20 termites were added to each culture dish, and each group was repeated 3 times. The samples were placed in a dark environment at 25 ℃ for observation and collection. The samples were collected at 3, 6, 12, and 24 hours, and the termites whose intestines turned blue were collected and stored at -80 ℃.

[0079] A fluorescence quantitative PCR (qRT-PCR) experiment was performed on the gene to test the changes in gene expression under different time and concentration treatments. The fluorescence quantitative primers are as follows (RPS18 and GAPDH are internal reference genes):

[0080] q- GNBP3 F:CACCATTTGACCAACCATTCTAC

[0081] q- GNBP3 R:GAGGCCTGAGGTGATGTATTT

[0082] q- RPS18 F:ATGGCAAACCCCCGTCAGTA

[0083] q- RPS18R:CATACCACGATGCGCACGAA

[0084] q- GAPDH F:TCGTATTGGCCGTCTTGTGC

[0085] q- GAPDH R:AGCGACCATGGGTGGAATCAT;

[0086] The fluorescence quantitative PCR reaction system is as follows:

[0087]

[0088] Reaction procedure:

[0089] 95℃ 30s

[0090] {95℃ 5 s, 60℃ 34 s} 30 rounds

[0091] {95 ℃ 15 s, 60 ℃ 1 min, 95 ℃ 15 s}

[0092] The experiment was designed with 3 biological replicates and 4 technical replicates for each biological replicate. After obtaining the Ct values ​​of the target gene and the reference gene, 2 -ΔΔt Methods The relative expression of target gene mRNA was calculated and the obtained data were analyzed for significant differences using InStat software.

[0093] To detect GNBP3 The expression of the target gene was changed at different sampling intervals after dsRNA feeding. The cDNA samples of the control group and the treatment group were tested by real-time fluorescence quantitative PCR. The results showed that the interference efficiency was 37.43%, 77.69%, 45.37% and 65.63% at 3 h, 6 h, 12 h and 24 h after dsRNA injection, respectively. The sampling interference efficiency was the highest at 6 h, and the relative expression of the target gene was significantly lower than that of the other two groups ( Figure 6 ).

[0094] Because at 6 hours, black-winged termites GNBP3 The interference efficiency is the highest, so we chose 6 h for RNAi treatment.

[0095] (4) Induced expression and extraction of dsRNA.

[0096] Containing L4440-ds GNBP3 and L4440-ds GFPThe recombinant plasmid was expressed by induced dsRNA in HT115 strain, and the total RNA after induced expression was digested with DNaseⅠ and RNase A. The electrophoresis results showed that the bacterial DNA and RNA were degraded, and the target bands were 461 bp and 500 bp, which were consistent with ds GNBP3 and ds GFP The expected size is consistent, and the interference vector is successfully constructed ( Figure 5 ).

[0097] L4440-ds GNBP 3 For example, the sequenced L4440-ds GNBP3 The recombinant plasmid was transformed into HT115 (DE3) competent bacteria and spread on a plate containing ampicillin (50 μg∙mL -1 ) and tetracycline (12.5 μg∙mL -1 ) on LB solid medium with dual antibodies and inverted culture at 37 °C overnight. Pick a single clone and inoculate it in a medium containing ampicillin (50 μg∙mL -1 ) and tetracycline (12.5 μg∙mL -1 ) in LB liquid medium with double antibodies, 37 ℃, 220 r∙min -1 The culture was shaken until the bacterial solution OD 600 When the concentration was about 0.5-0.6, IPTG (final concentration 0.8 mM) was added and the mixture was incubated at 37 °C and 220 r∙min. -1 Continue shaking the culture for 3 h, then use TaKaRa RNAiso Plus to extract dsRNA. Use RNAse H and DNAse I to digest dsRNA. Use Eppendorf Bio Spectrometer basic for quantification to a final concentration of 1 μg / μL. Store in a -80℃ ultra-low temperature freezer for later use.

[0098] Example 4 After RNAi GNBP3 Detection of gene expression.

[0099] First, GNBP 3 The dsRNA was mixed with Nile Blue, and then 800 uL was dripped onto the filter paper at the bottom of a 7 cm culture dish. GNBP3 The control group was ds GFP and 20% Nile Blue aqueous solution. 20 termites were added to each culture dish, and each group was repeated 3 times. The samples were placed in a dark environment at 25 ℃ for observation and collection. The samples were collected at 3, 6, 12, and 24 hours, and the termites whose intestines turned blue were collected and stored at -80 ℃.

[0100] A fluorescence quantitative PCR (qRT-PCR) experiment was performed on the gene to test the changes in gene expression under different time and concentration treatments. The fluorescence quantitative primers are as follows (RPS18 and GAPDH are internal reference genes):

[0101] q- GNBP3 F:CACCATTTGACCAACCATTCTAC

[0102] q- GNBP3 R:GAGGCCTGAGGTGATGTATTT

[0103] q- RPS18 F:ATGGCAAACCCCCGTCAGTA

[0104] q- RPS18 R:CATACCACGATGCGCACGAA

[0105] q- GAPDH F:TCGTATTGGCCGTCTTGTGC

[0106] q- GAPDH R:AGCGACCATGGGTGGAATCAT;

[0107] The fluorescence quantitative PCR reaction system is as follows:

[0108] Reaction procedure:

[0109] 95℃ 30s

[0110] {95℃ 5 s, 60℃ 34 s} 30 rounds

[0111] {95 ℃ 15 s, 60 ℃ 1 min, 95 ℃ 15 s}

[0112] The experiment was designed with 3 biological replicates and 4 technical replicates for each biological replicate. After obtaining the Ct values ​​of the target gene and the reference gene, 2 -ΔΔt Methods The relative expression of target gene mRNA was calculated and the obtained data were analyzed for significant differences using InStat software.

[0113] To detect GNBP3The expression of the target gene was changed at different sampling intervals after dsRNA feeding. The cDNA samples of the control group and the treatment group were tested by real-time fluorescence quantitative PCR. The results showed that the interference efficiency was 37.43%, 77.69%, 45.37% and 65.63% at 3 h, 6 h, 12 h and 24 h after dsRNA injection, respectively. The sampling interference efficiency was the highest at 6 h, and the relative expression of the target gene was significantly lower than that of the other two groups ( Figure 6 ).

[0114] Because at 6 hours, black-winged termites GNBP3 The interference efficiency is the highest, so we chose 6 h for RNAi treatment.

[0115] Example 5 Changes in the sensitivity of Coptotermes marcescens SM1 after RNAi.

[0116] First, dsRNA was mixed with Nile Blue, and then 800 uL was dripped onto the filter paper at the bottom of a 7 cm culture dish. GNBP3 The control group was ds GFP and 20% Nile Blue aqueous solution. GNBP3 The bioassay was started when the expression level was downregulated to the highest level. 20 termites were added to each culture dish, and each group was repeated 3 times. GFP Processing, ds GFP After interference, use SM1 to process, ds GNBP3 Processing and ds GNBP3 After interference, the samples were treated with SM1 and subjected to biological test. The samples were placed in a dark environment at 25°C for observation and data recording.

[0117] Feeding ds to black-winged termites GNBP3 After 6 hours, SM1 infection experiment was carried out. Through bioassay, it was found that the survival rate of black-winged termites after RNAi was significantly reduced compared with that without RNAi. We selected 11, 16, 21, 26, 31, and 36 hours for data analysis and found that at 11 hours, the survival rate of ds treated with SM1 was significantly reduced. GNBP3 The mortality rate of the SM1 treatment group was significantly higher than that of the other treatment groups, reaching 41.6%, and there was no significant difference between the other groups; at 16 h, the mortality rate of the SM1 treatment group was 41.6%. GNBP3 The mortality rate of the group was the highest and significantly different from that of the other treatment groups, reaching 73.3%. GNBP3 The mortality rates of the GFP group treated with SM1 and the ds1 group treated with SM1 were 48.3% and 31.6%, respectively, with no significant difference between the two groups. GNBP3The mortality rate of the group was the highest and significantly different from that of the other treatment groups, reaching 86.7%. GNBP3 The mortality rate of the treatment group was 71.7%, and the difference between the two groups was not significant. The mortality rates of the SM1 treatment group and the SM1 treatment GFP group were 23.3% and 40%, respectively, and the difference between the two treatment groups was not significant. However, all four groups were significantly different from the control group (fermentation liquid group and GFP group), indicating that ds GNBP3 There was also an obvious lethal effect; at 26 h, ds GNBP3 The mortality rate of the group has reached 100%, ds GNBP3 The mortality rate of the treated group was 73.3%, and that of the SM1 treated group was 51.7%. GFP The mortality rate of the group was 53.3%. The results showed that ds GNBP3 treatment group, SM1 treatment group, SM1 treatment group GFP There was no significant difference among the three groups, but they were all significantly different from the control group (fermentation liquid group and GFP group) were significantly different, indicating that ds GNBP3 There was also a significant lethal effect, and the effect was comparable to that of SM1; at 31 h and 36 h, ds GNBP3 treatment group, SM1 treatment group, SM1 treatment group GFP Group, ds treated with SM1 GNBP3 The mortality rates of the two groups were close to or even exceeded 80.0%, and were significantly lower than those of the control groups (fermentation liquid group and GFP We found that ds GNBP3 The best effect was achieved when used together with SM1, with a mortality rate of 100% at 26 hours; ds GNBP3 The effect of using ds alone was not significantly different from that of using SM1 alone. The mortality rate was close to 80% at around 36 h, indicating that ds GNBP3 It can also play a good insecticidal role when used alone as a medicine, with an effect similar to SM1.

[0118] It can also be clearly seen from the survival curve that the ds GNBP3 The survival rate of the group was significantly lower than that of the control group (fermentation liquid group and GFP Group), all termites were dead at 26 h; ds GNBP3 treatment group, SM1 treatment group, SM1 treatment group GFP The survival rate of the group was also significantly lower than that of the control group (fermentation liquid group and GFP group), the survival rate had dropped to about 20.0% at 30 h ( Figure 7 ).

[0119] In summary, this study established a feeding method for the black-winged termite GNBP3RNA interference system, and concluded that feeding had a significant gene silencing effect in black-winged termites. GNBP3 The application of RNAi technology provides technical support. This system successfully interferes with immune recognition proteins GNBP3 Gene expression and found GNBP3 The gene-silenced black-winged termites were significantly more sensitive to the SM1 strain of Serratia marcescens. GNBP 3 When dsRNA and SM1 were used together, the mortality rate of termites was significantly increased, indicating that it can improve the control effect of biocontrol bacteria; it was also found that when used alone GNBP3 dsRNA can also control black-winged termites, and its effect is comparable to that of SM1 alone. GNBP3 The application of dsRNA in termite control provides a theoretical basis. The present invention lays a theoretical foundation for the development of immunosuppressants that are safe for humans and animals, and provides a new theory for biological control of pests, ultimately providing new strategies and new ways of pest control for my country's green agricultural production and sustainable development.

[0120] The present invention provides a control idea and method for black-winged soil termites. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies. Sequence Listing <110> Nanjing Forestry University <120> The GNBP3 gene of Gram-negative bacteria recognition protein of Coptotermes nigrotermes and its application <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1119 <212> DNA <213> GNBP3 Nucleotide Sequence (Artificial Sequence) <400> 1 atgcggtctc ttgcgatatt ggtctgcacg attgcagcag cttcagcgca gtgcgttcaa 60 tccgtcacca ctgcgatcgg tactaaggcc ccagcgacca tatgcagcgg ggatctcatc 120 tttaacgagg aattcaacag tttagatttg tcgacttgga accacgagaa aaccgcgtca 180 ggaggtggta actgggaatt tgaaatctac aacaacaacc gttcgaacag ttttgtgagg 240 gatggaaatc tgttcatcaa accgaccctc acttctgaca tgtacggtga agaattctta 300 gcgaatggtg ttctcaactt gcaaggtgga gccccagctg acgtgtgcac aaatccaaga 360 gactatggct gtgaaagaac ggggtccgct tcaaacctct tgaaccctat aaattctgca 420 cgacttcgaa cagtggagtc ctttagcttc acatacggaa aattggaagt gagagcaaaa 480 ctgccagctg gtgactggat ctggccagca atttggctct tgcctcgctt taattattat 540 ggttcctggc cagcttctgg tgagatagac cttagtgaaa gtcgtggcaa caagcaactg 600 atccaaaatg gaaagaacat tggttctgct ctgtcttctt ctacactgca ttttggcccc 660 ttctggccac tcaatggata tgagcatgcc cactttgaga agacttcaga tacaaatgga 720 tttgacagtg acttcaatcg tttccaacta gaatggactc cagataacat gacgtttagt 780 attaatgata aaattattgg tcaagtaata ccctcagaag gtgggttctg ggagtttggc 840 cagttcaata cacaagttgg aaatgttgac aattcctgga atatggaag caagatggca 900 ccatttgacc aaccattcta catattactt aatgtagctg ctggaggt gatggatat 960 ttccctgatg atgcagaaaa tccaggaggc aaaccatggt taaatacatc acctcaggcc 1020 tcacagact tttggaatgg acgcagtcaa tggctcccta catggaatgg cgatgatgca 1080 gctatgcaag tggactgt taagttttgg gctttataa 1119 <210> 2 <211> 372 <212> PRT <213> GNBP3 is an artificial sequence. <400> 2 Met Arg Ser Leu Wings Leu Val Cys Thr Island Wings Wings Ser Wings 1 5 10 15 Gln Cys Val Gln Ser Val Thr Thr Ala Ile Gly Thr Lys Ala Pro Ala 20 25 30 Thr Ile Cys Ser Gly Asp Leu Ile Phe Asn Glu Glu Phe Asn Ser Leu 35 40 45 Asp Leu Ser Thr Trp Asn His Glu Lys Thr Ala Ser Gly Gly Gly Asn 50 55 60 Trp Glu Phe Glu Ile Tyr Asn Asn Asn Arg Ser Asn Ser Phe Val Arg 65 70 75 80 Asp Gly Asn Leu Phe Ile Lys Pro Thr Leu Thr Ser Asp Met Tyr Gly 85 90 95 Glu Glu Phe Leu Ala Asn Gly Val Leu Asn Leu Gln Gly Gly Ala Pro 100 105 110 Ala Asp Val Cys Thr Asn Pro Arg Asp Tyr Gly Cys Glu Arg Thr Gly 115 120 125 Ser Ala Ser Asn Leu Leu Asn Pro Ile Asn Ser Ala Arg Leu Arg Thr 130 135 140 Val Glu Ser Phe Ser Phe Thr Tyr Gly Lys Leu Glu Val Arg Ala Lys 145 150 155 160 Leu Pro Ala Gly Asp Trp Ile Trp Pro Ala Ile Trp Leu Leu Pro Arg 165 170 175 Phe Asn Tyr Tyr Gly Ser Trp Pro Ala Ser Gly Glu Ile Asp Leu Ser 180 185 190 Glu Ser Arg Gly Asn Lys Gln Leu Ile Gln Asn Gly Lys Asn Ile Gly 195 200 205 Ser Ala Leu Ser Ser Ser Thr Leu His Phe Gly Pro Phe Trp Pro Leu 210 215 220 Asn Gly Tyr Glu His Ala His Phe Glu Lys Thr Ser Asp Thr Asn Gly 225 230 235 240 Phe Asp Ser Asp Phe Asn Arg Phe Gln Leu Glu Trp Thr Pro Asp Asn 245 250 255 Met Thr Phe Ser Ile Asn Asp Lys Ile Ile Gly Gln Val Ile Pro Ser 260 265 270 Glu Gly Gly Phe Trp Glu Phe Gly Gln Phe Asn Thr Gln Val Gly Asn 275 280 285 Val Asp Asn Ser Trp Lys Tyr Gly Ser Lys Met Ala Pro Phe Asp Gln 290 295 300 Pro Phe Tyr Ile Leu Leu Asn Val Ala Ala Gly Gly Val Asn Gly Tyr 305 310 315 320 Phe Pro Asp Asp Ala Glu Asn Pro Gly Gly Lys Pro Trp Leu Asn Thr 325 330 335 Ser Pro Gln Ala Ser Thr Asp Phe Trp Asn Gly Arg Ser Gln Trp Leu 340 345 350 Pro Thr Trp Asn Gly Asp Asp Ala Ala Met Gln Val Asp Tyr Val Lys 355 360 365 Val Trp Ala Leu 370 <210> 3 <211> 23 <212> DNA <213> GNBP3F(Artificial Sequence) <400> 3 tcaaagaaag cgacatgcgg tct 23 <210> 4 <211> 25 <212> DNA <213> GNBP3R(Artificial Sequence) <400> 4 gtcggcagct ttataaagcc caaac 25 <210> 5 <211> 32 <212> DNA <213> dsGNBP3F(Artificial Sequence) <400> 5 atttgcggcc gcctgttcat caaaccgacc ct 32 <210> 6 <211> 31 <212> DNA <213> dsGNBP3R(Artificial Sequence) <400> 6 cccaagcttt ctgaagtctt ctcaaagtgg g 31 <210> 7 <211> 31 <212> DNA <213> dsGFP F(Artificial Sequence) <400> 7 atcggagctc agttgaacgg atccatcttc a 31 <210> 8 <211> 25 <212> DNA <213> dsGFP R(Artificial Sequence) <400> 8 cccaagctta gaacttttca ctgga 25 <210> 9 <211> 23 <212> DNA <213> q-GNBP3 F(Artificial Sequence) <400> 9 caccatttga ccaaccattc tac 23 <210> 10 <211> 21 <212> DNA <213> q-GNBP3 R(Artificial Sequence) <400> 10 gaggcctgag gtgatgtatt t 21 <210> 11 <211> 20 <212> DNA <213> q-RPS18F(Artificial Sequence) <400> 11 atggcaaacc cccgtcagta 20 <210> 12 <211> 20 <212> DNA <213> q-RPS18R(Artificial Sequence) <400> 12 cataccacga tgcgcacgaa 20 <210> 13 <211> 20 <212> DNA <213> q-GAPDHF(Artificial Sequence) <400> 13 tcgtattggc cgtcttgtgc 20 <210> 14 <211> 21 <212> DNA <213> q-GAPDHR(Artificial Sequence) <400> 14 agcgaccatg ggtggaatca t 21

Claims

1. A Gram-negative bacteria recognition protein for controlling black-winged termites GNBP3 dsRNA of a gene, wherein Said GNBP 3 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the dsRNA is GNBP3 The full-length plasmid pClone007- GNBP3 As a template, the upstream primer ds GNBP3 F and downstream primer ds GNBP3 R is amplified by PCR to obtain the target fragment, wherein, Upstream primer ds GNBP3 F is: ATTTGCGGCCGCCTGTTCATCAAACCGACCCT; Downstream primer ds GNBP3 R is: CCCAAGCTTTCTGAAGTCTTCTCAAAGTGGG.

2. A recombinant expression vector, characterized in that: It expresses the dsRNA of claim 1.

3. A host bacterium, characterized in that The recombinant expression vector described in claim 2 is transformed therein.

4. A method for preventing and controlling black-winged termites, characterized in that: The following steps are involved: Feed termites with the dsRNA of claim 1.

5. A method for preventing and controlling black-winged termites, characterized in that: The dsRNA of claim 1 and Serratia marcescens SM1 are co-fed to termites.

Images