SNP markers, KASP detection primers and their applications related to the quantitative traits of wheat pre-harvest sprouting resistance

By developing the SNP marker and KASP detection primers for wheat ear germination main effect QTL QSS.TAF9-3D, the problem of wheat ear germination resistance identification was solved, rapid and accurate genotyping was achieved, and breeding efficiency was improved.

CN115896334BActive Publication Date: 2025-08-01HENAN CROP MOLECULAR BREEDING RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211502263.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-28
Publication Date
2025-08-01
Estimated Expiration
2042-11-28

AI Technical Summary

Technical Problem

The prior art is difficult to effectively identify and utilize quantitative trait sites related to wheat ear germination resistance, resulting in low efficiency of wheat ear germination resistance breeding, affecting wheat yield and quality.

Method used

The main effect QTL QSS.TAF9-3D-related SNP markers and its KASP detection primers were developed. The wheat ear germination resistance genotype was quickly identified through PCR amplification and fluorescence detection typing.

Benefits of technology

It has achieved rapid and accurate division of wheat materials into two haplotypes: ear-resistant germination and ear-sensitive germination, which shortened the breeding cycle and improved the breeding efficiency of wheat ear-germination resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115896334B_ABST
    Figure CN115896334B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biotechnology, and particularly relates to an SNP marker, KASP detection primers related to the quantitative trait locus QSS.TAF9-3D for pre-harvest sprouting resistance in wheat, and their applications. The SNP marker is located at the 20th base of the sequence shown in SEQ ID NO:8 in the major QTL QSS.TAF9-3D for pre-harvest sprouting in wheat, and the base at this position is T / C. The present invention performs amplification analysis on 629 wheat germplasms in Henan, China. The KASP marker results show that the 629 natural populations can be divided into two haplotypes, which are named QSS.TAF9-3D-TT haplotype (resistant to pre-harvest sprouting) and QSS.TAF9-3D-CC haplotype (susceptible to pre-harvest sprouting), indicating that it is applicable in the molecular assisted breeding of wheat for pre-harvest sprouting resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to SNP markers, KASP detection primers related to the quantitative trait locus QSS.TAF9-3D (Quantitative Trait Locus, QTL) for pre-harvest sprouting resistance in wheat, and their applications. Background Art

[0002] Pre-harvest sprouting (PHS) in wheat refers to the phenomenon that grains germinate and sprout on the ear under rainy or humid environmental conditions before harvest, which is a worldwide natural disaster. It is understood that pre-harvest sprouting occurs to varying degrees every year globally, especially in Canada and Australia. In China, the middle and lower reaches of the Yangtze River winter wheat region, the southwestern winter wheat region, and the northeastern spring wheat region are areas where pre-harvest sprouting hazards are frequent and severe. Once pre-harvest sprouting occurs in wheat, the disasters it brings are very serious. On the one hand, the quality of wheat grains is affected, and on the other hand, the storage of wheat and the sowing quality in the next season or the following year are also greatly affected, causing significant economic losses to wheat production. The yield of wheat with pre-harvest sprouting will be greatly reduced. If visible pre-harvest sprouting occurs, the wheat yield may be reduced by about 10%. Pre-harvest sprouting not only reduces wheat yield but also seriously deteriorates wheat quality and seed value, causing serious economic losses. Pre-harvest sprouting causes a series of biochemical reactions inside the grains, increasing the activities of carbohydrate-degrading enzymes, proteolytic enzymes, etc., degrading the storage substances in the embryo and endosperm, and greatly reducing the processing quality of wheat. In the international market, commercial wheat with a germination rate exceeding 5% is designated as feed wheat, and the price is halved.

[0003] The pre-harvest sprouting resistance in wheat is a complex quantitative trait controlled by multiple genes. Currently, 42 QTLs related to pre-harvest sprouting resistance in wheat have been mapped, distributed on 18 chromosomes except 1D, 4D, and 7D, explaining 4.9 - 39.3% of the phenotypic variation. Discovering major QTLs controlling pre-harvest sprouting resistance in wheat and developing corresponding molecular markers are one of the important ways to rapidly improve pre-harvest sprouting resistance in wheat. Summary of the Invention

[0004] The present invention discovers SNP markers related to the pre-harvest sprouting trait in wheat, and proposes KASP primers for detecting the major QTL QSS.TAF9-3D for pre-harvest sprouting resistance in wheat, and the KASP primers are applicable in molecular-assisted breeding for pre-harvest sprouting resistance in wheat.

[0005] The technical solution of the present invention is as follows:

[0006] The present invention discovers that, taking Chinese_Spring1.0 as the reference genome, the base at position 571359493 on wheat chr 3D is T / C, and this locus can be used as an SNP marker related to the pre-harvest sprouting trait of wheat. In order to apply this SNP locus to all wheat germplasm resources, in the present invention, it is indicated that this SNP is located at the 20th base of the sequence shown in SEQ ID NO:8, and SEQ ID NO:8 is:

[0007] ATCAATTATCAGCTCTGGA N GAGAGTGTTTCCCGTCCCGTGTCGAAGCTCGCGCAGC

[0008] CAGCTCGGTCTGTTGCTCGGCCTCGGGCTGTCCTTCCTGCATGAGGAATTATCCATGT

[0009] TAGCTTTGGATGTTGAGGAAATATGGTAAGGTTCAGTAGTCGGGACACAGGTCAAGATTA, where N is T / C.

[0010] The above SNP marker is located in the major QTL for pre-harvest sprouting of wheat, QSS.TAF9-3D. When the genotype at this SNP marker in the wheat gene is TT, the wheat shows resistance to pre-harvest sprouting; when the genotype at this SNP marker in the wheat gene is CC, the wheat shows susceptibility to pre-harvest sprouting.

[0011] The present invention also provides KASP primers for detecting the major QTL for pre-harvest sprouting of wheat, QSS.TAF9-3D. The major QTL for resistance to pre-harvest sprouting, QSS.TAF9-3D, is located on wheat chromosome 3DL;

[0012] The KASP primers are composed of the following sequences:

[0013] Primer F1, as shown in SEQ ID NO:1;

[0014] Primer F2, as shown in SEQ ID NO:2;

[0015] Primer R, as shown in SEQ ID NO:3. Specifically:

[0016] Fl: 5'-GAAGGTCGGAGTCAACGGATTATCAATTATCAGCTCTGGAT-3';

[0017] F2: 5'-GAAGGTGACCAAGTTCATGCTATCAATTATCAGCTCTGGAC-3';

[0018] R: 5'-AATCTTGACCTGTGTCCCGA-3';

[0019] The specific fluorescence sequence HEX (red) is shown as SEQ ID NO:4, and the specific fluorescence sequence FAM (blue) is shown as SEQ ID NO:5. Specifically:

[0020] Specific fluorescence sequence HEX: 5'-GAAGGTCGGAGTCAACGGATT-3';

[0021] FAM: 5'-GAAGGTGACCAAGTTCATGCT-3'.

[0022] The present invention also provides a method for detecting the major QTL haplotype of pre-harvest sprouting in wheat using the above KASP primer pair, comprising the following steps:

[0023] Using the genomic DNA of the wheat to be tested as a template, performing PCR amplification with the above KASP primers, and then judging the genotype type of the sample according to the detected fluorescence color. Red indicates the genotype is TT, and blue indicates the genotype is CC. The wheat materials carrying the genotype TT have significantly better pre-harvest sprouting resistance than the wheat materials carrying the genotype CC. Among them, the amplification product with the genotype TT is named QSS.TAF9-3D-TT, and its sequence is shown as SEQ ID NO:6. The amplification product with the genotype CC is named QSS.TAF9-3D-CC, and its sequence is shown as SEQ ID NO:7. Specifically:

[0024] QSS.TAF9-3D-TT (5'~3'):

[0025] ATCAATTATCAGCTCTGGA T GAGAGTGTTTCCCGTCCCGTGTCGAAGCTCGCGCAGCCAGCTCGGTCTGTTGCTCGGCCTCGGGCTGTCCTTCCTGCATGAGGAATTATCCATGTTAGCTTTGGATGTTGAGGAAATATGGTAAGGTTCAGTAGTCGGGACACAGGTCAAGATTA.

[0026] QSS.TAF9-3D-CC (5'~3'):

[0027] ATCAATTATCAGCTCTGGA CGAGAGTGTTTCCCGTCCCGTGTCGAAGCTCGCGCAGCCAGCTCGGTCTGTTGCTCGGCCTCGGGCTGTCCTTCCTGCATGAGGAATTATCCATGTTAGCTTTGGATGTTGAGGAAATATGGTAAGGTTCAGTAGTCGGGACACAGGTCAAGATTA。

[0028] The present invention also provides a kit for identifying the major QTL haplotypes for pre-harvest sprouting of wheat as described above, and the kit contains the KASP primers as described above.

[0029] The above-mentioned KASP primers can be applied in the molecular assisted breeding of wheat resistance to pre-harvest sprouting to shorten the breeding cycle of materials resistant to pre-harvest sprouting.

[0030] The beneficial effects of the present invention are as follows:

[0031] The present invention amplified and analyzed 629 wheat germplasms in Henan, China. The amplification results of the KASP primers showed that the 629 natural populations could be divided into two haplotypes, which were named QSS.TAF9-3D-TT haplotype (resistant to pre-harvest sprouting) and QSS.TAF9-3D-CC haplotype (sensitive to pre-harvest sprouting), respectively. There were 263 individuals with the QSS.TAF9-3D-TT haplotype and 366 individuals with the QSS.TAF9-3D-CC haplotype in the 629 natural populations. Further analysis showed that the results were completely consistent with the SNP bases corresponding to the AX-95124645 locus obtained by scanning the 629 natural populations with a 660K chip. By performing T-A cloning and sequencing on the amplification products of Zhoumai 18 and Shengsimai, the sequence alignment results showed that there was only a T / C allelic variation at the 20bp position of the amplification products. By aligning in the EnsemblPlants database (http: / / plants.ensembl.org / index.html), it was found that the physical positions of this allelic variation and the allelic variation at the AX-95124645 locus of the 660K chip were completely consistent. In summary, it was verified that the KASP primers could completely distinguish the two haplotypes of QSS.TAF9-3D-TT and QSS.TAF9-3D-CC in the materials, indicating that the KASP primers are applicable in the molecular assisted breeding of wheat resistance to pre-harvest sprouting. Description of the Drawings

[0032] Figure 1 It is an analysis diagram of KASP marker amplification for 629 wheat germplasms in Henan, China. Red represents the varieties (lines) with the pre-harvest sprouting resistant haplotype QSS.TAF9-3D-TT, and blue represents the varieties (lines) with the pre-harvest sprouting sensitive haplotype QSS.TAF9-3D-CC.

[0033] Figure 2 Alignment map of the sequences of the amplification products of Zhoumai 18 and Sheng Simai in the EnsemblPlants database (http: / / plants.ensembl.org / index.html).

[0034] Figure 3 Manhattan plots of genome-wide association analysis of pre-harvest sprouting resistance in the core wheat germplasm resources of Henan Province in (a) 2021, (b) 2022, and (c) BLUP value environments. The abscissa 1-7 represents 1A-7A, 8-14 represents 1B-7B, and 15-21 represents 1D-7D. The horizontal dashed line indicates the significant threshold LOD = 3 in the association analysis results, and QSS.TAF9-3D is the new major QTL discovered in the present invention.

[0035] Figure 4 Haplotype analysis map of QSS.TAF9-3D. Detailed implementation manners

[0036] The present invention will be described in more detail below through specific implementation manners for the convenience of understanding the technical solution of the present invention, but it is not used to limit the protection scope of the present invention.

[0037] Term explanation: KASP primers are specific primers designed according to the differences in single bases in the gene sequence. Usually, the polymorphic nucleotide sites are designed at the 3' end of the primer, and the FAM sequence tag and HEX sequence tag that can emit different colors after binding with the universal fluorescent primer are designed at the 5' end of the primer. Based on the principle of ASPCR, the universal fluorescent primer is used for amplification, and the polymorphism of a single nucleotide is judged according to the color of the detected signal.

[0038] I. Identification of the major QTL QSS.TAF9-3D for pre-harvest sprouting in wheat

[0039] To rapidly identify a batch of novel wheat spike sprout resistance genes and germplasm resources, the wheat 660K array (Du, X., Xu, W., Peng, C., Li, C., and Zhang, Y., et al. (2021). Identification and validation of a novel locus, Qpm-3BL, for adult plant resistance to powdery mildew in wheat using multilocus GWAS. BMC Plant Biology 21.doi:10.1186 / s12870-021-03093-4) scanned and screened 629 natural populations of wheat germplasm in Henan Province, consisting of 362 wheat farm varieties and 267 local varieties (the 629 wheat germplasms in Henan Province were provided by the Molecular Breeding Laboratory of Henan Institute of Crop Molecular Breeding, and the public can obtain them from the Molecular Breeding Laboratory of Henan Institute of Crop Molecular Breeding). High-quality genotyping results of 314,548 SNP markers were obtained, and then linkage disequilibrium analysis was performed. Combined with the field wheat spike sprouting resistance phenotypic data from 2021 to 2022, a multi-locus whole-genome association analysis was performed.

[0040] Table 1 List of 629 core wheat germplasms in Henan Province

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047] SNPAX-95124645 was detected a total of eight times by five association analysis methods in two years of field conditions and was also reproducibly detected in their respective BLUP values. Linkage disequilibrium analysis determined that the attenuation distance of 629 natural populations was 2192 Kb. Therefore, the 2192 Kb region upstream and downstream of the physical location corresponding to this marker was identified as a major quantitative trait locus associated with ear sprouting resistance, designated QSS.TAF9-3D (chr3D: 569.17 Mb to 573.55 Mb). Haplotype analysis was performed in the QSS.TAF9-3D region using Haploview software ( Figure 4) The results showed that there was a haplotype block, Block1, in this region. Among the 5 SNP loci included in Block1, the AX-95124645 locus could be stably detected by 6 methods in 2 environments, and the maximum value of the effect value was greater than 30. Therefore, the AX-95124645 locus (chr3D:571359493,T / C) was used as the SNP locus to identify the haplotype of the QSS.TAF9-3D research material.

[0048] II. Screening of candidate genes in the chromosomal region where the major QTL QSS.TAF9-3D for pre-harvest sprouting in wheat is located

[0049] According to the annotation information of Chinese Spring version 1.0 (http: / / 202.194.139.32 / jbrowse-1.12.3-release / ?data=Chinese_Spring1.0), a total of 61 candidate genes were found. Based on the differentially expressed genes screened from the transcriptome sequencing results of the ears of Sheng Simai (resistant to pre-harvest sprouting) and Zhoumai 18 (susceptible to pre-harvest sprouting) at the dough stage treated for 0 h, 48 h, and 96 h respectively, combined with 66 candidate genes from the genome-wide association analysis, it was found that the expression levels of the candidate genes TraesCS3D01G466100.1 and TraesCS3D01G468500.1 in Sheng Simai were significantly different from those in Zhoumai 18 after 96 h of treatment, and the expression level of TraesCS3D01G468500.1 in Sheng Simai was much higher than that in Zhoumai 18 at all three treatment times. The above genes were each subjected to sequence alignment and conserved domain analysis on the NCBI (https: / / blast.ncbi.nlm.nih.gov / ) website. The sequence alignment results showed that the functions of the above 2 candidate genes had not been further studied in wheat. The conserved domain analysis showed that TraesCS3D01G466100.1 encoded a RING-type E3 ubiquitin ligase. In recent years, a large number of studies have shown that RING-type E3 is more widely involved in abiotic stress processes. In the phenotypic identification experiment of this example, the humid environment induced the expression of this gene, especially the expression level in the pre-harvest sprouting-resistant material was much higher than that in the pre-harvest sprouting-susceptible material; the TraesCS3D01G468500.1 gene encoded the initiation transcription factor TAF9, which has been proven to be involved in regulating the grain development process in Arabidopsis thaliana.

[0050] In summary, the differentially expressed genes between the pre-harvest sprouting-resistant material and the pre-harvest sprouting-susceptible material in the QSS.TAF9-3D interval are all related to the resistance of wheat to pre-harvest sprouting and are the major QTLs regulating wheat pre-harvest sprouting.

[0051] Table 2 Analysis of differentially expressed genes in the QSS.TAF9-3D interval of Sheng Simai (resistant to pre-harvest sprouting) and Zhoumai 18 (susceptible to pre-harvest sprouting) by transcriptome sequencing

[0052]

[0053] III. Genotyping of KASP Markers in a Natural Population of 629 Wheat Germplasms in Henan Province

[0054] 1. Primer Design and Synthesis

[0055] Based on the physical position information of SNP AX-95124645, referring to the Chinese Spring sequence information on the wheat whole-genome website (http: / / 202.194.139.32 / jbrowse-1.12.3-release / ?data=Chinese_Spring1.0), forward and reverse primers for KASP molecular markers were designed at 20 bp upstream and 200 bp downstream of the SNP locus, synthesized by Sangon Biotech (Shanghai) Co., Ltd. The length of the PCR product is approximately 180 bp, and 629 natural populations were subjected to PCR amplification and analysis using KASP 2×Master Mix (LGC Science Ltd.). The sequences are as follows:

[0056] Forward primer:

[0057] Fl: 5'-GAAGGTCGGAGTCAACGGATTATCAATTATCAGCTCTGGAT-3';

[0058] Forward primer:

[0059] F2: 5'-GAAGGTGACCAAGTTCATGCTATCAATTATCAGCTCTGGAC-3';

[0060] Reverse primer:

[0061] R: 5'-AATCTTGACCTGTGTCCCGA-3';

[0062] Specific fluorescence sequence HEX: 5'-GAAGGTCGGAGTCAACGGATT-3';

[0063] Specific fluorescence sequence FAM: 5'-GAAGGTGACCAAGTTCATGCT-3'.

[0064] 2. Reaction System

[0065] DNA (50 - 80 ng / ul), 2×KASP Master mix, KASP Assay mix (a mixture of three primers, Forward primer - F1, Forward primer - F2, Reverse primer - R at 100 uM and sterile water in a volume ratio of 12:12:30:46). Reaction system:

[0066] —— 384-well PCR plate (uL / well) Wheat genomic DNA 2.5 2×KASP Master mix 2.5 KASP Assay mix 0.07 Total reaction system 5

[0067] Reaction procedure:

[0068]

[0069] The above reaction system and reaction procedure were used to genotype 629 natural populations of wheat germplasms in Henan Province, and the results are shown in Table 3.

[0070] Table 3 Genotyping of KASP markers in 629 natural populations of wheat germplasms in Henan Province

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078] The method for identifying pre-harvest sprouting of the above wheat germplasm was carried out with reference to the "Agricultural Industry Standard of the People's Republic of China" NY / T 1939-2009 (hereinafter referred to as the "Standard"). The identification method of the whole spike sprouting rate (Spike Sprouting, SS): Select 20 representative main stem spikes of plants at the wheat dough stage, cut them at 15 cm - 20 cm below the ear neck, and store them in a -20°C refrigerator for later use. Randomly divide the 20 cut whole spikes into two groups, with 10 spikes in each group. Soak them in tap water for 4 h, then disinfect them with 0.1% sodium hypochlorite solution (V / V) for 5 min, and then culture them in an artificial climate chamber (temperature 22°C, relative humidity 100%) for 96 h. Immediately shell the grains by hand, and take the rupture of the epidermal part of the grain embryo as the germination standard. Count the total number of grains and the number of germinated grains of each whole spike in each group respectively, and then calculate the average spike sprouting rate. According to the standard in Table 4, determine its resistance to pre-harvest sprouting and grade according to the relative germination index (I) of the test sample. Substitute high resistance, resistance, medium resistance, susceptibility, and high susceptibility with the numbers 1, 2, 3, 4, and 5 respectively for correlation analysis.

[0079] Table 4 Evaluation criteria for wheat resistance to pre-harvest sprouting

[0080] Resistance to pre-harvest sprouting Relative germination index (I) Grade (level) Highly resistant (HR) <0.05 1 Resistant (R) 0.05~0.20 2 Moderately resistant (MR) 0.21~0.40 3 Susceptible (S) 0.41~0.60 4 Highly susceptible (HS) >0.60 5

[0081] The genotyping results showed that among the 629 varieties, 263 contained the QSS.TAF9-3D-TT haplotype and 366 contained the QSS.TAF9-3D-CC haplotype. The phenotypic variation interpretation rates of the QSS.TAF9-3D-TT / CC molecular marker for pre-harvest sprouting in 2021 and 2022 were 36.390 and 45.850 respectively; according to the phenotypic data in 2021 and 2022, there were 243 and 248 pre-harvest sprouting-resistant materials respectively, accounting for 93% and 94% respectively, indicating that the KASP marker is applicable in molecular-assisted breeding for wheat resistance to pre-harvest sprouting.

[0082] The above-described embodiments are only the preferred embodiments of the present invention and do not limit the scope of implementation of the present invention. Therefore, any equivalent changes or modifications made according to the structure, characteristics, and principles described in the scope of the present invention patent should be included in the scope of the patent application of the present invention.

Claims

1. KASP primers for detecting SNP markers associated with quantitative trait loci for pre-harvest sprouting resistance in wheat, characterized in that, The SNP marker is located at the 20th base of the sequence shown in SEQ ID NO:8 within the major QTL QSS.TAF9-3D for pre-harvest sprouting in wheat, and SEQ ID NO:8 is: ATCAATTATCAGCTCTGGA N GAGAGTGTTTCCCGTCCCGTGTCGAAGCTCGCGCAGCCAGCTCGGTCTGTTGCTCGGCCTCGGGCTGTCCTTCCTGCATGAGGAATTATCCATGTTAGCTTTGGATGTTGAGGAAATATGGTAAGGTTCAGTAGTCGGGACACAGGTCAAGATTA, where the base at position N is T or C; The KASP primers are as follows: Fl: 5' - GAAGGTCGGAGTCAACGGATT ATCAATTATCAGCTCTGGAT-3'; F2: 5' - GAAGGTGACCAAGTTCATGCT ATCAATTATCAGCTCTGGAC-3'; R: 5' - AATCTTGACCTGTGTCCCGA - 3'; Specific fluorescence sequence HEX: 5' - GAAGGTCGGAGTCAACGGATT - 3'; FAM: 5'- GAAGGTGACCAAGTTCATGCT -3'.

2. Kit for detecting SNP markers related to quantitative trait of wheat pre-harvest sprouting resistance, characterized in that, Containing the KASP primers described in claim 1.

3. Use of the KASP primers described in claim 1 or the kit described in claim 2 in the identification of wheat pre-harvest sprouting resistance.

4. The application according to claim 3, characterized in that, When the genotype at the SNP marker in the wheat gene is TT, the wheat shows resistance to pre-harvest sprouting, and when the genotype at the SNP marker in the wheat gene is CC, the wheat shows susceptibility to pre-harvest sprouting.

5. Use of the KASP primers described in claim 1 or the kit described in claim 2 in molecular assisted breeding for wheat pre-harvest sprouting resistance.

6. A method for detecting the haplotype of the major QTL for pre-harvest sprouting in wheat, characterized in that, Comprising the following steps: Using the genomic DNA of the wheat to be tested as a template, performing PCR amplification with the KASP primers described in claim 1, and then judging the genotype type of the sample according to the detected fluorescence color, where red indicates the genotype is TT and blue indicates the genotype is CC.

7. The method according to claim 6, wherein The wheat material carrying the genotype TT has better pre-harvest sprouting resistance than the wheat material carrying the genotype CC.