Application of Nrf2 in the preparation of therapeutic systems for treating neurological diseases caused by tRNA synthetase deficiency

Abstract

This invention relates to the field of therapeutic drugs and systems for nervous system diseases, specifically to the application of Nrf2 in the preparation of therapeutic systems for treating nervous system diseases caused by tRNA synthetase deficiency. Through research on tRNA synthetase-deficient mutants, we discovered that tRNA synthetase deficiency causes a reduction in the size of the mesencephalon in zebrafish, resulting in symptoms of cerebellar hypoplasia and cerebral atrophy. In-depth research on the Perk signaling pathway involved in the above process revealed that the nfe2l2b gene and the Nrf2 protein are key factors regulating neural development, and their downstream target gene is p53. The inventors further applied the nfe2l2 gene to the preparation of therapeutic systems for treating nervous system diseases and to related drug screening, solving the technical problem of the lack of effective treatments for nervous system diseases caused by tRNA synthetase deficiency in the prior art, and possessing ideal value for widespread application.

Description

Technical Field

[0001] This invention relates to the field of drugs and systems for treating nervous system diseases, specifically to the application of Nrf2 in the preparation of therapeutic systems for treating nervous system diseases caused by tRNA synthetase deficiency. Background Technology

[0002] tRNA synthase deficiency can affect the normal folding of proteins, thereby causing neurological diseases and embryonic nervous system development disorders. For example, glutamine tRNA synthase deficiency caused by abnormalities in key genes can cause a pentad of clinical symptoms, including microcephaly, cerebral atrophy, early-onset refractory epileptic encephalopathy, global developmental delay, and severe hypotonia (QARS1 gene-related glutamine tRNA synthase deficiency syndrome: three cases and literature review, Shen Yanwen et al., Chinese Journal of Pediatrics, 2020, 58(12):1006-1012.DOI:10.3760 / cma.j.cn112140-20200603-00571). Mitochondrial arginyl-tRNA synthetase (RARS2) gene mutations can lead to early-onset epileptic encephalopathy, most of which are drug-resistant epilepsy, accompanied by developmental delay, microcephaly, and elevated lactate levels. Cranial magnetic resonance imaging suggests progressive atrophy of the cerebrum or pons-cerebellum (Two cases of early-onset epileptic encephalopathy caused by mitochondrial arginyl-tRNA synthetase gene defects and literature review, Jiang Huafang et al., Chinese Journal of Pediatrics, 2020, 58(11), 893-899; DOI:10.3760 / cma.j.cn112140-20200716-00729). In the current technology, the treatment of microcephaly is mainly surgical. Microcephaly mainly refers to the fact that the head circumference of a child at birth is significantly smaller than that of a normal child of the same age, and the cranial sutures are completely closed or about to close, affecting the normal development of brain tissue. The purpose of surgery is to expand the skull, relieve the increase in intracranial pressure, and allow the compressed brain tissue and cranial nerves to grow and develop normally. However, the above-mentioned methods cannot fundamentally solve the problem of abnormal brain development. There is no effective way to treat neurological diseases caused by tRNA synthetase deficiency in the current technology. It is urgent to conduct in-depth research on the pathogenic mechanism and find an effective means to treat neurological diseases caused by tRNA synthetase deficiency by intervening in related genes. Summary of the Invention

[0003] The present invention aims to provide the application of the nfe2l2 gene in the preparation of a therapeutic system for treating neurological diseases caused by tRNA synthetase deficiency, in order to solve the technical problem that there is no effective means of treating neurological diseases caused by tRNA synthetase deficiency in the prior art.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] Application of the nfe2l2 gene in the preparation of therapeutic systems for treating neurological diseases caused by tRNA synthetase deficiency

[0006] This protocol also provides the application of the nfe2l2 gene in screening drugs for the treatment of neurological diseases caused by tRNA synthetase deficiency.

[0007] This protocol also provides the application of Nrf2 protein as a reagent for regulating p53 gene expression.

[0008] The principles and advantages of this scheme are:

[0009] In this technical solution, the inventors obtained ENU through a method of mutagenesis of ethylnitrosourea (ENU). - / - The mutant was identified, and through gene linkage analysis and other methods, it was found that the mutant specifically involved a mutation in the aars1 gene. The aars1 gene encodes an aminoacyl-tRNA synthetase (ALA-tRNA synthetase), ENU. - / - The mutant is aars1 ENU- / - Mutant. This mutant showed poorer activity in zebrafish juveniles compared to the wild type. Figure 2 Increased apoptosis of neural progenitor cells (NPCs) Figure 4 The midbrain volume decreased (midbrain volume measurement data of 3dpf juvenile fish in Example 1), and the expression levels of some genes related to neural development decreased. Figure 1 To further confirm the role of the aars1 gene, the inventors used the CRISPR / Cas9 system to knock out the aars1 gene, obtaining aars1. CRISPR- / - Mutant. Same as aars1 ENU- / - Like the mutant, aars1 CRISPR- / - The mutant's midbrain atrophies, and apoptotic signals are enhanced. Figure 8 The above study demonstrates that the deletion of the aars1 gene leads to neurological disorders such as cerebellar hypoplasia or brain atrophy caused by tRNA synthetase deficiency, and the disease model has been successfully constructed.

[0010] In the aforementioned disease model, the inventors discovered that the Perk signaling pathway plays a crucial role in the development of aars1. ENU- / -In the case of aars1 gene mutants, activation was observed, leading to apoptosis of neural progenitor cells. Subsequently, the inventors studied 293T cells and found that the NRF2 protein is associated with Perk signaling pathway-mediated apoptosis, thus linking tRNA synthetase deficiency to the NRF2 protein. The transcription factor NRF2 is a protein encoded by the nfe2l2 gene (nuclear factor erythroid-derived 2-like 2), and current research reports its main functions include antioxidant activity.

[0011] To further investigate the relationship between NRF2 protein and neurological diseases caused by tRNA synthetase defects such as microcephaly or cerebral atrophy, the inventors continued their research in zebrafish. Paralogous genes of the human NRF2 protein in zebrafish include the nfe2l2a and nfe2l2b genes. The nfe2l2b gene is a newly discovered paralogous gene, previously unreported in the literature. Experimental results showed that in aars1... ENU- / - The expression level of the nfe2l2b gene was significantly increased in the mutant. Figure 14 This suggests that the expression level of the nfe2l2b gene may be related to aars1. ENU- / - Apoptosis is associated with mutants. The nfe2l2b gene was knocked out using the CRISPR / Cas9 system to obtain nfe2l2b. CRISPR- / - Mutant. nfe2l2b CRISPR- / - The mutant can survive to adulthood and is not significantly different in appearance from the other two. Figure 16 This indicates that reducing (or even eliminating) the amount of active protein in the nfe2l2b gene does not produce significant side effects on the organism, providing a reference for subsequent use of nfe2l2b gene inhibitors or other methods to inhibit the expression of this gene. Regarding apoptosis, knocking out the nfe2l2b gene reduces apoptosis signaling (…). Figure 16 Especially in aars1 ENU- / - nfe2l2b CRISPR- / - In the double mutant, the apoptosis signaling (TUNEL) + Significantly lower than aars1 ENU- / - Mutant. In terms of midbrain size ( Figure 17 Knockout of the nfe2l2b gene can increase the size of the midbrain, demonstrating the potential of the nfe2l2b gene to improve neurological diseases caused by tRNA synthetase defects, such as cerebellar atrophy or brain atrophy.

[0012] In addition to the above research, the inventors also studied the downstream targets of the nfe2l2b gene-encoded protein, finding that the p53 gene is the direct target of the nfe2l2b gene-encoded protein. This protein can bind to the promoter region of the p53 gene, thereby regulating the expression of the p53 gene. Figure 20 ). In nfe2l2b CRISPR- / - In the mutant, the expression level of the p53 gene was decreased, while in zebrafish injected with exogenous nfe2l2b mRNA, the expression level of the p53 gene was increased. Figure 21 Therefore, the protein encoded by the nfe2l2b gene (i.e., NRF2 protein) or nfe2l2b mRNA can serve as a regulatory substance for the p53 gene to control the apoptosis process involved by the p53 gene. In addition, the transcriptional activation of the p53 gene by Nrf2 protein or nfe2l2b mRNA can be used to regulate p53 gene expression, thereby enabling research on the role of the p53 gene in neuronal apoptosis and other pathways.

[0013] In addition to alanyl-tRNA synthetase deficiency, the inventors also obtained an animal model of threonyl-tRNA synthetases using ENU mutagenesis and confirmed the association between the nfe2l2b gene and diseases caused by threonyl-tRNA synthetase deficiency. Therefore, Nrf2 can be used to prepare therapeutic systems for treating neurological diseases caused by aminoacyl-tRNA synthetase deficiency.

[0014] Furthermore, the tRNA synthetase deficiency includes aminoacyl-tRNA synthetase deficiency. Aminoacyl-tRNA synthetase deficiency can cause symptoms of microcephaly or brain atrophy.

[0015] Furthermore, the aminoacyl-tRNA synthetase deficiency includes alanyl-tRNA synthetase deficiency and threonyl-tRNA synthetase deficiency. Specifically, this protocol conducted experiments in both alanyl-tRNA synthetase deficiency and threonyl-tRNA synthetase deficiency models, demonstrating that the Nrf2 gene plays a crucial role in neurological diseases caused by tRNA synthetase deficiency.

[0016] Furthermore, the treatment system is used to reduce the activity of Nrf2 protein, or reduce the expression level of Nrf2 protein, or reduce the transcription level of the nfe2l2 gene, or knock out the nfe2l2 gene. All of these methods can inhibit the Perk-Nrf2-P53 signaling pathway, thereby preventing apoptosis of neural progenitor cells and alleviating neurological diseases caused by tRNA synthetase deficiency.

[0017] Furthermore, the treatment system is a CRISPR / Cas9 system for knocking out the nfe2l2 gene. This technical solution utilizes the CRISPR / Cas9 system to perform the nfe2l2 gene knockout operation. This system is mature and has high efficiency and ease of operation. Downregulating the expression level of the nfe2l2b gene and its protein expression level or inhibiting its protein activity in vivo can regulate the apoptosis and memory neurogenesis of neural progenitor cells, thereby alleviating neurological functional disorders caused by tRNA synthetase deficiency, especially cerebellar syndrome and cerebral atrophy. In this embodiment, the nfe2l2b gene is knocked out using CRISPR / Cas9, achieving inhibition of neuronal apoptosis and thus achieving the therapeutic goal. Gene knockout using the CRISPR / Cas9 system is a relatively extreme approach (complete gene inactivation) used to study the role of the nfe2l2b gene in neurological functional disorders caused by tRNA synthetase deficiency. The above method verifies that the nfe2l2b gene is a therapeutic target and can be applied to the preparation of drugs for neurological functional disorders caused by tRNA synthetase deficiency. In practice, we can use any means that can downregulate the expression level of the nfe2l2b gene in vivo (e.g., RNA interference technology) and its protein expression level or inhibit its protein activity (e.g., using nfe2l2b protein inhibitors).

[0018] Furthermore, the target sequence of the gRNA in the CRISPR / Cas9 system is 5'-TGGATGTCTCCGGCAGAGGG-3'. This target sequence is located on exon 2 of the nfe2l2b gene, enabling effective knockout of the target gene.

[0019] Furthermore, the neurological disorders include cerebellar syndrome and brain atrophy.

[0020] By analyzing aars1 ENU- / - mutants and aars1 CRISPR- / - mutants and tars1 ENU- / - Our research on mutants revealed that tRNA synthetase deficiency causes a reduction in the size of the mesencephaly in zebrafish, leading to symptoms of cerebellar hypoplasia and brain atrophy. Our approach, by controlling the Nrf2 gene, alleviated and treated these symptoms. Therefore, the Nrf2 gene can be used to develop therapeutic systems for treating neurological diseases caused by tRNA synthetase deficiency, and its role as a key factor in disease development can be utilized for drug screening.

[0021] Furthermore, the drug is used to reduce the activity of Nrf2 protein, or reduce the expression level of Nrf2 protein, or reduce the transcription level of the nfe2l2 gene, or knock out the nfe2l2 gene. This study has identified Nrf2 protein and the nfe2l2 gene as drug targets for the treatment of microcephaly or cerebral atrophy. The above methods can all inhibit the Perk-Nrf2-P53 signaling pathway, thereby preventing apoptosis of neural progenitor cells and alleviating neurological diseases caused by tRNA synthetase deficiency. Attached Figure Description

[0022] Figure 1 WISH and fluorescence images of the brain of a 3dpf juvenile fish (embryo) from Example 1 (scale bar 20 μm).

[0023] Figure 2 The movement trajectory of the juvenile fish with a 3dpf in Example 1.

[0024] Figure 3 TUNEL and Sox2 immunofluorescence images of the midbrain of 3dpf juvenile fish from Example 1 (scale bar 20 μm).

[0025] Figure 4 Caspase-3 in the midbrain of 3 dpf juvenile fish from Example 1 + Fluorescence image of the signal, statistical graph, and schematic diagram (scale bar 20 μm).

[0026] Figure 5 ENU for confirmation of Example 1 - / - A schematic diagram illustrating the location of the mutant gene in a mutant.

[0027] Figure 6 This is a schematic diagram of the gene mutation sites of the two aars1 gene mutants in Example 1 (the gray text box on the left shows the mutant formed by a 10bp deletion of bases in exon 4 of the gene through CRISPR; the gray text box on the right shows the mutant formed by a T to A point mutation in exon 5 of the gene obtained by ENU; both mutants will cause premature termination of translation of Aars1 protein, forming a non-functional truncated protein).

[0028] Figure 7 The results of the Western blot (WB) experiment of Aars1 protein in Example 1 and the fluorescence image of Sox2 in the midbrain (scale bar 20 μm).

[0029] Figure 8 The fluorescence and WISH images (scale bar 20 μm) of Sox2, GFP and neurod1 in Example 1 are shown.

[0030] Figure 9The fluorescence images of AO and Annexin V in Example 1 are shown (scale bar 20 μm).

[0031] Figure 10 The results of signaling pathway studies in the tRNA synthase-deficient animal model of Example 2 are shown (scale bar 20 μm).

[0032] Figure 11 Annexin V in 293T cells after drug treatment in Example 3 + Signal detection results and statistical charts.

[0033] Figure 12 The images are WB images of p-PERK and NRF2 from Example 3.

[0034] Figure 13 Fluorescence images of NRF2 and p-NRF2 from Example 3, Annexin V + Signal statistics graph and AO + Fluorescence image of the signal (scale bar 20 μm).

[0035] Figure 14 The image shows the fluorescence image of the nfe2l2b gene transcript in the midbrain of zebrafish in Example 3, along with a fluorescence intensity graph (scale bar 20 μm).

[0036] Figure 15 The image shown is a WISH image (scale bar 20 μm) of zebrafish nfe2l2b from Example 3.

[0037] Figure 16 Examples include wild-type zebrafish midbrain AO+ signal images, three types of 5-month-old zebrafish appearance photographs, and four types of zebrafish 3dpf TUNEL images. + Signal image (scale bar 20μm).

[0038] Figure 17 This is a statistical graph of the brain area at 3dpf in four types of zebrafish in Example 3.

[0039] Figure 18 Immunofluorescence images of Sox2 in the four zebrafish species of Example 3, and WISH images of neurod1 and olig2 (scale bar 20 μm).

[0040] Figure 19 This is a schematic diagram of the gene mutation sites of the nfe2l2b gene mutant in Example 3.

[0041] Figure 20 The diagram shows the promoter region structure of the p53 gene in Example 4, a schematic diagram of the ChIP experimental design, a ChIP-PCR experimental result diagram, and the luciferase activity test result.

[0042] Figure 21 Images showing the WISH detection results of p53 signal in the zebrafish brain and embryo in Example 4 (scale bar 20 μm).

[0043] Figure 22 The images show the fluorescent immunoassays of the nfe2l2b and p53 transcripts from Example 4, as well as the TUNEL assay results after injection of nfe2l2b mRNA (scale bar 20 μm).

[0044] Figure 23 The image shows an immunofluorescence image of p53 in the midbrain of a zebrafish from Example 4 (scale bar 20 μm).

[0045] Figure 24 This is a WISH image of p53 in the brain of a zebrafish from Example 4 (scale bar 20 μm).

[0046] Figure 25 Zebrafish midbrain AO (Analogous Oxygen Spectrostomy) as described in Example 4 + Signal image (scale bar 20μm).

[0047] Figure 26 Survival curve analysis for Example 4 and WISH images of nfe2l2b in the zebrafish brain (scale bar 20 μm).

[0048] Figure 27 tars1 for Example 4 ENU- / - Phenotypic results of mutants (scale bar: B: 1000 μm; C, D: 20 μm).

[0049] Figure 28 tars1 for Example 4 ENU- / - Results of quantitative PCR experiments on mutant-related genes.

[0050] Figure 29 WISH images of nfe2l2b and p53 in the zebrafish brain of Example 4, and AO + Signal statistics graph.

[0051] Figure 30 This is a schematic diagram of the overall mechanism of action of Nrf2 in Example 4.

[0052] Figure 31 This is a schematic diagram illustrating the principle of Morpholinos (MOs) technology in the prior art. Detailed Implementation

[0053] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the technical means used in the following embodiments and experimental examples are conventional means well known to those skilled in the art, and the materials and reagents used can all be obtained commercially.

[0054] Example 1: Animal model of tRNA synthetase deficiency (aars1) ENU- / - mutant (i.e., ENU) - / - (mutant) and aars1 CRISPR- / - (mutant)

[0055] The Aars1 gene encodes alanyl-tRNA synthetase (AlaRS), which catalyzes the aminoacylation of alanine amino groups with their corresponding tRNAs. To investigate the effects of AlaRS on neural development, this technique employed ENU mutagenesis to construct an animal model of tRNA synthetase deficiency. The zebrafish (Danio rerio) strains used in this technical solution include the wild-type zebrafish AB strain (CZ1, China Zebrafish Resource Center); the tars1ENU- / - mutant is a mutant constructed using existing technology (Cao et al., 2016); and the existing known strains are Tg(HuC:GFP) (ZDB-TGCONSTRCT-070117-150), Tg(sox2:GFP), Tg(neurod1:EGFP) (ZDB-TGCONSTRCT-080701-1), Tg(olig2:DsRed2) (ZDB-TGCONSTRCT-080321-1), Tg(coro1a:DsRed) (ZDB-TGCONSTRCT-191024-4), and Tg(HuC:GCaMP6s) (Park et al., 2000; Shin et al., 2014; Lu et al., 2019; Kim et al.). (Li et al., 2008; Li et al., 2012; Kim et al., 2017); Zebrafish transgenic lines were constructed using conventional methods of existing technology: Tg(NBT:DenNTR), Tg(NBT:aars1), Tg(hsp70:p53); Zebrafish mutant lines were constructed using existing ENU mutagenesis and CRISPR / Cas9 technology, with aars1 being the most readily available. ENU- / - mutant, aars1 CRISPR- / - mutant, nfe2l2b CRISPR- / -Mutant. The animals were raised in accordance with existing zebrafish rearing standards: a water temperature of 28.5℃, and 14 hours of light and 10 hours of darkness per day, in a cycle.

[0056] Both ENU mutagenesis and in situ cloning are standard techniques in existing technologies, as detailed in existing literature (Trevarrow, B., 2011. Techniques for optimizing the creation of mutations inzebrafish using 1019N-ethyl-N-nitrosourea. Lab Animal 40, 353-361.). To investigate the molecular mechanisms in nervous system development, large-scale screening of ENU-mutated mutants was conducted, and the ENU-mutated mutants (ENU...) were further analyzed. - / - The phenotype of the mutant was characterized. Figure 1 For 3dpf (3 days after fertilization) juvenile fish (embryos, including ENU) - / - Brain WISH (whole-mount in-situ RNA hybridization) and fluorescence images of mutants and their wild-type individuals (denoted as Sib). Arrows indicate fluorescence and WISH signals. Figure 1 It can be seen that in ENU - / - neurod1 in mutants + The signal weakened significantly, and in ENU - / - In the mutants, the fluorescence and transcription levels of some key genes related to nerve cells and glial cells were also downregulated. Figure 2 This represents the movement trajectory of 3dpf juvenile (embryo) fish. Wild-type juvenile fish moved a distance of 81.74±20.34 cm at a speed of 0.19±0.05 cm / s over a 5-minute recording period, but ENU... - / - The mutants are almost unable to move spontaneously. Figure 3 The image shows TUNEL and Sox2 immunofluorescence images of a cross-sectional view of the midbrain of 3dpf juvenile fish. The arrows indicate TUNEL. + Signals and Sox2 + Colocalization of signals. The mutant, relative to wild-type zebrafish, TUNEL + Signals and Sox2 + The colocation of signals is increasing. Figure 4 Caspase-3 in the midbrain of juvenile fish with an E value of 3 dpf + Fluorescence image of the signal (enclosed by dashed lines). Figure 4F represents the fluorescence signal intensity statistics (Mean ± SEM; sibling, 18.24 ± 0.71, n = 17; ENU). - / - ,63.41±3.51n=21; two independent clutches; unpaired t-test). Figure 4 G is in ENU - / - A schematic diagram illustrating apoptosis of neural progenitor cells (neuronal precursor cells) and neural developmental defects in mutants. Figure 4 Experimental results show that in this scheme, ENU - / - The mutant exhibited apoptosis of neural progenitor cells and impaired neurogenesis. Additionally, the 3dpf ENU... - / - The midbrain volume of the mutant is 75973±2162 μm. 2 The mesobrain volume of wild-type 3dpf juvenile fish is 91176±2063μm. 2 .

[0057] In order to find in ENU - / - In the mutant, to determine which gene played a key role, the inventors conducted gene linkage analysis and located the mutated gene locus on chromosome 18, in the 1.35-0.92 centimole range between ZK225B14 and ZK261F4. (See [link to relevant documentation]). Figure 5 One recombination site was discovered through sequencing the nucleotide sequence between SNP1 and SNP2, where ENU was involved. - / - The mutant gene mutation was localized to a 0.13 Mb (mega-base pair) region. Within this region, four genes with labeled functions were identified; further investigation revealed ENU... - / - The mutant aars1 gene had a point mutation in exon 5 (T to A), thus confirming the above ENU. - / - The mutant is a variant of the aars1 gene, named aars1. ENU- / - Mutants (see diagram) Figure 6 The point mutation from T to A led to aars1. ENU- / - The mutant changed the codon UGU at position 171 to UGA, causing premature termination of protein translation and resulting in a non-functional truncated protein.

[0058] Besides aars1 ENU- / - The inventors also created a CRISPR / Cas9-based aars1 gene knockout mutant. CRISPR- / -Mutants. The CRISPR / Cas9 system is a very mature gene editing method currently available. This was performed according to the literature (Chang, N., 2013. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res 23, 465-472.). aars1 CRISPR- / - The mutant creation process is roughly as follows: The gRNA targeting sequence was designed as 5'-GGGACGGGTCAATGGTGTTCAGG-3' (located on exon 4 of the aars1 gene, SEQ ID NO.1), and the gRNA was synthesized using a commercial kit (mMESSAGE mMACHINE T7 transcription kit, ThermoFisher Scientific). The Cas9 protein (Biolabs) and gRNA were mixed according to the protocol, and then the mixture was injected into zebrafish fertilized eggs (i.e., the single-cell embryo stage). Sequencing was used to determine whether the mutant was successfully constructed. See [link to documentation]. Figure 6 . Figure 6 The study showed that the gene knockout resulted in a 10bp deletion in exon 4 of the aars1 gene.

[0059] Figure 7 C demonstrated the mutant (aars1) via Western blotting. CRISPR- / - mutants and aars1 ENU- / - The expression of Aars1 protein in mutant individuals and their corresponding wild-type individuals (sib) was analyzed, demonstrating that the expression level of Aars1 protein was reduced in the mutant. The full-length zebrafish Aars1 protein showed sequence similarity of 81.88% and 82.61% with human and mouse Aars1 proteins, respectively. Therefore, the inventors targeted Aars1... ENU- / - The mutant and its corresponding wild-type individual (sib) were additionally subjected to human Aars1 protein mRNA (H-AARS1 mRNA), and it was found that the mRNA could restore Aars1. ENU- / - Expression levels of Sox2 in the mutant. Experimental results images can be found in [link to image]. Figure 7 D, aars1 ENU- / - The mutant and its corresponding wild-type individual (sib) were injected with H-AARS1 mRNA to observe the expression of Sox2 in the midbrain. The arrows indicate Sox2 expression. + Signal. Same as aars1 ENU- / - Like the mutant, aars1 CRISPR- / - Compared to its wild-type individual (sib), the mutant exhibits midbrain atrophy, particularly in the AO region. +Signal enhancement (Acridine Orange, for detecting apoptosis), Sox2 + HuC + and neurod1 + Signal attenuation Figure 8 , Figure 9 F). Annexin V+ signaling was significantly increased in F0 generation mutants ( Figure 9 G) also indicates that mutations in the aars1 gene can lead to neuronal apoptosis and neurogenesis defects.

[0060] Example 2: Study of signaling pathways involved in an animal model of tRNA synthetase deficiency (Perk signaling pathway)

[0061] AARS1 was studied. ENU- / - The experimental results regarding the signaling pathways related to apoptosis in mutant neurons are as follows:

[0062] BiP protein (protein-folding chaperone) in AARS1 ENU- / - The level in the mutant was twice that of its wild-type individual (sib). See the experimental results. Figure 10 A. In aars1 ENU- / - In the mutant, the endoplasmic reticulum (ER) exhibits severe bulging and expansion relative to the wild-type individual (sib). Figure 10 B). To aars1 ENU- / - Treatment of mutants with thapsigargin (Tg, an endoplasmic reticulum calcium pump inhibitor) and tunicamycin (Tn, a protein glycosylation inhibitor) promoted AO in the midbrain. + Signal strength ( Figure 10 C). To aars1 ENU- / - After the mutant was treated with azoramide (an endoplasmic reticulum stress inhibitor), AO + Signal strength weakened ( Figure 10 (D and E).

[0063] aars1 was detected ENU- / - mutants and aars1 CRISPR- / - The expression levels of p-eIF2α and eIF2α in mutants (reflecting PERK activity) showed a highly significant increase compared to their corresponding wild-type individuals (sib). Figure 10 F). We will next use GSK2656157 (a perk pathway inhibitor) to treat aars1. ENU- / - Mutant, aars1 was found ENU- / - AO in mutants + Signal attenuation Figure 10 G).

[0064] The above research indicates that in aars1 ENU- / - In the mutant, the perk signaling pathway is activated, which in turn induces apoptosis of neural progenitor cells (neuronal precursor cells).

[0065] Example 3: Study on the effect of Nfe2l2b gene on tRNA synthetase-deficient animal model

[0066] Application of tunicamycin (Tn) and thapsigargin (Tg) to HEK293T cells increased Annexin V levels. + Signals and increases p-PERK protein levels ( Figure 11 and Figure 12 C). We focused our research on NRF2, a typical antioxidant transcription factor. In HEK293T cells, the protein level of NRF2 increased after application of tunicamycin (Tn) and thapsigargin (Tg). Figure 12 D), especially phosphorylated NRF2 enhancement ( Figure 13 E). Treatment of HEK293T cells and wild-type zebrafish with oltipraz (an Nrf2-specific agonist) revealed Annexin V... + Signals and AO + Signal enhancement ( Figure 13 F and Figure 13 G). Among them, in Figure 11 In the mean ± SEM data, the specific data are as follows: DMSO, 2.29 ± 0.64n = 7; Tg, 17.43 ± 3.55n = 7; Tn, 16.44 ± 1.56n = 9; statistical format: two independent clutches, one-way ANOVA).

[0067] In zebrafish, paralogous genes of the human NRF2 protein include the nfe2l2a and nfe2l2b genes. The nfe2l2b gene is a newly discovered paralogous gene and has not yet been studied in detail. The aars1 gene was also investigated. ENU- / - Expression of the nfe2l2b gene in mutant zebrafish (midbrain), experimental results are shown in [link to experimental data]. Figure 14 This indicates that the expression of the nfe2l2b gene is concentrated in the NBT-DenNTR region. + In cells, and aars1 ENU- / - The expression level of the nfe2l2b gene was significantly increased in the mutant (Mean ± SEM; sibling, 23.92 ± 3.66, n = 18; aars1).ENU- / - ,65.86±5.65n=20; two independent clutches; unpaired t-test). Figure 15 The results of WISH analysis of the zebrafish brain were presented, showing the effects of aars1. ENU- / - Direct injection of chop mRNA or application of oltipraz to mutants and wild-type individuals (sib) can increase the transcription level of the nfe2l2b gene, but the transcription level of the nfe2l2a gene shows a decrease. Figure 16 L demonstrated wild-type midbrain AO + The signal indicates that the application of nfe2l2b gene mRNA (upgraded expression of full-length nfe2l2b gene mRNA) will enhance AO. + Signal.

[0068] The inventors then constructed a zebrafish nfe2l2b gene knockout model based on the CRISPR / Cas9 system. The construction method is described in Example 1. The gRNA target is 5'-TGGATGTCTCCGGCAGAGGG-3' (SEQ ID NO.2), located in exon 2 of the nfe2l2b gene. The resulting gene mutation is a 1-bp deletion in exon 2, leading to the production of a non-functional truncated protein, which is rapidly degraded after production (see schematic diagram). Figure 19 ). Figure 16 M showcases 5-month-old wild-type, homozygous nfe2l2b zebrafish. CRISPR- / - mutants and heterozygotes nfe2l2b CRISPR- / - Mutant. nfe2l2b CRISPR- / - The mutant can survive to adulthood and is not significantly different in appearance from the other two. Homozygous aars1 can be obtained using conventional hybridization techniques. ENU- / - nfe2l2b CRISPR- / - Double mutant (the two parents are aars1) ENU- / + Mutants and nfe2l2b CRISPR- / + Mutants (double mutants obtained through hybridization) were used to detect TUNEL in various mutants. + Signal and brain atrophy status. See experimental results for details. Figure 16 N (midbrain TUNEL) + Immunofluorescence signal and Figure 17 (Midbrain area statistics, Mean±SEM; sibling, 78201.27±3053.39n=12; aars1) ENU- / - ,58860.49±1452.75n=13;nfe2l2b CRISPR- / -,92589.72±1977.14n=12;aars1 ENU- / - nfe2l2b CRISPR- / - ,70933.32±659.96n=20; two independent clutches; one-way ANOVA), the experimental results show that the deletion of the nfe2l2b gene can increase the midbrain area to a certain extent, and alleviate the symptoms of brain atrophy in the case of aars1 gene deletion, thereby treating cerebellar hypoplasia and brain atrophy caused by tRNA synthetase deficiency. Immunofluorescence images of Sox2, and WISH images of neurod1 and olig2 are shown in [reference]. Figure 18 .

[0069] In summary, the nfe2l2b gene encodes a protein that is a downstream molecule of the perk signaling pathway. The perk signaling pathway regulates neural progenitor cells (neuronal precursor cells, NPCs) and neurogenesis in zebrafish larvae through transcriptional control by Chop and activity control by Perk. Downregulating the expression level of the nfe2l2b gene and its protein, or inhibiting its protein activity, can regulate apoptosis and memory neurogenesis in neural progenitor cells, thereby alleviating neurological disorders caused by tRNA synthetase deficiency, particularly cerebellar hypoplasia and cerebral atrophy. In this embodiment, the nfe2l2b gene was knocked out using CRISPR / Cas9, achieving inhibition of neuronal apoptosis and thus therapeutic effects. Gene knockout using the CRISPR / Cas9 system was a relatively extreme approach (complete gene inactivation) to investigate the role of the nfe2l2b gene in neurological disorders caused by tRNA synthetase deficiency. The above methods validated that the nfe2l2b gene is a therapeutic target for diseases, and can be applied to the preparation of drugs for neurological disorders caused by tRNA synthetase deficiency. In practice, any means can be used to downregulate the expression level of the nfe2l2b gene in vivo (e.g., RNA interference technology) or its protein expression level, or inhibit its protein activity (e.g., using nfe2l2b protein inhibitors). Furthermore, this technical solution provides a therapeutic target for neurological disorders caused by tRNA synthetase deficiency. We can screen for relevant drugs using the nfe2l2b gene; for example, by observing the inhibitory effects of drugs on nfe2l2b gene expression, Nfe2l2b protein expression, and Nfe2l2b protein activation, we can evaluate whether the drug can be used to treat neurological disorders caused by tRNA synthetase deficiency (cerebellar syndrome and cerebral atrophy).

[0070] Example 4: Study on downstream targets of the Nfe2l2b gene

[0071] NRF2 protein is a transcription factor, but its target is not yet clear. The inventors conducted in-depth research on the target of NRF2 protein using zebrafish as a research model, and found that the p53 gene is a direct target of Nfe2l2b protein (a paralog of NRF2 protein in zebrafish). The p53 gene plays a crucial role in regulating apoptosis. Using ChIP and luciferase methods, we discovered that Nfe2l2b protein can bind to the "GTAACAAAG" sequence in the promoter region of the p53 gene (position -639 in the p53 gene promoter region). Figure 20 A shows the sequence information of the promoter binding region. In the ChIP-PCR analysis, the binding site of Nfe2l2b in the p53 promoter region is shown in green. The blue arrow indicates ChIP-PCR, the gray arrow indicates the ChIP-negative control, and the blue box indicates the selected p53 exon. Figure 20 B represents the results of the ChIP-PCR experiment, where the abbreviations stand for: IgG, immunoglobulin G; IF, forward primers; IR, reverse primers; NF, negative forward primers; NR, negative reverse primers. In the experimental group containing the vector Nfe2l2bCDS, the activity of luciferase was significantly increased compared to the control group without the Nfe2l2bCDS vector. However, if the sequence was mutated, the intensity of luciferase decreased. Figure 20 C).

[0072] The inventors then studied nfe2l2b CRISPR- / - p53 signaling in mutants, see [link / reference] Figure 21 The WISH experiment results of D showed that p53 + The signal in nfe2l2b CRISPR- / - The mutant showed a significant decrease compared to wild-type individuals (sib) (testing zebrafish brain p53). + (Signal). If nfe2l2b mRNA is injected into zebrafish embryos, p53 will appear. + The phenomenon of signal enhancement ( Figure 21 E, testing p53 in zebrafish embryos + The signal, indicated by the arrow, is p53. + (Signal). Overexpression of nfe2l2b mRNA in zebrafish Tg(NBT:DenNTR) strains resulted in p53. + NBT-DenNTR signal (turquoise) +Cells and nfe2l2b (green) co-localize and exhibit TUNEL. + For the signal and experimental results, please refer to [link / reference]. Figure 22 F and Figure 22 G. p53 transcriptional levels in aars1 ENU- / - NBT-DenNTR mutant + In cells, p53 shows a significant increase. However, if nfe2l2b or chop is knocked out, the transcription level of p53 decreases significantly. Figure 23 and Figure 24 The inventors also tested aars1. ENU- / - The mutant underwent rapid gene knockout of p53 (using p53MOs). Experimental results showed that aars1 ENU- / - In the presence of p53MOs, the apoptosis signaling AO in mutants and their wild-type individuals (sib) was reduced. + reduce( Figure 25 K), and simultaneously increased brain volume in organisms. aars1 ENU- / - The mutant survived longer after treatment with p53 MOs. Figure 26 L). The purpose of Morpholinos (MOs) technology is to knock down the expression level of target genes. Morpholinos bind to RNA and exert their effect by blocking the translation process, thus blocking normal RNA splicing. Figure 31 ). In aars1 ENU- / - Tests were conducted in mutants and their wild-type individuals (sib), and the transcriptional level of nfe2l2b was altered due to p53 knockout. Figure 26 Furthermore, p53 knockout significantly reduced cell death in embryos treated with oltipraz, an Nrf2 activator. This means that p53 knockout alleviated apoptosis induced by Nfe2l2b protein activation. Figure 25 N).

[0073] In summary, p53 is the direct target and effector molecule of Nfe2l2b protein. In zebrafish, under the regulation of Nfe2l2b protein, it plays a regulatory role in the occurrence and development of nerve cells.

[0074] Example 5: Nfe2l2b gene in other tRNA synthetase-deficient animal models (tars1) ENU- / - Research on the role of )

[0075] The inventors further investigated the role of Nrf2 in other aminoacyl-tRNA synthetase-deficient animals, using tars1 ENU- / -The mutant is used as an example for illustration (Cao, Z., 2016. Noncanonical function of threonyl-tRNA synthetase regulates vascular development in zebrafish. Biochem Biophys Res Commun 473, 67-72.). The tars1 gene encodes threonyl-tRNA synthetase. The zebrafish tars1 gene was obtained through ENU mutagenesis and screening as described in Example 1. ENU- / - Mutants. Sequencing analysis showed that the tars1 gene was concentrated in groups 4 and 5 ( Figure 27 A) tars1 ENU- / - The mutant's brain is significantly smaller than that of the wild-type individual (sib), and its tail is curled. Figure 27 B). tars1 ENU- / - Compared to wild-type individuals (sib), the mutant showed significantly enhanced AO+ and TUNEl+ signaling, indicating enhanced apoptosis. Figure 27 C and D). tars1 ENU- / - The mutant showed a decrease in the number of NeuN+ cells and a reduction in the transcriptional levels of map2 and tuba1b, among others. Figure 28 E), increased transcription levels of bip and chop (E), Figure 28 F) indicates an abnormality in the neural development process. tars1 ENU- / - The mutants also showed upregulation of nfe2l2b and p53 expression levels. Figure 29 K). Tars1 is instantaneously interfered with via MOs. ENU- / - Functions of nfe2l2b and p53 in mutant and wild-type individuals were found to reveal AO + and TUNEL + Significantly reduced ( Figure 29 L and M).

[0076] The above research demonstrates that tRNA synthetase deficiency leads to accelerated apoptosis of neural progenitor cells and neurodevelopmental defects, which can result in neurodevelopmental disorders such as microcephaly and cerebral atrophy. Nrf2 protein (Nfe2l2b protein) is a key regulatory molecule in this process. tRNA synthetase deficiency upregulates the Perk signaling pathway, thereby upregulating Nrf2 protein (Nfe2l2b protein) levels, which in turn regulates p53 gene transcription, ultimately leading to accelerated apoptosis of neural progenitor cells and neurodevelopmental defects. This technical approach demonstrates that by controlling Nrf2 protein (Nfe2l2b protein), apoptosis can be inhibited, thereby treating neurodevelopmental disorders such as microcephaly and cerebral atrophy. The main methods for controlling Nrf2 protein (Nfe2l2b protein) include gene knockout, transcriptional inhibition, protein translation inhibition, and protein activity inhibition. A schematic diagram of the overall mechanism of action of Nrf2 is shown below. Figure 30 .

[0077] The technical means used in this technical solution are described in detail below:

[0078] (1) Information on the genes and proteins involved in this scheme:

[0079] Nrf2 protein / nfe2l2 gene: Ensembl:ENSG00000116044; Nfe2l2b protein / gene: Ensembl:ENSDARG00000089697; tars1 gene / protein: Ensembl:ENSDARG00000013250; aars1 gene / protein: Ensembl:ENSDARG00000069142.

[0080] (2) Image Analysis

[0081] AO + Signal, WB grayscale value, DNA gel electrophoresis band grayscale value, and FISH fluorescence intensity were analyzed using ImageJ software (NIH, Bethesda, MD, USA) according to conventional methods. Zebrafish midbrain volume analysis was performed according to the literature (Chowdhury, TA, 2018. Temporal and Spatial Post-Transcriptional Regulation of Zebrafish tie1 mRNA by Long Noncoding RNA During Brain Vascular Assembly. Arterioscler Thromb Vasc Biol 38, 1562-1575.).

[0082] (3) ChIP and fluorescent reporter gene detection methods

[0083] ChIP (Chromatin Immunoprecipitation) analysis was performed on 24 hpf zebrafish embryos (injected with HA-nfe2l2b mRNA). Since there is no Nfe2l2b-specific antibody in existing technology, we used an HA antibody to obtain the target DNA sequence. The eluted DNA was detected by PCR, with primers designed according to the Nfe2l2b binding site (Table 1). A dual-luciferase reporter assay was used for fluorescence reporter gene detection; enzyme activity measurements were performed according to the GloMax 20 / 20 luminometer (Promega) manual. The -2.6 kb p53 promoter was obtained by PCR amplification and integrated into the pGL3-basal plasmid (Promega). The p53-binding site (BS) was mutated as a control. Experimental procedures were performed according to the Lipo8000 protocol. TM Following the instructions for using the Transfection Reagent (Beyotime), 293T cells were cultured and transfected (200ng pGL3-p53 promoter, 200ng pGL3-p53 promoter-MBS, 250ng pCS2-nfe2l2b CDS, 250ng pCS2, 40ng pRL-CMV). Finally, the fluorescence signal was detected using the Dual Luciferase Reporter Gene Assay Kit (Beyotime).

[0084] Table 1: Primer sequence information

[0085] name Sequence (5'-3') serial number Zebrafish p53 Non-specific Forward GAGTACTTGCCGGGATCGTT SEQ ID NO.3 Zebrafish p53 Non-specific Reverse AGTGCAAGTTACAGATTTTGC SEQ ID NO.4 Zebrafish p53 Forward ATCCTAAACGTGGGTGACA SEQ ID NO.5 Zebrafish p53 Reverse ATACAACACACAAGCGGTCC SEQ ID NO.6

[0086] (4) Carrier construction and chemical substance treatment methods

[0087] Wild-type and mutant CDS of the aars1 gene were obtained by RCR amplification and then integrated into the pCS2+ vector using mMESSAGEmMACHINE. TM mRNA was synthesized using the SP6 kit (Roche). The synthesis of Chop and nfe2l2b mRNA followed the same procedure. For ChIP and fluorescent reporter gene detection methods, we synthesized mutant sequences based on existing literature (Huang, Y., 2019. Ikzf1 regulates embryonic T lymphopoiesis via Ccr9 and Irf4 in zebrafish. J Biol Chem, 294, 16152-16163.).

[0088] For chemical treatment, 1.5 dpf zebrafish embryos were incubated in GSK2656157 (65 μM), Thapsigargin (5 μM), Tunicamycin (1 μM), Cycloheximide (50 μM), Oltipraz (10 μM), and Ceapin-A7 (50 μM), respectively. HEK293T cells were incubated for 24 h at specified growth stages using Thapsigargin (0.5 μM or 1 μM), Oltipraz (40 μM), and Tunicamycin (6 μM).

[0089] The pT2AL2-NBT:aars1;cryaa:Cerulean plasmid was constructed by amplifying the full-length aars1 202 cDNA fragment and integrating it into the pT2AL2-NBT;cryaa:Cerulean empty vector plasmid. The hsp70:p53 plasmid was constructed by amplifying the full-length p53 cDNA fragment and integrating it into the pTol2-hsp70 empty vector plasmid. Transgenic zebrafish lines were constructed using these plasmids. The pT2AL2-NBT:aars1;cryaa:Cerulean plasmid (30 ng / μl) and Tol2 transposase mRNA (250 ng / μl) were co-injected into single-cell wild-type zebrafish embryos to construct the F0 generation of transgenic zebrafish, followed by hybridization to obtain the genetically stable F1 generation. Tg(NBT:DenNTR) and Tg(hsp70:p53) transgenic zebrafish were constructed using the same method.

[0090] (5) Staining methods

[0091] RNA probes were synthesized using the DIG RNA Labeling kit T3 / T7 / SP6 (Roche). WISH and FISH were performed according to existing literature (He, J., 2020. Combined whole-mount fluorescence in situhybridization and antibody staining in zebrafish embryos and larvae. NatProtoc 15, 3361-3379.; Huang, Y., 2019. Ikzf1 regulates embryonic T lymphopoiesis via Ccr9 and Irf4 in zebrafish. J Biol Chem, 294, 16152-16163.).

[0092] TUNEL staining was performed using the In Situ Cell Death Detection Kit and TMR Red Kit (Roche); Acridine orange (AO) staining was performed according to existing technical literature (Thompson, R., 2015. An Inhibitor of PID Dosome Formation. Mol Cell 58, 767-779.).

[0093] The above descriptions are merely embodiments of the present invention, and common knowledge such as specific technical solutions and / or characteristics are not described in detail here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the technical solutions of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications and improvements will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.

Claims

1. Used for knockout nfe2l2 The application of the CRISPR / Cas9 gene system in the preparation of therapeutic systems or drugs for treating microcephaly or cerebral atrophy in zebrafish, characterized by: The target sequence of the gRNA in the CRISPR / Cas9 system is 5'-TGGATGTCTCCGGCAGAGGG-3'.

Images