A method for producing organic fertilizer by combining composite microbial agent and nano-membrane fermentation

Abstract

The invention discloses a method for producing organic fertilizer by combining composite microbial agents and nano-membrane fermentation, comprising the following steps: mixing livestock and poultry manure and straw at a weight ratio of 1:3, adjusting the carbon-nitrogen ratio to 25:1, and simultaneously inoculating the composite microbial agent, with an inoculation amount of 3% by weight and a water content of 60%; obtaining pre-fermented material; adding the pre-fermented material to a fermentation tank of a nano-membrane aerobic composting fermentation machine, covering the nano-membrane, pre-fermenting for 10 days, the pre-fermentation temperature being 55°C to 70°C, and using intermittent air blowing during the pre-fermentation process to obtain fermented material, adding the fermented material to a vertical fermentation tank, maintaining the temperature at 60 to 70°C under the condition that a blower provides oxygen, stirring and fermenting for 5 days; the fermented product is crushed and granulated to prepare organic fertilizer. The composite microbial agent and nano-membrane combined fermentation method of the invention is used to produce organic fertilizer, thereby improving the production efficiency and fertilizer efficiency of organic fertilizer, and at the same time improving the harmless treatment effect of straw and manure.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a method for producing organic fertilizer by combining composite microbial agents and nano-membrane fermentation. Background Art

[0002] Organic fertilizers are rich in organic nutrients such as humic acid and amino acids, as well as inorganic nutrients such as nitrogen, phosphorus and potassium. They have been playing an important role in the development of agriculture in my country. In the development of modern agricultural science and technology, the use of chemical fertilizers has brought huge benefits to agricultural production, increased crop yields and farmers' income. However, a large amount of inorganic fertilizers will cause soil compaction, soil dysfunction, pollution to crops, and reduce the quality of agricultural products. Due to the large-scale application of chemical fertilizers, people do not pay enough attention to organic fertilizers, and the application area and amount of organic fertilizers are gradually reduced, resulting in soil degradation, soil compaction, reduction of organic matter and beneficial microorganisms, imbalance of farmland ecological environment, decline in product quality, pollution of agricultural environment and groundwater resources, and other adverse consequences, which pose a potential threat to human health. Biological organic fertilizers can not only improve soil fertility, but also produce high-value-added pollution-free green agricultural products. Therefore, it is necessary to use appropriate, harmless and highly stable organic fertilizers to supplement the substances taken away from the soil by crops and improve soil fertility in order to achieve the goals of ecology, safety, high yield, high quality and high efficiency.

[0003] Straw is a general term for the stems and leaves (ears) of mature crops. Straw is rich in nitrogen, phosphorus, potassium, calcium, magnesium and organic matter, and is a multi-purpose renewable biological resource. Livestock and poultry manure mainly refers to a type of rural solid waste produced in the livestock and poultry farming industry, including pig manure, cow manure, sheep manure, chicken manure, duck manure, etc. In agricultural production, straw and livestock and poultry manure are often mixed and fermented and put into farmland as organic fertilizer for reuse. However, the existing method of mixed fermentation of straw and livestock and poultry manure is generally traditional composting fermentation. Composting fermentation uses a compost turning machine to turn the compost, which results in large nutrient loss. In addition, the composting fermentation is open and polluted, the stacking site is large, and it cannot be deodorized, resulting in an unpleasant odor in the entire environment. At the same time, the fermentation agent used for composting fermentation is relatively single, and the function of a single microbial strain is limited, and it cannot maximize the technical problem of improving the efficiency of livestock and poultry manure and straw fermentation composting. Summary of the invention

[0004] An object of the present invention is to solve at least the above problems and / or disadvantages and to provide at least the advantages which will be described hereinafter.

[0005] In order to achieve these purposes and other advantages according to the present invention, a method for producing organic fertilizer by combining composite microbial inoculants and nano-membrane fermentation is provided, comprising the following steps:

[0006] Step 1: mix livestock and poultry manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate a composite microbial agent at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain a pre-fermented material;

[0007] Step 2: Add the pre-fermented materials into the fermentation tank of the nano-membrane aerobic composting fermentation machine, cover with the nano-membrane, pre-ferment for 10 days, the pre-fermentation temperature is 55°C to 70°C, and use intermittent blowing during the pre-fermentation process to obtain the fermented material, add the fermented material into a vertical fermentation tank, maintain the temperature at 60 to 70°C under the condition of oxygen provided by a blower, and stir and ferment for 5 days; the fermented product is crushed and granulated to obtain organic fertilizer.

[0008] Preferably, the livestock and poultry manure is one or more of pig manure, cow manure, chicken manure and duck manure.

[0009] Preferably, the nano-membrane has micropores with a pore size of 0.2 μm uniformly distributed thereon; the intermittent air blowing volume is 30 to 40 m 3 / min; the blowing time in one blowing cycle is 1 to 3 minutes and the rest time is 5 to 15 minutes.

[0010] Preferably, the preparation method of the composite microbial agent is: using an inoculation loop to pick two loops of slender lysine Bacillus, Bacillus and Bacillus brevis slant seeds respectively in a 250mL triangular flask filled with 50mL nutrient broth medium, 37°C, 150r / min, culture for 18h, and respectively prepare the slender lysine Bacillus first-level seed liquid, Bacillus first-level seed liquid and Bacillus brevis first-level seed liquid; inoculate the lysine Bacillus first-level seed liquid in 250mL optimized culture medium at an inoculation rate of 3% (v / v), 37°C, 150r / min, and culture for 18h. / min, shake flask culture for 30 hours to obtain a secondary seed liquid of elongated lysine Bacillus; inoculate the first-level Bacillus seed liquid and the first-level Bacillus brevis seed liquid in 250mL nutrient broth culture medium at an inoculation amount of 6% (v / v), 37°C, 150r / min, shake flask culture for 30 hours to respectively obtain a second-level Bacillus seed liquid and a second-level Bacillus brevis seed liquid; combine the second-level Bacillus lysine Bacillus seed liquid, the second-level Bacillus seed liquid and the second-level Bacillus brevis seed liquid in a ratio of 1-1.5:2:2 to obtain a microbial composite bacterial agent.

[0011] Preferably, the composition of the optimized culture medium is: CMC-Na 5.0g, (NH4)2SO4 2.0g, K2HPO4 1.0g, MgSO4·7H2O 0.5g, NaCl 0.5g, FeSO4·7H2O 0.1g, distilled water 1000mL, pH 7.0-7.2.

[0012] Preferably, the total colony count of the composite bacterial solution reaches 2.5×10 9 CFU / mL.

[0013] Preferably, the classification name of the elongated lysine Bacillus is Lysinibacillus macroides SWUST-1, which has been registered and deposited in the General Microbiological Center of the China National Microbiological Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No. 24857; the classification name of the bacillus is Bacillus sp. SWUST-3, which has been registered and deposited in the General Microbiological Center of the China National Microbiological Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No. 24858; the classification name of the brevibacillus is Brevibacillus sp. SWUST-2, which has been registered and deposited in the General Microbiological Center of the China National Microbiological Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No. 24859. The deposit addresses are all Beijing, China.

[0014] Preferably, the DNA gene sequence of the Lysinibacillus macroides SWUST-1 is as shown in SEQ ID NO.1.

[0015] Preferably, the DNA gene sequence of the Bacillus sp. SWUST-3 is as shown in SEQ ID NO.2.

[0016] Preferably, the DNA gene sequence of Brevibacillus sp. SWUST-2 is as shown in SEQ ID NO.3.

[0017] The present invention at least includes the following beneficial effects: the present invention adopts composite microbial agent and nano-film combined fermentation to produce organic fertilizer, the strain of the composite microbial agent is derived from the high temperature dominant bacterial community in the natural fermentation process of straw compost, and after long-term screening and domestication, it can effectively promote the organic fertilizer fermentation production process with straw and livestock and poultry manure as the main raw materials, and adopts a nano-film aerobic composting fermentation machine to cover the fermentation method of the nano-film, and the fermentation pile is covered with the nano-film, which can protect the wind and rain from the influence of bad weather, and at the same time, the carbon dioxide gas and water vapor entangled in the process can be quickly discharged. In addition, the nano-film has a certain insulation effect and pressurization effect, which can help the system maintain the temperature, make the oxygen concentration and temperature in the stacking evenly distributed, and help the entire stack reach the temperature condition for killing pathogens. The micropores with an aperture of 0.2 μm on the nano-membrane are effective physical barriers for dust, aerosols and microorganisms, preventing them from diffusing outwards; during the pre-fermentation process, a layer of condensed water film is generated on the inner surface of the nano-membrane; most of the odorous substances in the tail gas, such as ammonia, hydrogen sulfide, volatile organic compounds (VOCs), etc., are dissolved in the water film, and then fall back onto the pile with water droplets, where they continue to be decomposed by microorganisms; the composite microbial agent and the nano-membrane of the present invention are combined for fermentation to produce organic fertilizer, which improves the production efficiency and fertilizer effect of organic fertilizer, and at the same time improves the harmless treatment effect of straw and manure.

[0018] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is the dyed hydrolysis circle in the initial screening process of the strain of the present invention;

[0020] Figure 2 This is the glucose standard curve in the rescreening process of the strain of the present invention. DETAILED DESCRIPTION

[0021] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0022] It should be understood that terms such as “having”, “including” and “comprising” used herein do not specify the existence or addition of one or more other elements or combinations thereof.

[0023] Embodiment 1:

[0024] A method for producing organic fertilizer by combining composite microbial agents and nano-membrane fermentation, comprising the following steps:

[0025] Step 1: Mix pig manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate a composite microbial agent at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain a pre-fermented material;

[0026] Step 2: Add the pre-fermented material into the fermentation tank of the nano-membrane aerobic composting fermentation machine, cover the nano-membrane, pre-ferment for 10 days, the pre-fermentation temperature is 65°C, and intermittent air blowing is used during the pre-fermentation process to obtain the fermented material, add the fermented material into the vertical fermentation tank, maintain the temperature at 70°C under the condition of oxygen provided by the blower, and stir and ferment for 5 days; the fermented product is crushed and granulated to obtain organic fertilizer, and its various properties are shown in Table 1; the nano-membrane is evenly distributed with micropores with an aperture of 0.2 μm; the air volume of the intermittent air blowing is 30m 3 / min; the blowing time in one blowing cycle is 1 minute and the rest time is 5 minutes;

[0027] The preparation method of the composite microbial agent comprises the following steps: using an inoculation loop to respectively pick two loops of slant seeds of elongated lysine bacillus, bacillus and brevis in a 250mL triangular flask filled with 50mL of nutrient broth medium, culturing at 37°C and 150r / min for 18h to respectively prepare the first-level seed liquid of elongated lysine bacillus, the first-level seed liquid of bacillus and the first-level seed liquid of brevis; inoculating the first-level seed liquid of lysine bacillus in 250mL of optimized culture medium (CMC-Na5.0g, (NH4)2SO4 2.0g, K2HPO4 1.0g, MgSO4·7H2O 0.5g, NaCl 0.5g, FeSO4·7H2O 0.5g) at an inoculation amount of 3% (v / v) 0.1 g, 1000 mL of distilled water, pH value 7.0-7.2), 37°C, 150 r / min, shake flask culture for 30 h to obtain a secondary seed liquid of elongated lysine Bacillus; inoculate the primary seed liquid of Bacillus and the primary seed liquid of Bacillus brevis in 250 mL of nutrient broth medium at an inoculum amount of 6% (v / v), 37°C, 150 r / min, shake flask culture for 30 h to obtain a secondary seed liquid of Bacillus and a secondary seed liquid of Bacillus brevis respectively; combine the secondary seed liquid of elongated lysine Bacillus, the secondary seed liquid of Bacillus and the secondary seed liquid of Bacillus brevis in a ratio of 1.5:2:2 to obtain a microbial composite bacterial agent; the total colony count of the composite bacterial liquid reaches 2.5×10 9CFU / mL; the classification name of the elongated lysinibacillus is Lysinibacillus macroides SWUST-1, which has been registered and deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No.24857; the classification name of the bacillus is Bacillus sp.SWUST-3, which has been registered and deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No.24858; the classification name of the brevibacillus is Brevibacillus sp.SWUST-2, which has been registered and deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No.24859. The DNA gene sequence of the Lysinibacillus macroides SWUST-1 is shown in SEQ ID NO. 1. The DNA gene sequence of the Bacillus sp. SWUST-3 is shown in SEQ ID NO. 2. The DNA gene sequence of the Brevibacillus sp. SWUST-2 is shown in SEQ ID NO. 3.

[0028] Comparative Example 1:

[0029] Step 1: Mix pig manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate Bacillus elongatus lysine bacteria at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain a pre-fermented material;

[0030] Step 2: Add the pre-fermented material into the fermentation tank of the nano-membrane aerobic composting fermentation machine, cover the nano-membrane, pre-ferment for 10 days, the pre-fermentation temperature is 65°C, and intermittent air blowing is used during the pre-fermentation process to obtain the fermented material, add the fermented material into the vertical fermentation tank, maintain the temperature at 70°C under the condition of oxygen provided by the blower, and stir and ferment for 5 days; the fermented product is crushed and granulated to obtain organic fertilizer, and its various properties are shown in Table 1; the nano-membrane is evenly distributed with micropores with an aperture of 0.2 μm; the air volume of the intermittent air blowing is 30m 3 / min; the blowing time in one blowing cycle is 1 minute and the rest time is 5 minutes;

[0031] The preparation method of the elongated lysine bacillus inoculum comprises the following steps: using an inoculation loop to pick two loops of elongated lysine bacillus slant seeds and placing them in a 250mL triangular flask filled with 50mL of nutrient broth medium, culturing at 37°C, 150r / min, for 18h to obtain a first-level seed solution of the elongated lysine bacillus; inoculating the first-level seed solution of the elongated lysine bacillus in an inoculation amount of 3% (v / v) in 250mL of an optimized culture medium (5.0g of CMC-Na, 2.0g of (NH4)2SO4, 1.0g of K2HPO4, 0.5g of MgSO4·7H2O, 0.5g of NaCl, 0.5g of FeSO4·7H2O, etc.); 0.1g, distilled water 1000mL, pH value 7.0-7.2), 37°C, 150r / min, shake flask culture for 30h to obtain the secondary seed solution of Bacillus elongatus, i.e., Bacillus elongatus lysinic acid agent; the classification name of the Bacillus elongatus lysinic acid Bacillus macroides SWUST-1, which was registered and preserved in the General Microbiological Center of China National Microbiological Culture Collection on May 12, 2022, with the preservation number CGMCC No.24857; the DNA gene sequence of the Bacillus elongatus lysinic acid Bacillus macroides SWUST-1 is shown in SEQ ID NO.1.

[0032] Comparative Example 2:

[0033] Step 1: Mix pig manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate Bacillus inoculant at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain pre-fermented material;

[0034] Step 2: Add the pre-fermented material into the fermentation tank of the nano-membrane aerobic composting fermentation machine, cover the nano-membrane, pre-ferment for 10 days, the pre-fermentation temperature is 65°C, and intermittent air blowing is used during the pre-fermentation process to obtain the fermented material, add the fermented material into the vertical fermentation tank, maintain the temperature at 70°C under the condition of oxygen provided by the blower, and stir and ferment for 5 days; the fermented product is crushed and granulated to obtain organic fertilizer, and its various properties are shown in Table 1; the nano-membrane is evenly distributed with micropores with an aperture of 0.2 μm; the air volume of the intermittent air blowing is 30m 3 / min; the blowing time in one blowing cycle is 1 minute and the rest time is 5 minutes;

[0035] The preparation method of the bacillus inoculant is as follows: pick two rings of bacillus slant seeds with an inoculation loop and place them in a 250mL triangular flask filled with 50mL nutrient broth medium, culture them at 37°C, 150r / min, and culture them for 18h to obtain a first-level bacillus seed solution; inoculate the first-level bacillus seed solution in 250mL nutrient broth medium at an inoculum amount of 6% (v / v), culture them in a shake flask at 37°C, 150r / min, and culture them for 30h to obtain a second-level bacillus seed solution, i.e., a bacillus inoculant; the bacillus is classified and named as Bacillus sp. SWUST-3, which has been registered and deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on May 12, 2022, with a deposit number of CGMCC No. 24858; the DNA gene sequence of the bacillus sp. SWUST-3 is shown in SEQ ID NO. 2;

[0036] Comparative Example 3:

[0037] Step 1: Mix pig manure and straw at a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate Bacillus brevis inoculant at an inoculation amount of 3% by weight and adjust the water content to 60% to obtain pre-fermented material;

[0038] Step 2: Add the pre-fermented material into the fermentation tank of the nano-membrane aerobic composting fermentation machine, cover the nano-membrane, pre-ferment for 10 days, the pre-fermentation temperature is 65°C, and intermittent air blowing is used during the pre-fermentation process to obtain the fermented material, add the fermented material into the vertical fermentation tank, maintain the temperature at 70°C under the condition of oxygen provided by the blower, and stir and ferment for 5 days; the fermented product is crushed and granulated to obtain organic fertilizer, and its various properties are shown in Table 1; the nano-membrane is evenly distributed with micropores with an aperture of 0.2 μm; the air volume of the intermittent air blowing is 30m 3 / min; the blowing time in one blowing cycle is 1 minute and the rest time is 5 minutes;

[0039] The preparation method of the Bacillus brevis inoculant is as follows: pick two rings of Bacillus brevis slant seeds with an inoculation loop and place them in a 250mL triangular flask filled with 50mL nutrient broth medium, culture at 37°C, 150r / min, and culture for 18h to obtain a first-level seed solution of Bacillus brevis; inoculate the first-level seed solution of Bacillus brevis in 250mL nutrient broth medium at an inoculation rate of 6% (v / v), culture at 37°C, 150r / min, and shake the flask for 30h to obtain a second-level seed solution of Bacillus brevis; that is, the Bacillus brevis inoculant; the classification name of the Bacillus brevis is Bacillus sp. SWUST-2, which has been registered and preserved in the General Microbiology Center of the China Microbiological Culture Collection Administration on May 12, 2022, with a preservation number of CGMCC No. 24859; the DNA gene sequence of the Bacillus brevis (Brevibacillus sp. SWUST-2) is shown in SEQ ID NO.3.

[0040] Comparative Example 4:

[0041] Pig manure and straw are mixed at a weight ratio of 1:3, and the carbon-nitrogen ratio is adjusted to 25:1. At the same time, a composite microbial agent is added, and the inoculation amount is 3% by weight. The moisture content is adjusted to 60%. The temperature and moisture content are regularly monitored to maintain the temperature at 60°C. Water is added to maintain the moisture content of the compost at about 60%. The compost is turned over when the temperature drops significantly, and the compost is turned over 3 times in total. After the temperature no longer rises significantly, the organic fertilizer can be obtained after 10 days of decomposition. Its various properties are shown in Table 1. The preparation method of the composite microbial agent is shown in Example 1.

[0042] Table 1

[0043]

[0044] The screening and identification process of the elongated lysine Bacillus, Bacillus and Bacillus brevis used in the present invention is as follows:

[0045] 1. Initial screening of strains (high temperature enrichment and high temperature culture)

[0046] Take 10g of fecal sample from the composting process of livestock and poultry feces, put it into a 250mL conical flask filled with 100mL sterile saline under sterile conditions; activate and enrich it in a constant temperature shaking incubator at 50℃ and 150r / min for 24h;

[0047] The activated bacterial solution was diluted with sterile water in sequence until the bacterial solution was diluted to 10 -5 , 10 -6 , 10 -7Three gradients. Take 100 μL of the dilution respectively and add it dropwise to the screening medium (sodium carboxymethyl cellulose CMC-Na 5.0g, ammonium sulfate (NH4)2SO4 2.0g, dipotassium hydrogen phosphate K2HPO4 1.0g, magnesium sulfate heptahydrate MgSO4·7H2O 0.5g, sodium chloride NaCl 0.5g, ferrous sulfate heptahydrate FeSO4·7H2O 0.1g, agar powder 20g, pH 7.0-7.2. After dissolving the above substances, dilute to 1000mL with distilled water. Sterilize at 121℃, 0.1Mpa for 20min), spread evenly, wait for the bacterial solution to dry and fix, put the plate upside down in a constant temperature incubator, and culture at 50℃ for 72h.

[0048] Pick a large and obvious single colony, repeatedly streak it on the plate for isolation and purification, and observe it under Gram staining and electron microscope until there are no foreign bacteria. Take the isolated and purified colony and inoculate it on the screening medium plate at 30℃ and culture it for 72h. After the colony grows, stain it with Congo red for 0.5h, then soak it in 1mol / L sterile saline for 0.5h, and evaluate the enzyme production capacity of the strain based on the diameter of the transparent hydrolysis circle produced by the colony. Generally speaking, the larger the hydrolysis circle, the stronger the enzyme production capacity of the strain (such as Figure 1 ). The obtained strain was mixed with 0.7 mL bacterial solution and 0.3 mL glycerol and stored in a -80°C refrigerator for later use.

[0049] 2. Rescreening of strains (carboxymethyl cellulase activity assay)

[0050] The cellulose-degrading bacteria obtained by the primary screening were inoculated into the fermentation medium (sodium carboxymethyl cellulose CMC-Na 10.0g, ammonium sulfate (NH4)2SO4 2.0g, dipotassium hydrogen phosphate K2HPO4 1.0g, magnesium sulfate heptahydrate MgSO4·7H2O 0.5g, sodium chloride NaCl 0.5g, ferrous sulfate heptahydrate FeSO4·7H2O 0.1g, agar powder 20g, pH 7.0-7.2. After dissolving the above substances, dilute to 1000mL with distilled water. Sterilize at 121°C, 0.1Mpa for 20min), and cultured in a constant temperature shaking incubator at 30°C and 150r / min for 72h. The activity of carboxymethyl cellulase (CMCase) was determined, and the strain with higher enzyme activity was selected as the target strain. The specific steps are as follows:

[0051] 1. Drawing of glucose standard curve

[0052] Take 7 washed and dried 10mL colorimetric tubes, add 2mL of glucose-citrate mixture of 0, 0.04, 0.08, 0.12, 0.16, 0.20, 0.40mg / mL respectively. Then add 1.5mL of DNS reagent, boil in water bath for 10min, rinse with running water, cool, add 1.5mL of distilled water to 5mL, adjust the colorimetric tube to zero at 540nm wavelength with glucose concentration of 0, and measure the absorbance of different glucose concentrations ( Figure 2 ).

[0053] 2. Preparation of crude enzyme solution

[0054] Take 10 mL of fermentation liquid, place it in a clean and dried 50 mL centrifuge tube, centrifuge it at 5000 r / min for 5 min at 4°C, and aspirate the supernatant as the crude enzyme solution.

[0055] 3. Determination of enzyme activity

[0056] The enzyme activity of the fermentation broth was determined by the 3,5-dinitrosalicylic acid colorimetric method. The crude enzyme solution degraded cellulose to produce reducing sugars. The reducing sugars could reduce the nitro group of 3,5-dinitrosalicylic acid to amino groups to generate new amino compounds, and a color reaction occurred that turned the solution yellow. Under certain reducing sugar concentration conditions, the color depth of the mixed solution increased with the increase of reducing sugar concentration, that is, the size of the enzyme activity was positively correlated with the degree of color reaction.

[0057] CMCase activity assay: Take 4 sterilized and dried 10mL colorimetric tubes and number them. Add 1.5mL of citric acid buffer to tube 0 as a blank sample, and add 1.5mL of 1.0% CMC-Na solution to the other three colorimetric tubes. Add 0.5mL of crude enzyme solution to each of the 4 colorimetric tubes, and bathe in 50℃ for 30min. After the bath, add 1.5mL of DNS reagent and bathe in boiling water for 10min. Rinse with tap water and cool quickly. Add 1.5mL of distilled water. Measure its absorbance at a wavelength of 540nm (Table 2).

[0058] Table 2

[0059] Strain number CMCase / U 1# 25.573 2# 12.345 3# 26.692 4# 20.694 5# 27.742 6# 17.807 7# 10.869 8# 16.937 9# 18.165 10# 11.609

[0060] 3. Molecular identification of strains

[0061] The 1#, 3# and 5# strains with high enzyme activity were selected for sequencing and identification. The colony DNA was extracted by the kit method, and 27F (GAGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGAC) were used as forward and reverse primers for PCR amplification. After electrophoresis, the three strains had amplified bands at about 1500bp. The sequence of the 1# strain is shown in SEQ ID NO.3; the sequence of the 3# strain is shown in SEQ ID NO.1; the sequence of the 5# strain is shown in SEQ ID NO.2; the sequencing results were spliced ​​with ContigExpress, and the inaccurate parts at both ends were removed; the spliced ​​sequences were compared in the NCBI database (blast.ncbi.nlm.nih.gov), 1# strain: Brevibacillus sp.; 3# strain: Lysinibacillus macroides; 5# strain: Bacillus sp.

[0062] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the examples shown and described herein.

Claims

1. A method for producing organic fertilizer by combining composite microbial agents and nano-film fermentation, characterized in that: The following steps are involved: Step 1: Mix livestock and poultry manure and straw in a weight ratio of 1:3, adjust the carbon-nitrogen ratio to 25:1, and simultaneously inoculate a composite microbial agent at an inoculation amount of 3% by weight and adjust the moisture content to 60% to obtain a pre-fermented material; Step 2: adding the pre-fermented material into a fermentation tank of a nano-film aerobic composting fermentation machine, covering it with a nano-film, and pre-fermenting it for 10 days at a temperature of 55°C to 70°C. During the pre-fermentation process, intermittent air blowing is used to obtain a fermentation material, and the fermentation material is added into a vertical fermentation tank. Under the condition that a blower provides oxygen, the temperature is maintained at 60-70°C, and the fermentation is stirred for 5 days; the fermentation product is crushed and granulated to obtain an organic fertilizer; The preparation method of the composite microbial agent comprises: combining a secondary seed liquid of Bacillus elongatus, a secondary seed liquid of Bacillus subtilis, and a secondary seed liquid of Bacillus brevis in a ratio of 1-1.5:2:2 to obtain a composite microbial agent; Among them, the classification of Bacillus elongatus is named as Bacillus elongatus ( Lysinibacillus macroides SWUST-1 ), the deposit number is CGMCC No.M 24857; the classification name of Bacillus is Bacillus ( Bacillus sp.SWUST-3 ), the deposit number is CGMCC No.M 24858; the classification name of Bacillus brevis is Bacillus brevis ( Brevibacillus sp.SWUST-2 ), the deposit number is CGMCC No.M 24859; The elongated Lysinibacillus ( Lysinibacillus macroides SWUST-1 ) The DNA gene sequence is shown in SEQ ID NO.1; The Bacillus ( Bacillus sp.SWUST-3 ) The DNA gene sequence is shown in SEQ ID NO.2; The Bacillus brevis ( Brevibacillus sp.SWUST-2 ) is shown in SEQ ID NO.

3.

2. The method for producing organic fertilizer by combining composite microbial agent and nano-film fermentation as claimed in claim 1, characterized in that: The livestock and poultry manure is one or more of pig manure, cow manure, chicken manure and duck manure.

3. The method for producing organic fertilizer by combining composite microbial agent and nano-film fermentation as claimed in claim 1, characterized in that: The nano-membrane has micropores with a pore size of 0.2 μm; the intermittent blasting volume is 30-40 m 3 / min; the blowing time in one blowing cycle is 1 to 3 minutes and the rest time is 5 to 15 minutes.

4. The method for producing organic fertilizer by combining composite microbial agent and nano-film fermentation as claimed in claim 1, characterized in that: The preparation methods of the elongated lysinic Bacillus secondary seed liquid, the Bacillus secondary seed liquid and the brevis Bacillus secondary seed liquid are as follows: Two loops of slant seeds of Bacillus elongatus, Bacillus subtilis, and Bacillus brevis were picked with an inoculating loop and placed in a 250 mL Erlenmeyer flask filled with 50 mL of nutrient broth. The culture was incubated at 37°C, 150 rpm, for 18 h to obtain the first-level seed solution of Bacillus elongatus, the first-level seed solution of Bacillus subtilis, and the first-level seed solution of Bacillus brevis, respectively. The first-level seed solution of Bacillus elongatus was inoculated into 250 mL of optimized culture medium at a 3% (v / v) inoculation rate and cultured in a shake flask at 37°C and 150 rpm for 30 h to obtain the second-level seed solution of Bacillus elongatus. The first-level seed solution of Bacillus subtilis and the first-level seed solution of Bacillus brevis were inoculated into 250 mL of nutrient broth medium at an inoculum rate of 6% (v / v) and cultured in a shaking flask at 37°C and 150 rpm for 30 h to obtain the second-level seed solution of Bacillus subtilis and the second-level seed solution of Bacillus brevis, respectively.

5. The method for producing organic fertilizer by combining composite microbial agent and nano-film fermentation as claimed in claim 4, characterized in that: The composition of the optimized culture medium is: CMC-Na 5.0 g, (NH4)2SO4 2.0 g, K2HPO4 1.0 g, MgSO4·7H2O 0.5 g, NaCl 0.5 g, FeSO4·7H2O 0.1 g, distilled water 1000 mL, pH 7.0-7.

2.

6. The method for producing organic fertilizer by combining composite microbial agent and nano-film fermentation as claimed in claim 1, characterized in that: The total colony count of the composite microbial agent reached 2.5×10 9 CFU / mL.

Images