MdASG1 Protein, Encoding Gene Thereof, and Application Thereof in Regulating Apple Aroma Synthesis and Plant Stress Tolerance

By expressing and applying the MdASG1 protein and its encoding gene in apples, volatile aroma substances and plant reversibility in apple fruits are regulated, and the problems of lack of flavor and insufficient reversibility in apple fruits in the prior art are solved, and the content of aroma substances and the improvement of reversibility are achieved.

CN115925845BActive Publication Date: 2025-06-10SHANDONG AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210958518.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-09
Publication Date
2025-06-10
Estimated Expiration
2042-08-09

AI Technical Summary

Technical Problem

The prior art is difficult to effectively regulate apple aroma synthesis and plant reversibility, resulting in a lack of fruit flavor and affecting consumers' willingness to buy.

Method used

By expressing and applying specific MdASG1 protein and its encoding genes in apples, the content of volatile alcohols, esters and aldehydes in plant fruits is regulated, thereby improving plant reversibility.

Benefits of technology

The increase in the content of volatile aroma substances in apple fruits was achieved, the fruit flavor was improved, and the plant tolerance to salt stress was improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0003789146080000011
    Figure HDA0003789146080000011
Patent Text Reader

Abstract

The present invention discloses an MdASG1 protein for regulating apple aroma synthesis and plant stress tolerance, its encoding gene, and applications. The present invention provides a protein obtained from apple, named MdASG1 protein, which is a protein composed of the amino acid sequence shown in Sequence 1 in the sequence listing. The gene encoding the MdASG1 protein, named MdASG1 gene, also belongs to the protection scope of the present invention. The present invention also protects the applications of the MdASG1 protein: regulating the content of volatile alcohols and / or volatile esters and / or volatile aldehydes in plant fruits; increasing the content of volatile alcohols and / or volatile esters and / or volatile aldehydes in plant fruits; regulating the stress tolerance of plants; increasing the stress tolerance of plants. The present invention has great application and popularization value for plant breeding, especially apple breeding and tomato breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to an MdASG1 protein for regulating apple aroma synthesis and plant stress tolerance, its coding gene and applications. Background Art

[0002] As an important economic fruit tree, apples are widely cultivated worldwide. As the world's largest apple producer, China's cultivation area and output account for approximately 50% of the world's apples. The apple industry, as a pillar industry in the dominant planting areas, is of great significance for promoting local economic benefits.

[0003] As an important secondary metabolite, aroma is widely involved in various plant life activities, including defense or attracting insects, resisting the invasion of pathogenic microorganisms, promoting seed dispersal and plant reproduction. The volatile aroma released in apple fruits, as an important sensory quality, affects consumers' preferences and the market competitiveness of products. In recent years, breeders have mainly focused on fruit yield, disease resistance, and fruit coloring, while paying less attention to fruit flavor, resulting in the lack of flavor chemicals in traditional old varieties, thus weakening consumers' desire to buy apples.

[0004] The apple aroma synthesis pathway mainly includes the lipoxygenase pathway, β-oxidation pathway, amino acid pathway, and terpene synthesis pathway. More than 300 aroma substances are produced in mature apples, mainly including esters and alcohols. The main substances in esters are hexyl acetate and 2-hexen-1-yl acetate, and the main substance in alcohols is 1-hexanol. Among them, the lipoxygenase pathway is the main contributor to the synthesis of volatile aroma in mature apples. Current research often focuses on using some cultivation measures such as using LED lights, artificial pollination, planting special pollinator trees, and applying vitamin B6 to promote the production of apple aroma substances. In addition to transcriptional regulation, some environmental factors also affect the accumulation of fruit aroma substances. Moderate stress conditions can induce the accumulation of fruit aroma substances, but the regulatory mechanism of stress-mediated aroma substance accumulation is still unclear. Summary of the Invention

[0005] The object of the present invention is to provide an MdASG1 protein for regulating apple aroma synthesis and plant stress tolerance, its coding gene and applications.

[0006] The present invention provides a protein obtained from apples, named MdASG1 protein, which is as follows (a1) or (a2):

[0007] (a1) A protein consisting of the amino acid sequence shown in Sequence 1 in the sequence listing;

[0008] (a2) A protein derived from SEQ ID NO: 1, which has substitution and / or deletion and / or addition of one or more amino acid residues in the amino acid sequence of SEQ ID NO: 1 and is related to the content of plant fruit aroma substances and / or plant stress tolerance.

[0009] To facilitate the purification and detection of the MdASG1 protein in (a1), a tag shown in Table 1 can be linked to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing.

[0010] Table 1 Sequences of tags

[0011]

[0012]

[0013] The protein in the above (a2) can be artificially synthesized, or its coding gene can be synthesized first and then obtained through biological expression. The coding gene of the protein in the above (a2) can be obtained by deleting the codons of one or more amino acid residues in the DNA sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3 in the sequence listing, and / or performing a missense mutation of one or more base pairs, and / or linking the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0014] The gene encoding the MdASG1 protein, named MdASG1 gene, also belongs to the protection scope of the present invention.

[0015] The MdASG1 gene is specifically as follows (1) or (2) or (3) or (4) or (5):

[0016] (1) A DNA molecule whose coding region is shown in SEQ ID NO: 2 in the sequence listing;

[0017] (2) A DNA molecule whose coding region is shown in the nucleotides at positions 1-1311 of SEQ ID NO: 2 in the sequence listing;

[0018] (3) The DNA molecule shown in SEQ ID NO: 3 in the sequence listing;

[0019] (4) A DNA molecule that hybridizes with the DNA sequence defined in (1) or (2) or (3) under stringent conditions and encodes the said protein;

[0020] (5) A DNA molecule that has more than 90% homology with the DNA sequence defined in (1) or (2) or (3) and encodes the said protein.

[0021] The above stringent conditions can be a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS, and hybridize and wash the membrane at 65°C in a DNA or RNA hybridization experiment.

[0022] The recombinant expression vector, expression cassette, transgenic cell line, transgenic plant tissue or recombinant bacterium containing the MdASG1 gene all fall within the protection scope of the present invention.

[0023] The present invention also protects the application of the MdASG1 protein, which is as follows (b1) and / or (b2) and / or (b3) and / or (b4):

[0024] (b1) Regulating the content of volatile alcohols and / or volatile esters and / or volatile aldehydes in plant fruits;

[0025] (b2) Increasing the content of volatile alcohols and / or volatile esters and / or volatile aldehydes in plant fruits;

[0026] (b3) Regulating the stress tolerance of plants;

[0027] (b4) Increasing the stress tolerance of plants.

[0028] The regulation is positive regulation.

[0029] When the content of the MdASG1 protein increases, the content of volatile alcohols and / or volatile esters and / or volatile aldehydes in plant fruits increases.

[0030] When the content of the MdASG1 protein increases, the stress tolerance of plants increases.

[0031] The present invention also protects the following application of the MdASG1 gene: cultivating transgenic plants with increased content of volatile alcohols and / or volatile esters and / or volatile aldehydes in fruits.

[0032] The present invention also protects the following application of the substance for inhibiting the expression of the MdASG1 gene: cultivating transgenic plants with decreased content of volatile alcohols and / or volatile esters and / or volatile aldehydes in fruits.

[0033] The present invention also protects the application of the MdASG1 gene in cultivating transgenic plants with increased stress tolerance.

[0034] The present invention also provides a method for cultivating transgenic plants, which includes the following steps: introducing the MdASG1 gene into a starting plant to obtain a transgenic plant with a content of volatile alcohols and / or volatile esters and / or volatile aldehydes in fruits higher than that of the starting plant.

[0035] The present invention also protects a method for cultivating transgenic plants, which includes the following steps: introducing the MdASG1 gene into a starting plant to obtain a transgenic plant with a stress tolerance higher than that of the starting plant.

[0036] Specifically, the MdASG1 gene can be introduced into the starting plant through a recombinant expression vector containing the MdASG1 gene.

[0037] An existing plant expression vector can be used to construct a recombinant expression vector containing the MdASG1 gene. When using the MdASG1 gene to construct a recombinant expression vector, any one of enhancer-type, constitutive, tissue-specific or inducible promoters can be added before the transcription start nucleotide, and they can be used alone or in combination with other plant promoters; in addition, when using the MdASG1 gene to construct a recombinant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be the ATG start codon or the start codon in the adjacent region, etc., but must be in the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signals and start codons are extensive and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene. For the convenience of identifying and screening transgenic plant cells or plants, the used plant expression vector can be processed, such as adding a gene that can produce a color change enzyme or a luminescent compound in plants, an antibiotic marker with resistance, or an anti-chemical reagent marker gene, etc. Considering the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened by phenotype. The starting vector of the recombinant expression vector can be the pCB302 vector or the pHB vector. The specific recombinant expression vector can be the following recombinant plasmid: replacing the small fragment between the HindⅢ and BamHⅠ restriction enzyme sites in the pHB vector with the DNA molecule shown by the 1st to 1311th nucleotides in Sequence 2 of the sequence listing. The specific recombinant expression vector can be the following recombinant plasmid: replacing the small fragment between the BamHI and StuI restriction enzyme sites in the pCB302 vector with the DNA molecule shown by the 1st to 1311th nucleotides in Sequence 2 of the sequence listing.

[0038] The substance for inhibiting the expression of the MdASG1 gene can specifically be an interfering vector targeting the MdASG1 gene.

[0039] Any of the above-mentioned plants can be a monocotyledonous plant or a dicotyledonous plant.

[0040] The dicotyledonous plant can specifically be a Rosaceae plant. The Rosaceae plant can specifically be a Malus plant. The Malus plant can specifically be Malus domestica, and more specifically be 'Otome' apple.

[0041] The dicotyledonous plant can specifically be a Solanaceae plant. The Solanaceae plant can specifically be a Solanum plant. The Solanum plant can specifically be Solanum lycopersicum, and more specifically be Micro-Tom tomato.

[0042] Any of the above-mentioned volatile alcohols can be 1-hexanol.

[0043] Any of the above-mentioned volatile esters can be hexyl acetate and / or 2-hexen-1-yl acetate.

[0044] Any of the above stress tolerances may be stress tolerance to salt stress.

[0045] The present invention has great application and popularization value for plant breeding, especially apple breeding and tomato breeding. Brief Description of the Drawings

[0046] Figure 1 Results of the relative expression level of the MdASG1 gene and the content of volatile compounds in Example 2.

[0047] Figure 2 Results of the correlation analysis of the relative expression level of the MdASG1 gene and the content of volatile compounds in Example 2.

[0048] Figure 3 Results of subcellular localization in Example 3.

[0049] Figure 4 Results of the relative expression level of the MdASG1 gene in Example 4.

[0050] Figure 5 Results of the contents of esters and alcohols in volatile substances in Example 4.

[0051] Figure 6 Results of the contents of 1-hexanol, hexyl acetate, and 2-hexen-1-yl acetate in volatile substances in Example 4.

[0052] Figure 7 Relevant mass spectrometry diagrams of 1-hexanol, hexyl acetate, and 2-hexen-1-yl acetate in volatile substances in Example 4.

[0053] Figure 8 Results of the contents of aldehydes and alcohols in volatile substances in Example 5.

[0054] Figure 9 Plant photos during salt stress treatment in Example 5.

[0055] Figure 10 Results of the contents of aldehydes and alcohols in volatile substances under salt stress conditions in Example 5.

[0056] Figure 11 Results of the MdASG1 gene in response to salt stress in Example 6. Detailed Description of the Invention

[0057] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not constitute any limitation to the present invention in any way. The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified. Unless otherwise specified, the quantitative tests in the following embodiments are all set with more than three repeated experiments, and the results are averaged. MS: Qingdao Haibo Biotechnology, product catalog number HB8469-5. 1 / 2MS: Qingdao Haibo Biotechnology, product catalog number HB8469-6. Agrobacterium tumefaciens GV3101 (pSoup-p19) competent cells: Shanghai Weidi Biotechnology Co., Ltd.; CAT# is AC1003.

[0058] The method for detecting the content of volatile compounds in the test samples is as follows:

[0059] Transfer the fresh pulp (5 g) cut into pieces to a 50 mL conical flask, and then add 10 μL of 0.4 mg·mL -1 3-nonanone solution (the preparation method of 3-nonanone solution: first dissolve it with absolute ethanol, and then make up the volume with water) (3-nonanone is used as the internal standard), seal the bottle mouth with tin foil, first equilibrate at 45 °C for 5 min, and then extract at 45 °C for 40 minutes.

[0060] An SPME fiber extraction head coated with a 50 / 30 μm divinylbenzene / carboxy / polydimethylsiloxane layer (50 / 30 μm DVB / CAR / PDMS, Supelco) is used to collect volatiles. A gas chromatography-mass spectrometer (GCMS-QP2010, Shimadzu) is equipped with an Rtx-5MS capillary column (30 m × 0.25 mm i.d. × 0.25 μm film thickness, Restek). High-purity helium is used as the carrier gas with a constant flow rate of 2 mL·min -1 . The initial temperature of gas chromatography is set at 35 °C, maintained at 35 °C for 2 min, and then increased at 6 °C·min -1 to 120 °C, and then increased at 10 °C·min -1 to 180 °C, and finally increased at 20 °C·min -1 to 250 °C, and maintained at 250 °C for 5 minutes. The transfer, MS source, and interface temperatures are 250 °C, 200 °C, and 230 °C in sequence. Mass spectra are obtained with an electron ionization energy of 70 eV, and the mass scan is completed in the range of 30-500 m / z.

[0061] Individual compounds in the volatiles were identified by matching with the NIST / EPA / NIH Mass Spectral Library (NIST 2017) and comparing with the linear retention index (LRI) values. The relative content of each compound in the volatiles was determined based on the total ion chromatogram (TIC) with reference to the internal standard peak area, and then the content of each compound in the volatiles was calculated according to the internal standard content. Finally, the content of each volatile compound in the pulp per unit mass of fresh weight (unit: μg × g -1 FW) was calculated.

[0062] The sum of the contents of all ester volatile compounds is the ester content, the sum of the contents of all alcohol volatile compounds is the alcohol content, and the sum of the contents of all aldehyde volatile compounds is the aldehyde content. Apples were tested for ester and alcohol contents. Tomatoes were tested for aldehyde and alcohol contents.

[0063] The pHB vector (i.e., the "pHB vector" in the literature), pTRV2 vector (i.e., the "pTRV2 vectors" in the literature), and pTRV1 vector (i.e., the "pTRV1 vector" in the literature) are all described in the following literature: JrWRKY21 interacts with JrPTI5L to activate the expression of JrPR5L for resistance to Colletotrichum gloeosporioides in walnut; The Plant Journal, (2022), doi: 10.1111 / tpj.15883.

[0064] The pCB302 vector (i.e., the "pCB302 vector" in the literature) is described in the following literature: Activation of disease resistance against Botryosphaeria dothidea by downregulating the expression of MdSYP121 in apple; He et al. Horticulture Research (2018) 5:24; DOI 10.1038 / s41438-018-0030-5.

[0065] Example 1. Discovery of the MdASG1 Protein and Its Encoding Gene

[0066] The inventors discovered a new protein from the mature fruits of 'Taishan Zaoxia' apples, named MdASG1 protein, as shown in Sequence 1 of the sequence listing.

[0067] The gene encoding the MdASG1 protein is named the MdASG1 gene.

[0068] In the cDNA, the open reading frame encoding the MdASG1 protein is as shown in Sequence 2 of the Sequence Listing.

[0069] In the genomic DNA, the MdASG1 gene is as shown in Sequence 3 of the Sequence Listing.

[0070] Example 2. Correlation between MdASG1 Gene Expression and Total Ester Content in Pulp

[0071] The test samples were respectively the mature fruits of 'Granny Smith', 'Fuji', 'Yanfu3', 'Harlikar', 'Taishanzaoxia', 'Golden Delicious', 'Royal Gala' and 'Starkrimson'.

[0072] I. Detect the relative expression level of the MdASG1 gene.

[0073] Take the test samples, extract total RNA, and reverse transcribe to obtain cDNA. Using the cDNA as a template and the MdActin gene as an internal reference gene, detect the relative expression level of the MdASG1 gene in the test samples.

[0074] The primers used to detect the MdASG1 gene are as follows:

[0075] F1: TCATAGACACAGACAGACAGA;

[0076] R1: GACGAAACCACCCACAAA.

[0077] The primers used to detect the internal reference gene are as follows:

[0078] F2: TGACCGAATGAGCAAGGAAATTACT;

[0079] R2: TACTCAGCTTTGGCAATCCACATC.

[0080] The results are shown in Figure 1 A.

[0081] II. Take the test samples and detect the content of volatile compounds.

[0082] Set 3 biological replicates for each test sample.

[0083] The results are shown in Figure 1 B.

[0084] III. Correlation analysis was performed on the variables using SPSS 22.

[0085] The results are shown in Figure 2 . The results showed that the relative expression level of the MdASG1 gene was significantly positively correlated with the ester content, and the correlation reached 82.07%. These results indicate that the MdASG1 protein is a candidate protein involved in the lipoxygenase pathway.

[0086] Example 3. Subcellular localization

[0087] The coding region of the MdASG1 gene was cloned and ligated to the pHB vector by homologous recombination to obtain the recombinant plasmid 35S:MdASG1-GFP. The recombinant plasmid 35S:MdASG1-GFP was introduced into the competent cells of Agrobacterium tumefaciens GV3101 (pSoup-p19) to obtain recombinant Agrobacterium. An infection solution was prepared with the recombinant Agrobacterium, and then the lower epidermal cells of tobacco were injected. Then, the tobacco plants were placed in the dark for 2 days.

[0088] The pHB vector was used as a control for the recombinant plasmid 35S:MdASG1-GFP and was designated as 35S:GFP in the figure.

[0089] The lower epidermis of tobacco was torn off and observed for fluorescence signals under a laser confocal microscope (LSM880).

[0090] The results are shown in Figure 3 . The MdASG1 protein was evenly distributed in the nucleus and cytoplasm.

[0091] Example 4. Transient transfection assay

[0092] I. Construction of overexpression vector

[0093] 1. Synthesize the double-stranded DNA molecule shown in Sequence 2 of the sequence listing.

[0094] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, perform PCR amplification with the primer pair consisting of F3 and R3, and recover the PCR amplification product.

[0095] F3: accagtctctctctc aagctt ATGGATCCTCAGGCTTTTATTAGG;

[0096] R3: gcccttgctcaccat ggatcc TATAGAAGGGCAGGAGGTTTTCC.

[0097] 3. Take the pHB vector and perform double digestion with the restriction enzymes HindIII and BamHI, and recover the vector backbone of about 12000 pb.

[0098] 4. The PCR amplification products recovered in Step 2 and the vector backbone obtained in Step 3 were subjected to homologous recombination to obtain an overexpression vector, named recombinant plasmid 35S:MdASG1-GFP. The recombinant plasmid 35S:MdASG1-GFP has been verified by sequencing. Compared with the pHB vector, the difference of the recombinant plasmid 35S:MdASG1-GFP lies only in that a small fragment between the HindⅢ and BamHⅠ restriction enzyme cleavage sites in the pHB vector was replaced with the DNA molecule shown by the 1st to 1311th nucleotides in Sequence 2 of the Sequence Listing.

[0099] II. Construction of interference vector

[0100] 1. Synthesize the double-stranded DNA molecule shown in Sequence 2 of the Sequence Listing.

[0101] 2. Using the double-stranded DNA molecule obtained in Step 1 as a template, perform PCR amplification with the primer pair consisting of F4 and R4, and recover the PCR amplification products.

[0102] F4: gtgagtaaggttacc gaattc GAATGCCAGGAGGCCGTG;

[0103] R4: gagacgcgtgagctc ggtacc AGGGCAGGAGGTTTTCCTGA.

[0104] 3. Take the pTRV2 vector, perform double digestion with the restriction enzymes EcoRI and KpnI, and recover the vector backbone of about 9000 bp.

[0105] 4. The PCR amplification products obtained in Step 2 and the vector backbone obtained in Step 3 were subjected to homologous recombination to obtain an interference vector, named recombinant plasmid TRV-MdASG1. The recombinant plasmid TRV-MdASG1 has been verified by sequencing. Compared with the pTRV2 vector, the difference of the recombinant plasmid TRV-MdASG1 lies only in that a small fragment between the EcoRI and KpnI restriction enzyme cleavage sites in the pTRV2 vector was replaced with the DNA molecule shown in Sequence 4 of the Sequence Listing.

[0106] III. Preparation of infection solution

[0107] Infection buffer: containing 10 mM MgCl 2 , 10 mM MES and 150 μM acetosyringone, with the balance being water.

[0108] 1. Prepare the infection solution for the overexpression experimental group and the corresponding control group infection solution.

[0109] (1) Introduce the recombinant plasmid 35S: MdASG1-GFP into the competent cells of Agrobacterium tumefaciens GV3101 (pSoup-p19) to obtain recombinant Agrobacterium tumefaciens.

[0110] (2) Take the cells of the recombinant Agrobacterium tumefaciens obtained in step (1) and suspend them in the infection buffer to obtain a bacterial solution with an OD 600nm of 1.0, which is the infection solution for the overexpression experimental group and is named the 35S::MdASG1 infection solution.

[0111] (3) Introduce the pHB vector into the competent cells of Agrobacterium tumefaciens GV3101 (pSoup-p19) to obtain recombinant Agrobacterium tumefaciens.

[0112] (4) Take the cells of the recombinant Agrobacterium tumefaciens obtained in step (3) and suspend them in the infection buffer to obtain a bacterial solution with an OD 600nm of 1.0, which is the infection solution for the control group and is named the 35S::GFP infection solution.

[0113] 2. Prepare the infection solution for the interference experimental group and the corresponding control group.

[0114] Introduce the recombinant plasmid TRV-MdASG1 into the competent cells of Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium tumefaciens, named recombinant Agrobacterium tumefaciens A. Suspend the cells of recombinant Agrobacterium tumefaciens A in the infection buffer to obtain a bacterial solution with an OD 600nm of 1.0, named bacterial solution A.

[0115] Introduce the pTRV2 vector into the competent cells of Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium tumefaciens, named recombinant Agrobacterium tumefaciens B. Suspend the cells of recombinant Agrobacterium tumefaciens B in the infection buffer to obtain a bacterial solution with an OD 600nm of 1.0, named bacterial solution B.

[0116] Introduce the pTRV1 vector into the competent cells of Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium tumefaciens, named recombinant Agrobacterium tumefaciens C. Suspend the cells of recombinant Agrobacterium tumefaciens C in the infection buffer to obtain a bacterial solution with an OD 600nm of 1.0, named bacterial solution C.

[0117] Mix bacterial solution A and bacterial solution C in equal volumes to obtain the infection solution for the interference experimental group, named the TRV-MdASG1 infection solution.

[0118] Mix bacterial solution B and bacterial solution C in equal volumes to obtain the infection solution for the control group, named the TRV infection solution.

[0119] IV. Transient transfection

[0120] Test inoculation solution: 35S::MdASG1 inoculation solution, 35S::GFP inoculation solution, TRV-MdASG1 inoculation solution or TRV inoculation solution. The injection site refers to the area within a radius of 1 cm around the injection point.

[0121] 1. Pick uncolored 'Otome' apple fruits and inject the test inoculation solution (the newly prepared inoculation solution is allowed to stand in the dark for 3 hours before injection. The injection needle is obliquely inserted into the apple fruit about 1 mm; 4 - 6 injection points are evenly set on each apple fruit, and 500 μL of inoculation solution is injected at each injection point). Then place the fruits in an environment of 24°C, 16 h light / 8 h dark for 3 days. Conduct three replicate experiments, and each replicate experiment uses 15 apples for each inoculation solution.

[0122] 2. After placing for 3 days in step 1, sample the pulp from the injection site and detect the relative expression level of the MdASG1 gene.

[0123] The detection method is the same as step one of Example 2.

[0124] The results are shown in Figure 4 . Figure 4 Among them, -1, -2, -3 represent different apples injected with the same inoculation solution respectively. After transient overexpression of the MdASG1 gene, the expression level of the MdASG1 gene increased by about 1 fold. After transient silencing of the MdASG1 gene, the expression level of the MdASG1 gene decreased.

[0125] 3. After placing for 7 days in step 1, sample the pulp from the injection site as the test sample and detect the content of volatile compounds.

[0126] The results of the ester content and alcohol content are shown in Figure 5 . Figure 5 Among them, -1, -2, -3 represent different apples injected with the same inoculation solution respectively. After transient overexpression of the MdASG1 gene, the alcohols and esters showed a significant increasing trend. After transient silencing of the MdASG1 gene, the alcohols and esters showed a significant decreasing trend.

[0127] When the volatile compounds as the detection targets are 1-hexanol, hexyl acetate and 2-hexen-1-yl acetate, the exemplary mass spectra are shown in Figure 7 , and the average value results of the volatile compound content are shown in Figure 6 . After transient overexpression of the MdASG1 gene, the contents of 1-hexanol, hexyl acetate and 2-hexen-1-yl acetate are all significantly higher than those of the corresponding empty vector control treatment. After transient silencing of the MdASG1 gene, the contents of 1-hexanol, hexyl acetate and 2-hexen-1-yl acetate are all significantly lower than those of the corresponding empty vector control treatment.

[0128] The above results show that:

[0129] The MdASG1 protein positively regulates the contents of 1-hexanol, hexyl acetate, and 2-hexen-1-yl acetate in apple fruits;

[0130] The MdASG1 protein positively regulates the contents of alcohols and esters in apple fruits;

[0131] The MdASG1 protein positively regulates the synthesis of apple aroma substances.

[0132] Example 5. Obtaining and Identification of Transgenic Plants

[0133] I. Construction of Overexpression Vector

[0134] 1. Synthesize the double-stranded DNA molecule shown in Sequence 2 of the Sequence Listing.

[0135] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, perform PCR amplification with the primer pair composed of F5 and R5, and recover the PCR amplification product.

[0136] F5: ctccccttgctccgt ggatcc ATGGATCCTCAGGCTTTTATTAGG;

[0137] R5: aacgtcgtatgggta aggcct TATAGAAGGGCAGGAGGTTTTCC.

[0138] 3. Take the pCB302 vector, perform double digestion with restriction endonucleases BamHI and StuI, and recover the vector backbone of about 7000 pb.

[0139] 4. Perform homologous recombination on the PCR amplification product recovered in step 2 and the fragment obtained in step 3 to obtain an overexpression vector, named recombinant plasmid pCB302-MdASG1. The recombinant plasmid pCB302-MdASG1 has been verified by sequencing. Compared with the pCB302 vector, the difference of the recombinant plasmid pCB302-MdASG1 is only that: the small fragment between the BamHI and StuI restriction sites in the pCB302 vector is replaced by the DNA molecule shown by the 1st to 1311th nucleotides in Sequence 2 of the Sequence Listing.

[0140] II. Tomato Genetic Transformation

[0141] 1. Obtaining of Tomato Explants

[0142] (1) Pick plump seeds of Micro-Tom tomatoes, soak the seeds in a 40 °C water bath for 30 min, disinfect with 70% ethanol for 30 sec, rinse with sterile water 4 times, then disinfect with 8% hypochlorous acid solution for 10 min, and rinse with sterile water 7 times, and blot dry the surface moisture.

[0143] (2) Spread the seeds that have completed step (1) on the MS solid medium and incubate them in the dark at 24 °C until the seeds germinate, then transfer them to a light incubator at 24 °C and culture until the two cotyledons are fully expanded.

[0144] MS solid medium (pH 5.8 - 6.0): containing 4.74 g / L MS, 7 g / L agar, and 30 g / L sucrose, with the balance being water.

[0145] (3) After completing step (2), excise the cotyledons, cut off the petioles and tips among them, and then place the cotyledons with the wound facing down flat on the MS co-culture medium and incubate them in the dark at 24 °C for 2 d.

[0146] MS co-culture medium (pH 5.8 - 6.0): containing 4.74 g / L MS, 7 g / L agar, 30 g / L sucrose, 0.5 mg / L auxin, and 2 mg / L zeatin, with the balance being water.

[0147] 2. Preparation of infection solution

[0148] Introduce the recombinant plasmid pCB302-MdASG1 into the competent cells of Agrobacterium tumefaciens LBA4404 to obtain recombinant Agrobacterium. Suspend the recombinant Agrobacterium cells in the MS liquid medium containing 100 μM acetosyringone to obtain the infection solution.

[0149] Compared with the MS solid medium, the difference in the MS liquid medium is only that agar is not added.

[0150] 3. Infection, induction of differentiation, and rooting

[0151] (1) Place the cotyledons that have completed step 1 in the infection solution prepared in step 2, incubate at room temperature and 160 rpm for 15 min, then take out the cotyledons, blot the surface bacterial liquid with sterile filter paper, and then place them on the MS co-culture medium containing 100 μM ACE and culture in the dark at 24 °C for 2 days.

[0152] (2) After completing step (1), transfer the cotyledons to the differentiation medium and culture them under the conditions of 24 °C, 16 h light / 8 h dark, and change the differentiation medium every 2 weeks until young shoots grow and the shoot length reaches 2 - 4 cm.

[0153] Differentiation medium (pH 5.8 - 6.0): containing 4.74 g / L MS, 7 g / L agar, 30 g / L sucrose, 0.5 mg / L auxin, 2 mg / L zeatin, 300 mg / L sodium penicillin, 140 μL / L 10% herbicide, with the balance being water.

[0154] (3) Transfer the explants with buds obtained in step (2) to the rooting medium and culture them under the conditions of 24°C, 16 h light / 8 h dark until roots grow and the plant height reaches 10 cm.

[0155] Rooting medium (pH 5.8 - 6.0): containing 2.47 g / L 1 / 2MS, 7 g / L agar, 30 g / L sucrose, 0.1 mg / L auxin, 300 mg / L sodium penicillin, 140 μL / L 10% herbicide, with the balance being water.

[0156] (4) Transplant the rooted plants obtained in step (3) into nutrient soil and culture them normally. Extract the genomic DNA of the plant leaves and perform PCR identification.

[0157] The primers for PCR identification are as follows (the target sequence is 1447 bp):

[0158] 188F: CCTCTCACCTTTTCGCTGTAC;

[0159] R: TATAGAAGGGCAGGAGGTTTTCC.

[0160] 4. Obtain transgenic lines

[0161] The plants identified as positive by PCR in step 3 (4) are harvested for seeds by self-pollination, which are the T 0 -generation seeds.

[0162] T 0 The plants grown from the T 1 -generation seeds are the T

[0163] T 1 -generation plants. The T 1 -generation plants are harvested for seeds by self-pollination, which are the T

[0164] T 1 The plants grown from the T 2 -generation seeds are the T

[0165] Perform PCR identification on each T 1 -generation plant and T 2 -generation plant respectively, with the method the same as that in step 3 (4).

[0166] For a certain T 1 -generation plant, if both it and the T 2 -generation plants obtained by its self-pollination are identified as positive by PCR, the self-crossed offspring of this T 1 -generation plant is a homozygous transgenic MdASG1 gene line.

[0167] III. Trait identification

[0168] Test plants: T 3 -generation plants of three homozygous transgenic MdASG1 lines (MdASG1-3 line, MdASG1-6 line, MdASG1-9 line), and Micro-Tom tomato plants (denoted as WT). There were at least 6 plants in each line.

[0169] The test plants were cultivated under parallel conditions until mature fruits were obtained.

[0170] The pulp of mature fruits was taken as the test sample to detect the content of volatile compounds.

[0171] The results of aldehyde content and alcohol content are shown in Figure 8 . Compared with the fruits of wild-type Micro-Tom tomatoes, the aldehyde content and alcohol content in the fruits of transgenic tomatoes were significantly increased. The results indicate that MdASG1 protein promotes the accumulation of fruit fatty acid-derived volatiles.

[0172] IV. Salt stress treatment

[0173] Test plants: T 3 -generation plants of three homozygous transgenic MdASG1 lines (MdASG1-3 line, MdASG1-6 line, MdASG1-9 line), and Micro-Tom tomato plants. There were at least 6 plants in each line.

[0174] The tomatoes were planted in square plastic pots (10 cm in top side length, 7.5 cm in bottom side length, 8.5 cm in height) and watered normally before salt stress treatment.

[0175] Tomato plants that were one month old and had uniform growth were selected and grouped for treatment:

[0176] Experimental group: Every 4 days, 500 mL of MS liquid medium containing 200 mM NaCl was irrigated until the fruits matured;

[0177] Control group: Every 4 days, 500 mL of MS liquid medium was irrigated until the fruits matured.

[0178] The phenotypes of the plants were continuously observed during the grouping treatment. The photos of the plants during the grouping treatment are shown in Figure 9 . The transgenic MdASG1 tomato plants had stronger tolerance to salt stress and lower leaf wilting degree.

[0179] The pulp of mature fruits was taken as the test sample to detect the content of volatile compounds. The results are shown in Figure 10, WT represents the control group of Micro-Tom tomato plants, WT-NaCl represents the experimental group of Micro-Tom tomato plants, MdASG1 represents the control group of tomato plants of the transgenic MdASG1 gene line (the average value of three lines), and MdASG1-NaCl represents the experimental group of tomato plants of the transgenic MdASG1 gene line (the average value of three lines). After salt treatment, the aldehyde content and alcohol content in the fruits of wild-type and transgenic MdASG1 tomatoes both increased correspondingly, especially the increase in the content induced by salt stress in the fruits of transgenic MdASG1 tomatoes was greater.

[0180] The above results indicate that moderate salt stress can promote the accumulation of aroma substances, and at the same time, the MdASG1 protein may participate in the salt stress pathway to promote the accumulation of higher levels of volatile aroma compounds in fruits.

[0181] Example 6. MdASG1 Gene Responds to Salt Stress

[0182] The shoot tips of 25-day-old 'Royal Gala' tissue culture seedlings were cut and transferred to a liquid MS medium containing 200 mM NaCl for soaking treatment for 12, 24, and 48 h. Then, samples were taken, frozen in liquid nitrogen, RNA was extracted, and reverse transcription was performed to analyze the relative expression level of the MdASG1 gene by fluorescence quantitative analysis.

[0183] The results are shown in Figure 11 . With the increase of the treatment time, the expression level of the MdASG1 gene showed an upward trend, indicating that MdASG1 responds to salt stress.

[0184] The above details the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that are outside the scope disclosed in this application. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. Use of MdASG1 protein in increasing volatile alcohols and / or volatile esters in apple fruits; the MdASG1 protein is a protein consisting of the amino acid sequence shown in Sequence 1 in the Sequence Listing.

2. Use of MdASG1 protein in increasing volatile alcohols and / or volatile aldehydes in tomato fruits; the MdASG1 protein is a protein consisting of the amino acid sequence shown in Sequence 1 in the Sequence Listing.

3. Use of MdASG1 protein in increasing the salt tolerance of tomatoes; the MdASG1 protein is a protein consisting of the amino acid sequence shown in Sequence 1 in the Sequence Listing.

4. MdASG1 Use of a gene in cultivating a transgenic apple with increased contents of volatile alcohols and / or volatile esters in fruits; the MdASG1 gene is a gene encoding an MdASG1 protein; the MdASG1 protein is a protein consisting of the amino acid sequence shown in Sequence 1 in the Sequence Listing.

5. The application according to claim 4, characterized in that: The said MdASG1 gene is as follows (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is the DNA molecule shown by nucleotides 1-1311 in Sequence 2 in the Sequence Listing; (3) The DNA molecule shown in Sequence 3 in the Sequence Listing.

6. MdASG1 Use of a gene in cultivating transgenic tomatoes with increased contents of volatile alcohols and / or volatile aldehydes in fruits; the MdASG1 gene is a gene encoding an MdASG1 protein; the MdASG1 protein is a protein consisting of the amino acid sequence shown in Sequence 1 in the Sequence Listing.

7. The application according to claim 6, characterized in that: The said MdASG1 The gene is as follows (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is the DNA molecule shown by nucleotides 1-1311 in Sequence 2 in the Sequence Listing; (3) The DNA molecule shown in Sequence 3 in the Sequence Listing.

8. MdASG1 Use of a gene in cultivating transgenic tomatoes with increased salt tolerance; the MdASG1 gene is a gene encoding an MdASG1 protein; the MdASG1 protein is a protein consisting of the amino acid sequence shown in Sequence 1 in the sequence listing.

9. The application according to claim 8, characterized in that: The said MdASG1 The gene is as follows (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is the DNA molecule shown by nucleotides 1-1311 in Sequence 2 in the Sequence Listing; (3) The DNA molecule shown in Sequence 3 in the Sequence Listing.

10. A method for cultivating transgenic apples, comprising the following steps: introducing the MdASG1 gene into the starting apples to obtain transgenic apples with a content of volatile alcohols and / or volatile esters in the fruits higher than that of the starting apples; the MdASG1 gene is a gene encoding the MdASG1 protein; the MdASG1 protein is a protein composed of the amino acid sequence shown in Sequence 1 in the sequence listing.

11. The method according to claim 10, characterized in that: The said MdASG1 The gene is as follows (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is the DNA molecule shown by nucleotides 1-1311 in Sequence 2 in the Sequence Listing; (3) The DNA molecule shown in Sequence 3 in the Sequence Listing.

12. A method for cultivating transgenic tomatoes, comprising the following steps: introducing the MdASG1 gene into the starting tomatoes to obtain transgenic tomatoes with a content of volatile alcohols and / or volatile aldehydes in the fruits higher than that of the starting tomatoes; the MdASG1 gene is a gene encoding the MdASG1 protein; the MdASG1 protein is a protein composed of the amino acid sequence shown in Sequence 1 in the sequence listing.

13. The method according to claim 12, characterized in that: The said MdASG1 The gene is as follows: (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is the DNA molecule shown by nucleotides 1-1311 in Sequence 2 in the Sequence Listing; (3) The DNA molecule shown in Sequence 3 in the Sequence Listing.

14. A method for cultivating transgenic tomatoes, comprising the following steps: introducing the MdASG1 gene into the starting tomatoes to obtain transgenic tomatoes with salt tolerance higher than that of the starting tomatoes; the MdASG1 gene is a gene encoding the MdASG1 protein; the MdASG1 protein is a protein composed of the amino acid sequence shown in Sequence 1 in the sequence listing.

15. The method according to claim 14, characterized in that: The said MdASG1 The gene is as follows (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is the DNA molecule shown by nucleotides 1-1311 in Sequence 2 in the Sequence Listing; (3) The DNA molecule shown in Sequence 3 in the Sequence Listing.

16. Use of a substance for inhibiting MdASG1 gene expression: cultivating transgenic apples with reduced contents of volatile alcohols and / or volatile esters in fruits; the substance for inhibiting MdASG1 gene expression is an interfering vector targeting the MdASG1 gene; the MdASG1 gene is a gene encoding the MdASG1 protein; the MdASG1 protein is a protein composed of the amino acid sequence shown in Sequence 1 in the sequence listing.