Application of Interference with the Expression of the Lepidoptera Conserved Gene LSCG6 in the Control of Lepidoptera Pests
By using RNAi technology to target and inhibit the expression of the LSCG6 gene in lepidopteran pests, the problem of lepidopteran pest control has been solved, and effective control of Asian corn borer and rice stem borer has been achieved, especially in rice cultivation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-17
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies are insufficient to effectively control lepidopteran pests, such as the Asian corn borer and the rice stem borer. In particular, the control of the rice stem borer is of great significance in rice cultivation. RNAi technology has broad application prospects in the control of lepidopteran pests, but there is a lack of targeted inhibition methods for the conserved lepidopteran gene LSCG6.
Using RNA interference (RNAi) technology, specific dsRNAs were designed and synthesized to reduce or inhibit the transcription and translation of the LSCG6 gene in lepidopteran pests through injection or feeding, thereby affecting the development and survival of the pests.
It significantly reduces the egg turning rate and hatching rate of silkworms, affects the development of Asian corn borer and rice stem borer larvae and even causes death, providing a new method for the population control of lepidopteran pests.
Smart Images

Figure CN115925859B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the application of interfering with the expression of the conserved Lepidoptera gene LSCG6 in the control of Lepidoptera pests. Background Technology
[0002] Insects, as one of the most diverse groups of species on Earth, are closely related to our lives. Among insects, most moths and butterflies in the order Lepidoptera are pests that cause serious damage to agriculture. Therefore, it is necessary and important to find methods for controlling Lepidoptera pests.
[0003] The silkworm is a holometabolous insect, classified in entomological terms as Arthropoda, Insecta, Lepidoptera, Bombyx mori, and Bombyx genus. Its life cycle consists of four stages: egg, larva, pupa, and adult. The larval stage is generally divided into five instars, requiring four molts. The silkworm's molting and metamorphosis are regulated by a complex network of systems. The silkworm is not only an important economic insect but also a model organism for research. As a representative of Lepidoptera research, studying the silkworm can provide insights and methods for the control of Lepidoptera pests.
[0004] The Asian corn borer is an insect belonging to the family Pyralidae in the order Lepidoptera. It is distributed throughout most parts of my country and mainly damages crops such as corn. Adults are capable of long-distance migration, and under suitable temperature conditions, the larvae can have multiple generations per year, damaging corn at various stages of its growth.
[0005] The rice stem borer (Chilodonella spp.) belongs to the family Pyralidae in the order Lepidoptera. It is widely distributed in my country and worldwide, and is particularly detrimental to rice, boring into the rice stems and damaging young panicles and heading stages, causing whiteheads and partially withered panicles. Controlling the rice stem borer is of paramount importance for China, the world's largest rice-producing country.
[0006] RNA interference (RNAi) refers to the technology of introducing double-stranded RNA (composed of the sense and antisense RNA) into cells, which causes specific degradation of the mRNA, leading to the silencing of its corresponding gene. This technology was named one of the top ten scientific advances of 2001 by *Science* magazine and is currently used in many species, including *Arabidopsis thaliana*, *Pseudomonas erythropterus*, *Drosophila melanogaster*, and silkworm. This technology can target and inhibit gene expression, and it shows great promise for molecular target control of lepidopteran pests.
[0007] The LSCG6 gene is conserved in Lepidoptera. Analysis revealed that this gene is expressed throughout the entire life cycle, with slightly higher expression during the egg and adult stages. Using RNAi to reduce the expression of this gene is essential for validating feasible molecular targets for pest control in Lepidoptera. Summary of the Invention
[0008] In view of this, one objective of the present invention is to provide an application of interfering with the expression of the Lepidoptera conserved gene LSCG6 in the control of Lepidoptera pests. The evolutionarily conserved Lepidoptera gene LSCG6 affects the growth and development of Lepidoptera pests. Silencing this gene will affect their development and survival, thus providing a molecular target for the control of Lepidoptera pests. Another objective of the present invention is to provide a method for the control of Lepidoptera pests, using the Lepidoptera conserved gene LSCG6 as a target to reduce or inhibit the transcription and translation of the Lepidoptera conserved gene LSCG6, thereby increasing the mortality rate of Lepidoptera pests.
[0009] To achieve the above objectives, the present invention provides the following technical solution:
[0010] 1. Application of interference with the expression of the conserved Lepidoptera gene LSCG6 in the control of Lepidoptera pests.
[0011] Preferably, the gene LSCG6 of this invention is derived from silkworm, Asian corn borer, or rice stem borer.
[0012] Preferably, the amino acid sequence of the protein encoded by the silkworm LSCG6 gene is shown in SEQ ID NO.2, and the nucleotide sequence of the silkworm LSCG6 gene is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the Asian corn borer LSCG6 gene is shown in SEQ ID NO.11, and the nucleotide sequence of the Asian corn borer LSCG6 gene is shown in SEQ ID NO.10; the amino acid sequence of the protein encoded by the rice stem borer LSCG6 gene is shown in SEQ ID NO.20, and the nucleotide sequence of the silkworm LSCG6 gene is shown in SEQ ID NO.19.
[0013] 2. A method for controlling lepidopteran pests
[0014] The method involves targeting the conserved lepidopteran gene LSCG6 to reduce or inhibit the transcription and translation of LSCG6, thereby increasing the mortality rate of lepidopteran pests.
[0015] Preferably, the method for reducing or inhibiting is gene mutation, gene silencing, or gene knockout.
[0016] In a preferred embodiment of the present invention, the gene silencing method is to reduce the expression of the LSCG6 gene using RNAi.
[0017] In a preferred embodiment of the present invention, the RNAi method involves designing dsRNA primers with added T7 adapters based on the cDNA sequence of the LSCG6 gene, synthesizing dsRNA sequences, and using the dsRNA to reduce the expression of the LSCG6 gene in the target species by injection or feeding.
[0018] Preferably, the dsRNA sequence is shown in SEQ ID NO.5.
[0019] Preferably, the dsRNA sequence is shown in SEQ ID NO.14.
[0020] Preferably, the dsRNA sequence is shown in SEQ ID NO.23.
[0021] The beneficial effects of this invention are as follows:
[0022] This invention targets the LSCG6 gene, reducing its expression level, which can decrease the rate of silkworm egg development and hatching; it can also affect the development of Asian corn borer and rice stem borer larvae, even causing death. This invention can be used for population control of lepidopteran pests, providing a new entry point for pest control. Attached Figure Description
[0023] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:
[0024] Figure 1 For LSCG6 gene multiple sequence alignment;
[0025] Figure 2 Collinearity analysis of the LSCG6 gene;
[0026] Figure 3 To investigate the interference of LSCG6 in silkworm eggs;
[0027] A: Expression of LSCG6 gene 24 hours after interference; B: Greening rate after interference; C: Ant emergence rate after interference.
[0028] Figure 4 Interference with LSCG6 in the Asian corn borer;
[0029] A: Expression of LSCG6 gene after 12 hours of interference; B: Survival status of Asian corn borers after 24 hours of interference; C: Mortality phenotype of Asian corn borers after 12 hours of interference (the top 3 are normal controls, the rest are interference phenotypes);
[0030] Figure 5 To investigate the interference of LSCG6 in rice stem borer;
[0031] A: Expression of LSCG6 gene 24h after interference; B: Survival rate of rice stem borer 24h after interference; C: Interference-induced death phenotype of rice stem borer 24h (3 on the left are normal controls, the rest are interference phenotypes). Detailed Implementation
[0032] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments are not intended to limit the present invention. Experimental methods not specified in the embodiments are generally performed under conventional conditions such as those described in Molecular Cloning: A Laboratory Manual (3rd Edition, by J. Sambrook et al.), or as recommended by the manufacturer.
[0033] Example 1: RNAi of the LSCG6 gene in silkworm eggs
[0034] (1) Primer design and synthesis of dsRNA
[0035] Using the E-RNAi webservice (https: / / www.dkfz.de / signaling / e-rnai3 / ), dsRNA primers were designed based on the cDNA sequence of the silkworm LSCG6 gene. These primers were then compared with the silkworm genome, and highly specific dsRNA primers were selected. The nucleotide sequence of the silkworm LSCG6 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.
[0036] Based on the selected dsRNA primers, the following primers were synthesized by Qingke Biotechnology:
[0037] BO-dsRNA-F: TAATACGACTCACTATAGGGGGTCCAAAGCCCGGCAGCAT (SEQ ID NO: 3) BO-dsRNA-R: TAATACGACTCACTATAGGGGTTATCTCTAAATTATTTCC (SEQ ID NO: 4)
[0038] Using silkworm cDNA as a template, annealing and extension were performed using PrimeSTAR GXL high-fidelity polymerase. After PCR, the DNA was recovered and purified using gel extraction.
[0039] Using the PCR-recovered and purified product as a template, dsRNA was synthesized in vitro using the T7 in vitro transcription kit manufactured by Promaga, and then purified and tested to obtain the nucleotide sequence of silkworm dsRNA as shown in SEQ ID NO.5.
[0040] (2) Silkworm embryo RNAi
[0041] The purified and recovered dsRNA had a final concentration of 5000 ng / μL. It was injected into freshly laid silkworm eggs using a microinjection apparatus at a ratio of dsRNA:silveworm eggs = 4 μL: 500 eggs. The control group received the same amount of purified water. After injection, the silkworm eggs were sealed with glue, kept moist, and placed in a 25°C artificial climate incubator to promote development. The development of the silkworm eggs was monitored closely.
[0042] (3) Detection of dsRNA interference efficiency and statistics on silkworm egg turning rate and hatching rate
[0043] Twenty-four hours after dsRNA injection into silkworm eggs, 16 eggs were collected from each tube, with three replicates and a control group. Then, Omega's [product name] [product name] was used... The Total RNA Kit is used for RNA extraction.
[0044] The extracted RNA was processed using PrimeScript manufactured by Takara. TM The cDNA was obtained by reverse transcription using the RT reagent kit with gDNAEraser (Perfect Real Time), detected, diluted 5 times, and stored at 4°C for later use.
[0045] Quantitative primers were designed on NCBI based on the LSCG6 gene cDNA sequence, and their specificity was compared using BLAST.
[0046] Based on the selected quantitative primers, the following primers were synthesized by Qingke Biotechnology:
[0047] BO-qPCR-F: GGCCTCCACCACATAACACA (SEQ ID NO: 6)
[0048] BO-qPCR-R:CCCATGCGACCATCCTCTAC(SEQ ID NO:7)
[0049] The silkworm qPCR internal reference gene is
[0050] SW22934-F:TTCGTACTGCTCTTCTCGT(SEQ ID NO:8)
[0051] SW22934-R:CAAAGTTGATAGCAATTCCCT(SEQ ID NO:9)
[0052] After primer detection, use Green Pro Taq HS premixed qPCR quantitative reagent was used to conduct quantitative experiments, evaluate data, and analyze and plot graphs. Results are as follows: Figure 3 As shown in Figure A, the expression of LSCG6 in the silkworm eggs was significantly reduced by interference.
[0053] When the silkworm eggs reached day 10 of development, the greening rate of the interfered and control silkworm eggs was statistically analyzed, and the results are as follows: Figure 3 B. As can be seen from the figure, the rate of turning green in the interfered silkworm eggs was significantly lower than that in the control, and the decreased expression of the LSCG6 gene affected the development and turning of the silkworm eggs green.
[0054] Fifteen days after egg-laying, the cumulative hatching rate of the interfered silkworm eggs and the control group was calculated, and the results are as follows: Figure 3 C. As can be seen from the figure, the hatching rate of the interfered silkworm eggs was significantly lower than that of the control, and the decreased expression of the LSCG6 gene affected the hatching of the silkworm eggs.
[0055] (4) Conservation analysis of the LSCG6 gene
[0056] like Figure 1 , Figure 2 As shown, multiple sequence alignment analysis and collinearity analysis of the LSCG6 gene in 26 species of lepidopteran butterflies and moths indicate that the LSCG6 gene is conserved in lepidopterans.
[0057] Example 2: RNAi analysis of the LSCG6 gene in Asian corn borer larvae
[0058] (1) Primer design and synthesis of dsRNA
[0059] Using the E-RNAi webservice (https: / / www.dkfz.de / signaling / e-rnai3 / ), dsRNA primers for the LSCG6 gene were designed based on the cDNA sequence of the Asian corn borer. These primers were then compared with the Asian corn borer genome to select highly specific dsRNAs. The cDNA sequence of the LSCG6 gene is shown in SEQ ID NO.10, and the amino acid sequence is shown in SEQ ID NO.11.
[0060] Based on the selected dsRNA primers, the following primers were synthesized by Qingke Biotechnology:
[0061] LOF-dsRNA-F: TAATACGACTCACTATAGGGTGCTACTTGGGGTATGACTTC (SEQ ID NO: 12)
[0062] LOF-dsRNA-R: TAATACGACTCACTATAGGGGGATCATTTGCCAGTGATTT (SEQ ID NO: 13)
[0063] Using Asian corn borer cDNA as a template, annealing and extension were performed using PrimeSTAR GXL high-fidelity polymerase. After PCR, the DNA was recovered and purified using gel extraction.
[0064] Using the PCR-recovered and purified product as a template, dsRNA was synthesized in vitro using the T7 in vitro transcription kit manufactured by Promaga, and then purified and tested to obtain the nucleotide sequence of Asian corn borer dsRNA as shown in SEQ ID NO.14.
[0065] (2) RNAi of Asian corn borer larvae
[0066] The synthesized dsRNA was added to the feed of Asian corn borers (the dry feed powder was obtained from Keyun Biotechnology and prepared by boiling water in the laboratory), and mixed well to prepare an RNAi feed with a concentration of 0.03% dsRNA. Newly hatched Asian corn borer larvae were then inoculated onto the feed using a larvae-picking pen, with pure water added as a control. All reagents and consumables used were RNase-free. After feeding, the larvae were placed in a 28℃ artificial climate incubator with a light:dark ratio of 14:10, and their development was observed continuously.
[0067] (3) Detection of dsRNA interference efficiency and phenotypic observation
[0068] Twelve hours after dsRNA interference, three Asian corn borers were collected from each tube in the experimental group, with three replicates in each group and the control group treated similarly. Then, Omega's [technology / method / technology] was used... The Total RNA Kit is used for RNA extraction.
[0069] The extracted RNA was processed using PrimeScript manufactured by Takara. TM The cDNA was obtained by reverse transcription using the RT reagent kit with gDNAEraser (Perfect Real Time), detected, diluted 5 times, and stored at 4°C for later use.
[0070] Quantitative primers were designed on NCBI based on the cDNA sequence of the LSCG6 gene of the Asian corn borer, and their specificity was compared using BLAST.
[0071] Based on the selected quantitative primers, the following primers were synthesized by Qingke Biotechnology:
[0072] LOF-qPCR-F: AAGGATAAACAGCCGCAAGTG (SEQ ID NO:15)
[0073] LOF-qPCR-R:TCGTGTTCTGCATAGTGCTGT(SEQ ID NO:16)
[0074] The internal reference gene for the Asian corn borer qPCR is:
[0075] LOF-Actin-F:ACGGAGGTGGTAACCATCAACA(SEQ ID NO:17)
[0076] LOF-Actin-R:ACGCCTCCTTCTTGGTGTCG (SEQ ID NO:18)
[0077] After primer detection, use Green Pro Taq HS premixed qPCR quantitative reagent was used to conduct quantitative experiments, evaluate data, and analyze and plot graphs. Results are as follows: Figure 4 As shown in Figure A, the expression of LSCG6 in Asian corn borers was significantly reduced after the intervention.
[0078] like Figure 4 As shown in Figures B and C, the survival of Asian corn borers was recorded at 0h, 12h, 18h, and 24h after feeding. Compared with the control, Asian corn borers fed with dsRNA gradually died within 24h, indicating that the reduced expression of the LSCG6 gene affects the development and survival of Asian corn borer larvae.
[0079] Example 3: RNAi analysis of the LSCG6 gene in rice stem borer larvae
[0080] (1) Primer design and synthesis of dsRNA
[0081] Using the E-RNAi webservice (https: / / www.dkfz.de / signaling / e-rnai3 / ), dsRNA primers for the LSCG6 gene were designed based on the *Staphylococcus aureus* cDNA sequence. These primers were then compared with the *Staphylococcus aureus* genome to select highly specific dsRNAs. The cDNA sequence of the *Staphylococcus aureus* LSCG6 gene is shown in SEQ ID NO.19, and the amino acid sequence is shown in SEQ ID NO.20.
[0082] Based on the selected dsRNA primers, the following primers were synthesized by Qingke Biotechnology:
[0083] LCS-dsRNA-F: taatacgactcactatagggaagaaacaaaggaacaaattgag (SEQ ID NO: 21)
[0084] LCS-dsRNA-R: taatacgactcactatagggttagtttccttctgttgttgcc (SEQ ID NO: 22)
[0085] Using rice stem borer cDNA as a template, annealing and extension were performed using PrimeSTAR GXL high-fidelity polymerase. After PCR, the DNA was recovered and purified using gel extraction.
[0086] Using the PCR-recovered and purified product as a template, dsRNA was synthesized in vitro using the T7 in vitro transcription kit manufactured by Promaga and then purified and tested. The nucleotide sequence of the dsRNA of the rice stem borer LSCG6 gene is shown in SEQ ID NO:23.
[0087] (2) RNAi of rice stem borer larvae
[0088] The synthesized dsRNA was added to the rice stem borer feed and mixed thoroughly to prepare an RNAi feed with a concentration of 0.03% dsRNA. Newly hatched rice stem borer larvae were then inoculated onto the feed using a larvae-picking pen, with pure water added as a control. All reagents and consumables used were RNase-free. After feeding, the larvae were placed in a 28℃ artificial climate incubator with a light:dark ratio of 14:10, and their development was observed continuously.
[0089] (3) Detection of dsRNA interference efficiency and phenotypic observation
[0090] 24 hours after dsRNA intervention, three rice stem borers were collected from each tube of the experimental group, with three replicates for each group and the control group being identical. Then, Omega's [technology / method / technology] was used... The Total RNA Kit is used for RNA extraction.
[0091] The extracted RNA was processed using PrimeScript manufactured by Takara. TM The cDNA was obtained by reverse transcription using the RT reagent kit with gDNAEraser (Perfect Real Time), detected, diluted 5 times, and stored at 4°C for later use.
[0092] Quantitative primers were designed based on the cDNA sequence of the LSCG6 gene of the rice stem borer using NCBI. BLAST was used to compare their specificity. Based on the selected quantitative primers, the following primers were synthesized by Qingke Biotechnology:
[0093] LCS-qPCR-F: agcagaccatagtccgaggt (SEQ ID NO: 24);
[0094] LCS-qPCR-R: cgggcgaagatacggatgaa (SEQ ID NO: 25);
[0095] The internal reference gene for the rice stem borer qPCR is:
[0096] LCS-Qef1-F: tgaacccccatacagcgaatcc (SEQ ID NO: 26);
[0097] LCS-Qef1-R:tctccgtgccaaccagaaatagg (SEQ ID NO: 27);
[0098] After primer detection, use Green Pro Taq HS premixed qPCR quantitative reagent was used to conduct quantitative experiments, evaluate data, and analyze and plot graphs. Results are as follows: Figure 5 As shown in Figure A, the expression of LSCG6 in the rice stem borer was significantly reduced after the interference.
[0099] like Figure 5 As shown in B and C, the survival of rice stem borers was assessed 24 hours after the feed was added. Compared with the control, the survival rate of rice stem borers fed with dsRNA was significantly reduced after 24 hours, indicating that the reduced expression of the LSCG6 gene affects the development and survival of rice stem borer larvae.
[0100] In this embodiment of the invention, RNAi technology is used to reduce the expression of the LSCG6 gene. As is known to those skilled in the art, any means capable of knocking out or reducing the LSCG6 gene can achieve the objective of this invention. Those skilled in the art should understand that various modifications can be made to this invention without departing from the scope defined by the claims.
[0101] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. Interfering with Lepidoptera LSCG6 The use of gene expression in the control of Lepidoptera pests, characterized in that, The lepidopteran pest is Asian corn borer or common skipper; Asian corn borer LSCG6 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO. 11, common skipper LSCG6 The amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO.
20.
2. A method for controlling lepidopteran pests, characterized by, The method is: taking the lepidopteran pest Asian corn borer or the Chinese LSCG6 gene as the target, reducing or inhibiting the transcription and translation of the LSCG6 gene, thereby increasing the mortality rate of the lepidopteran pest; the nucleotide sequence of the Asian corn borer LSCG6 gene is as shown in SEQ ID NO. 10; the nucleotide sequence of the Chinese LSCG6 lepidopteran pest borer gene is as shown in SEQ ID NO.
19.
3. The method of claim 2, wherein, The reduction or inhibition LSCG6 The method of reducing or inhibiting expression of a gene is gene mutation, gene silencing or gene knockout.
4. The method of claim 3, wherein, The method of gene silencing is to reduce the expression of the gene using RNAi. LSCG6 the gene.
5. The method of claim 4, wherein, The method of RNAi is specifically: according to LSCG6 the cDNA sequence of the gene, design dsRNA primer with T7 adapter, synthesize dsRNA sequence, and use the dsRNA to reduce the expression of the target gene of the target species by injection or feeding method. LSCG6 the gene.
6. The method of claim 5, wherein, Ostrinia nubilalis LSCG6 The dsRNA sequence of the gene is shown in SEQ ID NO.
14.
7. The method of claim 5, wherein, chilo suppressalis LSCG6 The dsRNA sequence of the gene is shown in SEQ ID NO. 23.
Citation Information
Patent Citations
Application of insect DNA transmethylase Dnmt1 to pest control
CN106566831A
Rnai-based pest control method using irrigation, and application thereof
WO2015070765A1