HIF2α gene mutants and their application in establishing NAFLD mouse models

Abstract

The present invention relates to a HIF2α gene mutant, a vector, and their use in constructing a NAFLD mouse model. Genetically modified mice constructed using this mutant can be stably propagated, facilitating practical studies of the pathogenic mechanisms of the HIF2α gene in mice with non-alcoholic fatty liver disease (NAFLD). Given the limited availability of human NAFLD livers and the constraints of medical ethics, the mouse model provided in this application will become an important tool in NAFLD research, providing a stable, heritable research model for studies of pathogenic mechanisms, treatments, and drug screening.

Description

(1) Technical field

[0001] The present invention relates to a HIF2α gene mutant, a vector, and applications of the HIF2α gene mutant and a vector in constructing a NAFLD mouse model. (2) Background technology

[0002] Nonalcoholic fatty liver disease (NAFLD) is caused by an excess supply of energy relative to the body's needs and is characterized by the accumulation of ectopic triglycerides in the liver, without excessive alcohol consumption. NAFLD can lead to various complications, including cardiovascular disease, renal impairment, and osteoporosis. Persistent NAFLD increases the risk of nonalcoholic steatohepatitis (NAFLD) and end-stage liver diseases such as cirrhosis and hepatocellular carcinoma, significantly shortening life expectancy. Due to lifestyle changes, the prevalence of NAFLD has increased dramatically in recent decades, affecting up to one-third of the world's population. Therefore, developing precise prevention strategies and treatment guidelines to address this disease is crucial. However, the precise pathogenesis of NAFLD remains unclear, making research into its pathogenic mechanisms and drug development crucial. It is currently believed that NAFLD is caused by a complex interplay between environmental factors and genetic factors that cannot be fully replicated in animals. Despite this, preclinical models are needed to investigate NAFLD. Several mouse models of NAFLD exist, some of which exhibit key pathophysiological and histopathological hallmarks of human NAFLD, while others may be useful for addressing specific questions. Therefore, the development and use of animal models based on NAFLD pathogenic genes are crucial for exploring the pathogenesis and treatment of the disease.

[0003] Studies have shown that the hypoxia signaling system is closely linked to the pathogenesis of NAFLD. Central to cellular oxygen sensing is the hypoxia-inducible factor (HIF) family of transcription factors, which regulate the expression of genes responsive to hypoxia. HIFs are heterodimers composed of an α subunit (three subunits are currently known: HIF1α, HIF2α, and HIF3α) and a β subunit (HIF1β). Due to their roles in regulating diverse processes, including metabolism and angiogenesis, HIFs are likely involved in multiple key processes in the development and progression of NAFLD. Accumulation of HIFs has been shown to occur in the livers of NAFLD patients, but the mechanisms driving HIF activation remain uncertain. Studies have shown that the loss of HIF1α in hepatocytes of mice fed a high-fat diet prevents NAFLD-associated liver fibrosis but does not affect fat accumulation. However, HIF2α activation in the livers of NAFLD patients and mouse models accelerates lipid accumulation; mice with high-fat diet-induced hepatic steatosis show reduced lipid accumulation when treated with a HIF2α antagonist. This suggests that HIF signaling may be a potential target for treating this disease, but further studies are needed to confirm the underlying mechanism and determine whether targeting HIF can serve as a new therapeutic strategy.

[0004] Currently established small animal models of NAFLD often have limitations. Therefore, establishing a stable, reliable, reproducible, and comprehensive genetic mouse model of NAFLD has become a technical challenge urgently needed to be addressed by those skilled in the art. (3) Summary of the invention

[0005] The present invention aims to provide a HIF2α gene mutant and vector for constructing a stable, reliable, reproducible, and complete disease spectrum genetic mouse model, and their use in constructing a NAFLD mouse model.

[0006] The technical solution adopted in the present invention is:

[0007] A HIF2α gene mutant, wherein the mutation is a C to T mutation at position 2473 of the sixteenth exon of EPAS1.

[0008] The inventors discovered a previously undescribed germline c.C2473T (p.R825S) mutation in HIF2α in the liver tissue of Chinese patients with dyslipidemia. They also constructed a corresponding R825S mutation in the HIF2α gene in mice, confirming that this mutation is one of the causative genes for dyslipidemia. Because HIF2α mutations at this site have not previously been shown to cause dyslipidemia in China or abroad, systematic research on its pathogenic mechanism has not been conducted. Furthermore, the difficulty in obtaining liver tissue from patients has severely hampered the development of related research. The method for constructing a mouse model with a HIF2α gene mutation provided by the present invention can be used to explore the possible mechanisms of action of HIF2α in NAFLD under hypoxia and metabolic stress.

[0009] Specifically, the nucleotide sequence of the mutant is shown in SEQ ID No. 1.

[0010] The sequence of SEQ ID No. 1 is as follows (the underline indicates the mutation site):

[0011] T GGCTGCTCGGGCCCTCATTTGAGTCCTACCTGCTGCCCGAACTGACCAGATATGACTGTGAGGTGAACGTGCCCGTGCTGGGAAGCTCCACGCTCCTGCAAGGAGGGGACCTCCTCAGAGCCCTGGACCAGGCCACCTGA

[0012] The present invention also relates to a vector containing the mutant.

[0013] The present invention also relates to the use of the mutant in constructing a non-alcoholic fatty liver disease (NAFLD) mouse model.

[0014] Specifically, the application is: constructing a mutation vector, transfecting C57BL / 6 mouse totipotent embryonic stem cells, microinjecting the ES cells into which the targeted gene has been successfully introduced into the blastocyst cavity of the mouse to obtain chimeric mice, breeding the obtained chimeric mice with wild-type mice to obtain R825S mutant chimeric mice with normal reproductive ability, and then further breeding them through inbred lines to produce homozygous EPAS1R825S / R825S knock-in mice, feeding the homozygous EPAS1R825S / R825S knock-in mice with a high-fat diet, and confirming that the model construction is successful by staining with hematoxylin-eosin (HE) and Oil Red O, thereby obtaining a NAFLD mouse model.

[0015] The most commonly used in vivo models of NAFLD in research are typically rodents, induced by diet. Diets include methionine- and choline-deficient diets (MCDs), high-fat diets (HFDs), cholesterol- and bile-salt diets, and fructose diets, with HFDs and MCDs being the most commonly used. HFDs are widely used to induce hepatic steatosis in experimental animals. Compared to MCD models, HFD models exhibit milder liver damage and more similar histopathological and pathophysiological features to those of human NAFLD. While high-fat diets in rats closely resemble human fatty liver pathology, model development is prolonged, with some rats requiring approximately six months to develop fibrosis. In mice fed a choline- and methionine-deficient (MCD) diet, although typical ballooning and fibrosis develop in the liver after eight weeks, these mice exhibit weight loss at all stages, unlike the obesity often associated with NAFLD in humans. Furthermore, the progression of hepatic steatosis and the production of inflammatory markers vary significantly between mouse strains and sexes. Male mice fed an MCD or HFD exhibit greater lipid deposition and steatosis than female mice. The liver lipid content and liver-to-body weight ratio of Wistar rats are higher than those of Long-Evans and Sprague Dawley rats. However, male C57BL / 6 mice show more inflammatory foci, lipid peroxidation, and mitochondrial damage products compared with Wistar rats, but less steatosis and lower liver triglyceride (TG) levels. Genetically obese ob / ob mice, although steatosis is similar to that of humans, cannot replicate fatty liver fibrosis. HIF2α is inhibited by HFD feeding. R825S / R825S The mutant male C57BL / 6 mice can just make up for the defects of less fatty degeneration and lower liver TG levels, making the constructed mouse NAFLD model closer to the occurrence and development process of human NAFLD.

[0016] HIF2α mutant mice were created using targeted animal gene modification technology, achieving a specific site-specific, copy-specific mutation without affecting other genes, thereby increasing phenotypic certainty. This mutation only affects hepatic lipid deposition, blood lipids, and related metabolic functions; no effects on mouse health or other physiological functions have been observed. Furthermore, these mice have normal fertility and can be bred as breeding stock, ensuring sufficient numbers of experimental mice.

[0017] Compared with wild-type male C57BL / 6 mice, HIF2α mutant male C57BL / 6 mice have obvious hepatic TG deposition and obvious vacuolar degeneration, which makes up for the shortcomings of wild-type C57 high-fat modeling and makes it an ideal in vivo fatty liver model.

[0018] The beneficial effects of the present invention are mainly reflected in: the present invention provides a HIF2α gene mutant, and the mutant mice constructed from this mutant have the characteristics of spontaneous fatty liver. Compared with ordinary C57BL / 6 mice, this model is more likely to induce non-alcoholic fatty liver disease. As a mouse model, it will become an important tool in the study of non-alcoholic fatty liver disease, providing a stable heritable research model in the study of pathogenic mechanism, treatment method and drug screening. (IV) Description of the accompanying drawings

[0019] Figure 1 It is a linearized carrier structure;

[0020] Figure 2 The electrophoresis results of the vector digested with restriction endonucleases are shown;

[0021] Figure 3 is the sequencing result;

[0022] Figure 4 HE staining and Oil Red O staining of mouse liver under a microscope (40x objective lens observation, the left side is wild type, the right side is mutant mouse);

[0023] Figure 5 The concentrations of lipids such as cholesterol (TC) and triglycerides (TG) deposited in the liver after 12 weeks of high-fat diet;

[0024] Figure 6 The concentrations of blood lipids such as TC and low-density lipoprotein (LDL-C) in peripheral blood;

[0025] Figure 7 Comparison of the livers of wild-type mice and HIF2α gene mutant mice fed a high-fat diet for 12 weeks (wild-type on the left and mutant mice on the right). (V) Specific implementation methods

[0026] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:

[0027] Example 1:

[0028] 1. Single nucleotide polymorphism (SNP) testing revealed a novel mutation in the liver tissue of patients with dyslipidemia: the c.C2473T (p.R825S) mutation located in exon 16 of EPAS1.

[0029] 2. Prepare the amplified fragment according to the vector scheme and design the primers for the mutation site (Table 1). The reaction system is 1 μl of template, 1 μl of forward and reverse primers, 1 μl of dNTP (10 nM), 5 μl of Taq buffer, 5 μl of 5 mM MgCl2, and 2.5 U of Taq enzyme. The PCR reaction conditions are: pre-denaturation at 95°C for 3 min, denaturation at 94°C for 30 s, annealing at 61°C for 15 s, extension at 68°C for 2 min, and repair extension at 68°C for 8 min, for a total of 32 cycles. Amplify the template, apply gel after amplification, and recover the fragment for ligation.

[0030] Table 1: Primers for vector construction

[0031]

[0032] 3. Select a suitable vector skeleton and cut it with endonuclease and recover it with gel. The vector skeleton is modified based on PUC57 ( Figure 1 ), the backbone and fragments are connected using ligase;

[0033] The backbone and fragments are connected using ligase, and the connection system is as follows:

[0034] C115-Novozyme ligase system:

[0035] Processed skeleton 100ng Connecting fragments 50ng 2*Enzyme mixture 5ul Sterilization water Up to 10ul

[0036] C115-Novozyme connection system:

[0037] Reaction temperature 50℃ Heated lid temperature 105℃ Reaction time 15min Reaction system 10ul

[0038] 4. Chemically transform the ligated fragment backbone mixture, draw part of the mixture and add it to the competent cells, ice bath for 30 minutes, then quickly put it in a 42°C water bath for heat shock for 45 seconds, and immediately ice bathe for 2 minutes after the heat shock. After the ice bath, transfer the competent bacteria to LB liquid medium and culture at 37°C*225rpm*1h constant temperature shaking;

[0039] 5. Take the cultured bacterial solution and centrifuge at 4000rpm*2min to remove the supernatant, discard 400μL LB, gently pipette the remaining bacterial solution to mix, aspirate all the bacterial suspension and spread it on the resistance plate, culture at constant temperature overnight, record the spots, pick the spots and perform bacterial inspection, spot run the gel to verify the size of the bacterial inspection band, inoculate the colonies with positive bacterial inspection and shake overnight; centrifuge the bacterial solution, collect the bacteria and perform a small extraction of plasmids, record the concentration of the extracted plasmids, select the appropriate endonuclease for enzyme digestion identification, spot run the gel and check whether the band size is consistent with the theoretical one. The enzyme digestion map shows that the corresponding fragment size is consistent with the theoretical one ( Figure 2 ): After correct identification, arrange to aspirate part of the plasmid for sequencing;

[0040] 6. Use software (SeqMan or Snapgene) to check whether the constructed sequence is correct. The sequencing results show that the sequencing area covers the upper and lower 200bp of the interface between 5arm and DTA, the upper and lower 200bp of exons E8 to E10, and the upper and lower 200bp of the interface between E11, 5arm and Neo. At the same time, the entire 3arm and the upper and lower 200bp are all tested without abnormalities ( Figure 3 ), after the sequencing is correct, the next step is to amplify and extract the plasmid for injection.

[0041] 7. Resuscitate C57BL / 6 mouse ES cells, subculture them in mouse embryonic stem cell serum-free medium (OriCell, MUXES-90061), expand them to an appropriate density, digest them, wash them with DPBS, and resuspend the cells. Count and take 1×10 7 Resuspend the cells in electroporation buffer and add 35 μg of the linearized plasmid. Mix thoroughly and incubate on ice for 5 minutes. Transfer the cell suspension to an electroporation cuvette and electroporate once at 250 V, 500 μF. Transfer the electroporated cells to a dish pre-seeded with G418-resistant MEF cells and culture them in Mouse Embryonic Stem Cell Serum-Supplemented Medium (OriCell, MUXES-90011).

[0042] 8. After 24 hours, change the medium, wash with DPBS to remove cell debris, and select with complete mouse embryonic stem cell culture medium containing G418 (final concentration 200 μg / mL) for 7 days. During this period, observe and change the medium every day. After the drug screening is completed, pick the surviving clones and transfer them to a 96-well plate, one clone per well, and change the medium every day. On the third day after the clone is selected, pass the 96-well plate into two, and freeze one of them after the cells are fully grown. After the cells are fully grown in the other well, extract genomic DNA for subsequent PCR identification.

[0043] 9. Obtain blastocysts from the uterus of the donor female mouse 3.5 days after mating. Select blastocysts with good morphology and moderate developmental status and transfer them to the culture medium in the injection dish.

[0044] 10. Transfer the ES cells to be injected into the cell culture medium of the injection dish, arrange them evenly and at a moderate density, draw the ES cells into the injection needle, and inject them one by one into the blastocyst cavity.

[0045] 11. Prepare pseudo-pregnant female mice. Select fertile female mice of appropriate age and mate them with male mice that have been sterilized after vasectomy. Stimulate the female mice to undergo a series of pregnancy changes to obtain pseudo-pregnant female mice, which will serve as surrogate mice for the genetically modified fertilized eggs.

[0046] 12. Transplant the ES cell-injected blastocyst into the uterus of a surrogate mouse.

[0047] 13. After transplantation, place the surrogate mother mouse in a clean cage and keep it warm until it wakes up and then return it to the cage for breeding.

[0048] 14. After the blastocyst transfer is completed, wait for the chimeric mice to be born. One week after the mice are born, their paws can be clipped and numbered, and PCR identification can be performed at the same time. Three weeks after the mice are born, they can be raised in separate cages.

[0049] 15. Collect tissues (tail or toe tissues) from 1- to 2-week-old mice; lyse the tissues and extract the genome; perform PCR amplification and electrophoresis detection using specific primers for the target gene to screen out offspring with exogenous gene integration.

[0050] 16. Use positive F1 from the same source to perform sibling mating, and obtain homozygous F2 mice born; screen out mice that express the target gene, establish a stable lineage, and record the generation status and pedigree;

[0051] 17. After breeding and expansion, mice were fed a high-fat diet to establish a NAFLD mouse model: male C57BL / 6 mice homozygous for the HIF2α mutation and wild-type male C57BL / 6 mice were fed a normal SPF mouse diet for 6 weeks. At 6 weeks, the normal mouse diet was stopped and the mice were fed a high-fat diet (HFD) (60% fat, 20% protein, 20% carbohydrate) for 12 weeks.

[0052] 8. Confirmation of successful model establishment through HE, Oil Red O staining and biochemical testing: After 12 weeks of feeding, peripheral blood and liver tissue homogenates were collected from mice for biochemical analysis, and liver tissue sections were stained with HE and Oil Red O. Compared with wild-type C57BL / 6 mice, HE staining results showed obvious vacuolar changes in the liver tissue of mutant mice, while Oil Red O staining results showed more significant lipid deposition in the liver tissue ( Figure 4 ); At the same time, biochemical tests showed that the lipids deposited in the liver, such as cholesterol (TC) and TG, increased significantly ( Figure 5 ), and peripheral blood lipids such as TC and low-density lipoprotein (LDL-C) were significantly increased ( Figure 6 ), confirming that the NAFLD mouse model was successfully established.

[0053] The above describes the specific implementation method of the present invention. It should be understood that the present invention is not limited to the above specific implementation method, and the inventors may make various modifications or variations within the scope of the claims, which will not affect the essence of the present invention.

Claims

1. Application of a HIF2α gene mutant in constructing a non-alcoholic fatty liver disease (NAFLD) mouse model, wherein the mutant nucleotide sequence is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that The application is as follows: constructing a mutation vector, transfecting C57BL / 6 mouse totipotent embryonic stem cells, microinjecting the ES cells into which the targeted gene has been successfully introduced into the blastocyst cavity of the mouse to obtain chimeric mice, breeding the obtained chimeric mice with wild-type mice to obtain R825S mutant chimeric mice with normal reproductive capacity, further breeding through inbred lines to produce homozygous EPAS1R825S / R825S knock-in mice, and feeding the homozygous EPAS1R825S / R825S knock-in mice with a high-fat diet to obtain a NAFLD mouse model.

Images