A new strain of Ganoderma lucidum with high polysaccharide production HMGIM-S140529 and its molecular marker and artificial cultivation method

Abstract

The present invention discloses a new high-polysaccharide Ganoderma lucidum strain HMGIM‑S140529, its molecular marker and artificial cultivation method. Ganoderma lucidum (Ganoderma lucidum) HMGIM‑S140529, the deposit number is GDMCC No: 62208. Ganoderma lucidum HMGIM‑S140529 is a wild Ganoderma lucidum strain. After separation and purification, domestication and cultivation research and active ingredient content evaluation by our team, it was found that it has the advantages of fast growth rate, high temperature resistance, high polysaccharide content, etc. The polysaccharide content of substitute material cultivation can reach 2.1±0.08%, which can provide raw materials for the development of medicinal and health foods with Ganoderma lucidum polysaccharides as the main ingredient, and has good edible and medicinal development value. In addition, because the strain is collected from the wild, it has rich genetic variations and is distantly related to the varieties circulating in the market, it can provide valuable germplasm resources for the selection and breeding of excellent new varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology application, and specifically relates to a new high-polysaccharide-yielding ganoderma lucidum strain HMGIM-S140529 and its molecular marker, specific primer pair and artificial cultivation method. Background Art

[0002] Ganoderma lucidum (Curtis) P. Karst. is a fungus belonging to the class Agaricomycetes, family Polyporaceae, and genus Ganoderma P. Karst. Ganoderma has been regarded as the "best medicine" since ancient times and is the only legal Chinese medicine that can be used to make a prescription. According to the "Shennong's Herbal Classic", Ganoderma has the effects of "calming the spirit, increasing wisdom, benefiting the heart, strengthening the bones and muscles, improving complexion, and making the body light and immortal if eaten for a long time". It has been included in the "American Herbal Pharmacopoeia and Therapeutic Compendium" and the "Pharmacopoeia of the People's Republic of China" and other official pharmacopoeias in China and abroad, and the medicinal value of Ganoderma has been widely recognized. It has been determined that Ganoderma fruiting bodies contain more than 300 compounds in 9 categories, and the physiologically active components include Ganoderma polysaccharides, triterpenoids, proteins, polypeptides, nucleosides, furans, sterols, alkaloids and amino acids. Ganoderma lucidum polysaccharide is an important active substance of Ganoderma lucidum, which has a wide range of pharmacological activities such as anti-tumor, hypoglycemic and blood lipid, immunomodulatory, anti-oxidant, anti-fatigue, anti-inflammatory, intestinal flora regulation, neuroprotection, liver protection and anti-depression. Therefore, breeding high-yield polysaccharide Ganoderma lucidum strains can provide high-quality raw materials for the development of Ganoderma lucidum processing industry.

[0003] The Pharmacopoeia of the People's Republic of China clearly requires that the polysaccharide content of qualified Ganoderma lucidum fruiting bodies must be greater than or equal to 0.9%. The polysaccharide content of Ganoderma lucidum fruiting bodies in the Chinese market is generally 0.9-1.5%, which is too low to meet people's demand for medicinal and health foods. According to the previous investigation of this research team, the main Ganoderma lucidum producing areas in China (Zhejiang, Shaanxi, Anhui, Shandong, Fujian, and Jilin) ​​mainly use the introduced Hanzhi series of species. Although the locally bred varieties such as Shanghai Agricultural and Longzhi have been promoted to a certain extent, their popularity is far less than that of the introduced varieties. The reason is that the existing varieties do not perform well in important agronomic traits such as yield, stability, and active ingredient content. my country has abundant wild resources, which are distantly related to the market species and have rich genetic diversity. Investigating, collecting, domesticating, and screening wild resources can provide germplasm resources for the selection and breeding of high-quality Ganoderma lucidum varieties.

[0004] Variety selection is a systematic and long-term work, and Ganoderma lucidum can reproduce production seeds through asexual reproduction, which has greatly dampened the enthusiasm of breeders, affected the development of the entire industry, and caused confusion among species with the same name and the same name. Traditional identification of edible fungi species mainly relies on mycelium antagonism, fruiting body morphology and other methods. The judgment of mycelium antagonism is greatly affected by human factors, and the antagonism line between closely related strains is not obvious and cannot be effectively distinguished. The appearance of the fruiting body is greatly affected by environmental factors (temperature, humidity, light, oxygen), and it takes several months to obtain the fruiting body, which is not conducive to rapid and effective identification of strains. With the development of molecular biology technology, DNA molecular marker technology is widely used in genetic breeding and species relationship identification due to its advantages of simplicity, rapidity, and not being restricted by developmental period and environmental factors. Summary of the invention

[0005] The invention aims to provide a Ganoderma lucidum HMGIM-S140529 with high polysaccharide yield, fast growth rate and high temperature resistance, as well as a molecular marker and an artificial cultivation method thereof.

[0006] Ganoderma lucidum HMGIM-S140529 was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on January 13, 2022, at the 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 62208.

[0007] The second object of the present invention is to provide a cultivation method of the above-mentioned Ganoderma lucidum HMGIM-S140529, which comprises the steps of mycelium culture, ganoderma management and harvesting.

[0008] Preferably, the specific steps are:

[0009] 1. Culture medium formula

[0010] Mother culture medium: by mass fraction, including 20% ​​potato + 2% glucose + 1% peptone + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + 0.001% vitamin B1, the solvent is water;

[0011] Production seed culture medium: by mass fraction, including 98-99% sorghum + 1-2% calcium carbonate, natural pH;

[0012] Cultivation material: by mass fraction, including 50% sawdust, 38% cottonseed hulls, 10% wheat bran, 2% calcium carbonate; water content 60-65%, natural pH;

[0013] 2. Cultivation Process

[0014] Mycelium culture: under aseptic operation conditions, take the Ganoderma lucidum HMGIM-S140529 fungus block and inoculate it into the mother culture medium, with a humidity of 50%-60%, and culture it in the dark until the mycelium covers the slope; transfer the mother culture mycelium to the production culture medium for expansion culture, and culture it in the dark until the mycelium covers the bag; then inoculate the production mycelium into the cultivation material, culture it in the dark, with a humidity of 50%-60%, and ventilate it regularly to keep the carbon dioxide concentration below 4000ppm. After the cultured mycelium covers the bag, continue to culture it for 7-10 days for the after-ripening period.

[0015] Management of mushroom production: After the mycelium matures, buds are promoted. The lids of the cultivation bags are opened and placed vertically. The temperature is 26-28℃ and the relative humidity of the air is maintained at 90%-95%. The light is scattered. After the mushroom production management, the primordium begins to form at the opening of the cultivation material. The humidity is adjusted to 80-90%. When the mushroom cap begins to differentiate, fresh air is exchanged every day. The growth points on the edge of the fruiting body disappear. Before spraying powder, the air humidity is adjusted to 80%;

[0016] Harvest: The fruiting bodies are harvested when a large number of spores are ejected from the back of the cap. The average bag yield is 51.2-64.4g, the cap length is 11.7-14.7cm, the stem height is 1.1-2.1cm, and the cap thickness is 9.6-12.8mm.

[0017] Further preferably, the cultivation process is:

[0018] Mycelium culture: taking a block of Ganoderma lucidum HMGIM-S140529 and inoculating it into a mother culture medium under aseptic operation conditions, with a humidity of 50%-60%, and culturing it at a constant temperature of 25°C in the dark for 8-12 days until the mycelium covers the slant; transferring the mother culture mycelium to a production culture medium for expansion culture, culturing it at a constant temperature of 25°C in the dark until the mycelium covers the bag, then inoculating the production mycelium into a cultivation material, culturing it at a constant temperature of 25°C in the dark, with a humidity of 50%-60%, and regularly ventilating to keep the carbon dioxide concentration below 4000ppm, culturing it for 18-20 days until the mycelium covers the bag, and then culturing it under the same conditions for 7-10 days for post-ripening culture;

[0019] Management of mushroom production: After the mycelium matures, buds are promoted. The lids of the cultivation bags are opened and placed vertically. The temperature is 26-28℃ and the relative humidity of the air is maintained at 90%-95%. The scattered light is used for 8h / d. After about 8 days of management, primordia begin to form at the opening of the cultivation material. The humidity is adjusted to 80-90%. When the mushroom cap begins to differentiate, fresh air is exchanged twice a day for 1h each time. The growth points on the edge of the fruiting body disappear. Before spraying, the air humidity is adjusted to 80%;

[0020] Harvesting: Harvest the fruiting bodies when spores are ejected in large quantities from the back of the cap.

[0021] The present invention uses whole genome resequencing technology to obtain genome sequence information of multiple strains, obtains InDel variation site sets through bioinformatics analysis, designs specific primers in a targeted manner, and obtains specific DNA fragments of wild Ganoderma lucidum HMGIM-S140529 through PCR amplification, which is the molecular marker of Ganoderma lucidum strain HMGIM-S140529.

[0022] The nucleotide sequences of the molecular markers of the Ganoderma lucidum strain HMGIM-S140529 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.

[0023] The present invention also provides a primer set for identifying the Ganoderma lucidum strain HMGIM-S140529:

[0024] include:

[0025] As indicated by any of the following primer pairs:

[0026] S529-1 primer pair: S529-1F: GCAGGCACAACTTTGACGAT and S529-1R: TATCACACATGCCACGCTCT;

[0027] S529-2 primer pair: S529-2F: AAGCGCGTTGACATTGGTAA and S529-2R: ACCCCACAAGCAGGAAGATA;

[0028] S529-Y1 primer pair: S529-YF1: CTTACCCCACTGTTTCTCGC and S529-YR1: AACGCCCGACAATCACGAGTA;

[0029] S529-Y2 primer pair: S529-YF2: GACCTACAACACCCGGACTTAG and S529-R2: GTACCTGATGACCATGTCCAGC.

[0030] The present invention also provides a molecular marker of Ganoderma lucidum HMGIM-S140529 or an application of the identification primer set in identifying Ganoderma lucidum HMGIM-S140529.

[0031] The invention also provides a method for identifying Ganoderma lucidum HMGIM-S140529, comprising extracting genomic DNA of the Ganoderma lucidum to be tested, performing PCR amplification with a primer pair of S529-1 and S529-2, and if a characteristic band can be amplified, the Ganoderma lucidum is HMGIM-S140529, otherwise, the Ganoderma lucidum is not HMG IM-S140529; or performing fluorescent PCR reaction with the primer pair of S529-Y1 and S529-Y2, and if a melting curve shows that a characteristic peak can be generated, the Ganoderma lucidum is HMGIM-S140529, and if no characteristic peak can be generated, the Ganoderma lucidum is not HMG IM-S140529.

[0032] Compared with the traditional method of random primer amplification, the method of obtaining differential sites of the present invention has the advantages of high efficiency and rich specific sites, and can more effectively protect the fungus species. Compared with the conventional fruiting body morphology and mycelium antagonistic line observation, the detection method of the present invention has the advantages of short detection time, objective and true detection results, and high accuracy.

[0033] Lingzhi HMGIM-S140529 is a wild Lingzhi strain. After separation and purification, domestication and cultivation research, and evaluation of the content of active ingredients by our team, it was found that it has the advantages of fast growth, high temperature resistance, and high polysaccharide content. The polysaccharide content of substitute cultivation can reach 2.1±0.08%, which can provide raw materials for the development of medicinal and health foods with Lingzhi polysaccharides as the main ingredient, and has good edible and medicinal development value. In addition, because the strain was collected from the wild, it has rich genetic variation and is distantly related to the varieties circulating in the market, which can provide valuable germplasm resources for the selection and breeding of excellent new varieties.

[0034] Ganoderma lucidum HMGIM-S140529 was deposited on January 13, 2022 at the Guangdong Microbiological Culture Collection Center (GDMCC), address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 62208. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a picture of Ganoderma lucidum HMGIM-S140529 (Ganoderma lucidum) collected in the wild;

[0036] Figure 2 This is a photo of the mycelium of Ganoderma lucidum HMGIM-S140529;

[0037] Figure 3 This is the phylogenetic tree result diagram of HMGIM-S140529 and other species of Ganoderma based on ITS sequence;

[0038] Figure 4 It is the phenotype of domesticated fruiting body of Ganoderma lucidum HMGIM-S140529;

[0039] Figure 5 is a graph showing the amplification results of the specific primer pair in HMGIM-S140529 (S529) and market species;

[0040] Figure 6 It is the amplification result diagram of specific primer pairs in HMGIM-S140529 and market species. DETAILED DESCRIPTION

[0041] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0042] Example 1: Acquisition and identification of strains

[0043] On July 23, 2014, researchers from the Edible Fungi Research and Development Center of the Institute of Microbiology, Guangdong Academy of Sciences collected a Ganoderma specimen in a national nature reserve in Henan Province. The fungus was scattered in the humus soil of sunny broad-leaved forests and was identified as Ganoderma lucidum HMGIM-S140529. It was deposited in the Guangdong Microbiological Culture Collection Center (GDMCC) on January 13, 2022, with the address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the collection number is GDMCC No: 62208.

[0044] 1. Tissue separation and hyphae morphology

[0045] Wipe the surface of the Ganoderma lucidum fruiting body collected in the wild with 75% alcohol, tear open and clamp the internal fungus tissue of 0.2-0.5mm×0.2-0.5mm in a sterile environment and inoculate it into the enriched comprehensive PDA medium. Place it in a 25℃ incubator for constant temperature and dark culture. After the mycelium has grown all over the slope, take the tip mycelium and transfer it to purification culture. The purified mycelium is as follows Figure 2 As shown, the mycelium is white and dense, grows vigorously, has no mold contamination, has neat colony edges, and is resistant to high temperatures. It can quickly resume growth after being treated at 40°C for 24 hours, with an average growth rate of 0.82 cm / d (on enriched comprehensive PDA medium), which is significantly faster than the commercial strains Shanghai Agricultural No. 1 (0.67 cm / d) and Hanzhi 203 (0.73 cm / d).

[0046] 2. Identification

[0047] 2.1 Traditional Identification - Macroscopic and Microscopic Identification

[0048] The fruiting body of wild HMGIM-S140529 has lateral stalks, which are corky when fresh and corky when dried. The cap is flat and cap-shaped, with a diameter of about 4.2 cm and a stipe length of about 5 cm. The cap is mostly yellow-brown, with light yellow edges and a light yellow, nearly circular surface of the tube mouth, with 5-6 fungus holes per millimeter, and the flesh is light brown, with the upper flesh lighter in color and the lower flesh darker in color. It is corky and the fungus hole color is darker than the flesh. The basidiospore is oval, flat-topped, double-walled, with a transparent and smooth outer wall and a brown or light brown inner wall with small thorns, non-starchy, with an oil droplet in the center, 8.5-10.7 microns × 5.5-7.5 microns.

[0049] 2.2 Molecular identification

[0050] 2.2.1 ITS identification method

[0051] The purified mycelium was transferred to a rich comprehensive PDA plate medium covered with a serofen film on the surface, and placed in a constant temperature and dark culture at 25°C. After the mycelium grew all over the plate, fresh mycelium was collected and ground at room temperature. The DNA genome was extracted using a magnetic bead method genomic DNA extraction kit (Guangzhou Maibao Biotechnology Co., Ltd., catalog number DNF628-05B) with a fully automatic nucleic acid extractor. The obtained DNA solution (DNA template) was refrigerated at -20°C for use. The ITS-PCR experiment was performed using the universal primers ITS1 / ITS4 of the fungal ribosomal gene spacer region (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATTGATATGC, synthesized by Sangon Biotech (Shanghai) Co., Ltd.), and the amplification was performed on a BioRad PCR instrument. The composition of the PCR reaction solution (30 μl in total) is as follows:

[0052] Table 1 Fungal ITS PCR system

[0053]

[0054] Table 2 Fungal ITS PCR amplification procedures

[0055]

[0056] Related reagents (product number P111-01) were purchased from Nanjing Novozymes Biotech Co., Ltd. PCR products were directly sent to BGI for bidirectional sequencing.

[0057] 2.2.2 Determination of taxonomic status

[0058] The sequencing results were compared in NCBI GenBank, and the ITS sequence was , and the identification result indicated that the strain was a Ganoderma lingzhi strain. To further confirm its species, the maximum likelihood method (ML) and the neighbor-joining method (NJ) were used to construct phylogenetic trees, and Trametes versicolor was used as the outgroup. In the phylogenetic trees constructed by the two algorithms, HMGIM-S140529 and Ganodermalingzhi were both in the same branch, clustered into one category, and had a close relationship. It can be determined that HMGIM-S140529 is a Ganoderma lingzhi strain ( Figure 3). The Ganoderma lucidum recorded in the Chinese Pharmacopoeia is the dried fruiting body of the Polyporaceae fungus G. lucidum or G. sinense. However, with the development of phylogenetic research, the research of Professor Dai Yucheng, a taxonomic expert in my country, in 2013 showed that the Ganoderma lucidum widely distributed and cultivated in my country is different from the G. lucidum produced in Europe. Wasser et al. (2006) and Wasser (2011) also pointed out that the name G. lucidum was incorrectly used for the medicinal fungus Ganoderma lucidum. In fact, Chinese Ganoderma lucidum (commonly known as red ganoderma) is a new species: Ganoderma lingzhi SHWu, Y.Cao & Y.C.Dai (Cao et al. 2012), so the Latin name of red ganoderma recorded in the Chinese Pharmacopoeia should be G.lingzhi, not G.lucidum. The strain protected by this patent is a wild strain of G.lingzhi native to China, but since the current Pharmacopoeia still uses G.lucidum as the Latin name of Ganoderma lucidum, the strain protected by this patent is tentatively named G.lucidum, which will be corrected after the Pharmacopoeia is revised. It is named Ganoderma lucidum HMGIM-S140529, which was deposited in Guangdong Microbiological Culture Collection Center (GDMCC) on January 13, 2022, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, and the deposit number is GDMCC No: 62208.

[0059] Example 2: Domestication and systematic breeding of wild Ganoderma lucidum strains

[0060] (I) Domestication and cultivation of wild Ganoderma lucidum strains

[0061] 1. Culture medium formulation and configuration

[0062] 1.1 Mother culture medium (enriched comprehensive PDA): by mass fraction, it includes 20% potato + 2% glucose + 1% peptone + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + 0.001% vitamin B1, and the balance is water. The preparation method is: first wash and peel the potatoes, then weigh 200g of potatoes and cut them into small pieces, add water and cook them until they are soft (boil for 20 to 30 minutes, and the glass rod can pierce them), filter them with eight layers of gauze, and add 20g glucose, 10g peptone, 20g agar, 3g potassium dihydrogen phosphate, 1.5g magnesium sulfate, and 0.01% vitamin B1 to the filtrate. g, stir evenly, add water to 1000 ml after cooling slightly, and dispense into glass test tubes (18*180mm), sterilize at 0.11MPa, 121℃ high temperature and high pressure wet heat for 30min, and place on the slope to cool and shape before the culture medium solidifies after sterilization. After cooling, sterile operation is performed to inoculate the successfully isolated Ganoderma lucidum strain HMGIM-S140529. Place in a 25℃ incubator for constant temperature dark culture, and transfer after the mycelium has covered the slope (about 8-12 days).

[0063] 1.2 Production seed culture medium: by mass fraction, including 99% sorghum + 1% calcium carbonate, natural pH. Weigh the required proportion of sorghum, soak overnight and cook until thoroughly cooked, remove and filter to discard excess water, add calcium carbonate in proportion and mix well, put into a 13cm×25cm high temperature resistant transparent polypropylene bag, equivalent to 200-250g of dry material per bag. 0.11MPa, 121℃ high temperature and high pressure wet heat sterilization for 30min. Take out and cool, then aseptically inoculate the production mother seed. Make sure the mother seed block is buried in the production seed material during inoculation. Place the inoculated production seed in a 25℃ incubator for constant temperature dark culture. After the mycelium has eaten the material (about 8-12 days), it can be used as a production seed and inoculated into the cultivation bag.

[0064] 1.3 Production of cultivation bags: by mass fraction, including 50% sawdust, 38% cottonseed hulls, 10% wheat bran, 2% calcium carbonate, pH natural. Take the above formula and mix thoroughly and add water to a moisture content of 60-65%. After stacking overnight, turn the pile again and mix well, adjust the moisture content to 60-65% again, and put it into a 17cm×35cm high-temperature resistant transparent polypropylene strain bag, equivalent to 400-420g of dry material per bag. After loading the material, use a punching rod to punch holes in the bag material, the hole is as deep as the bottom of the bag, then put a plastic ring on the bag mouth, buckle the matching lid, and you will get a prepared cultivation bag material. Sterilize at 0.147MPa atmospheric pressure, 128℃ high temperature and high pressure for 90min, take it out and cool it down, and then aseptically inoculate the production seed, and the full growth time is about 18-20d.

[0065] 2. Cultivation management

[0066] After the cultivation bag is inoculated, it is cultured in a dark room at 25℃±1℃ and relative air humidity of 60-70%. When the mycelium in the cultivation bag is full of the cultivation material in the bag, open the lid of the cultivation bag, remove the fungus ring, and place the cultivation bags vertically (there should be gaps between bags), place them at 26-28℃, relative air humidity of 90-95%, and irradiate with scattered light for 8h / d. Primordia will begin to form in about 8d. After the cap is formed, fresh air is replaced every day, once in the morning and once in the evening, each time for 1h, and the air humidity is adjusted to 85%-90%. The growth point on the edge of the fruiting body disappears. Before starting to spray powder, adjust the air humidity to 80%, and harvest when a large number of spores are ejected from the back of the cap.

[0067] (II) Systematic breeding to obtain excellent strains and their fruiting body characteristics

[0068] After the fruiting of mushrooms, the fruiting bodies with strong growth (round kidney-shaped cap, long and thick cap) are selected for tissue separation and purification again to obtain alternative Ganoderma lucidum strains, which are preserved and prepared in sequence as mother strains and production strains, and cultivated for mushroom production. According to the growth rate, anti-bacterial ability and fruiting body formation ability of the alternative strains during the cultivation process, the tissue separation is performed to obtain purified mycelium, and this is a cycle to select and breed stable, fast-growing and antibacterial strains. The excellent strains finally preserved are cultivated and managed, and pruning is performed at the young fruiting body stage. After pruning, the incision no longer forms the primordium, and a single fruiting body can be formed by pruning once, which is conducive to the formation of fruiting bodies with good commercial properties and reduces the workload of cultivation personnel. Domestication fruiting body traits: fruiting body round kidney-shaped, cap length is 11.7-14.7cm, stipe height is 1.1-2.1cm, and stipe height is 9.6-12.8cm. Before the spores are ejected, the front of the cap is yellow-brown with obvious concentric rings and radial longitudinal ridges. When mature, the fruiting body is reddish brown and shiny, with a light yellow ventral surface, obvious fungal tubes, and a reddish brown stipe. The fresh weight of a single fruiting body is 51.2-64.4g, and the dry weight is 18.8-22.1g ( Figure 4 The comprehensive characteristics of domesticated fruiting bodies are better, and the fruiting body yield can be increased by further adjusting the culture medium formula or cultivation conditions.

[0069] The polysaccharide content of the Ganoderma lucidum fruiting bodies obtained by domestication and cultivation was determined by referring to the "sulfuric acid-anthrone colorimetric method" in the Ganoderma lucidum of the "Chinese Pharmacopoeia". The polysaccharide content of the fruiting bodies was 2.1%, which was significantly higher than the 0.9% specified in the "Chinese Pharmacopoeia" and also higher than most of the bred Ganoderma lucidum strains, such as Taishan Red Ganoderma Lucidum No. 1 (1.07%), the hybrid TL-3 bred with Taishan Red Ganoderma Lucidum No. 1 as the parent (1.09%), Taishan wild Ganoderma lucidum strain 4895 (0.84%), wild Ganoderma lucidum HMGIM-Z150381 from Jinzhai, Anhui (1.35%), the widely used commercial strain Hanzhi 203 (1.37%), and Shanghai Agricultural No. 1 (1.2%). Therefore, HMGIM-S140529 can provide raw materials for the development of medicinal and health foods with Ganoderma lucidum polysaccharides as the main ingredient, and has good edible and medicinal development value.

[0070] Based on the outstanding advantages of HMGIM-S140529, such as fast mycelium growth rate and high temperature resistance, good fruiting body morphology and high polysaccharide content, this strain can be used as a basis to select more excellent new strains through mutagenesis breeding, hybrid breeding, protoplast fusion breeding and other methods.

[0071] The strain was transferred from the storage tube to a Jiafu comprehensive PDA plate, and the strain was activated by dark culture at 28℃. After activation twice, the strain was inoculated on the Jiafu comprehensive PDA plate with an equal amount using a hole puncher, and dark cultured at 28℃ for 4 days. The initial diameter of the colony was recorded by the cross method. After treatment at 40℃ for 24 hours, it was placed at 28℃ for recovery culture for 3 days, and the final diameter of the colony was recorded. Each treatment was repeated 8 times, and the heat resistance of the strain was evaluated by measuring the speed of colony recovery growth. The measurement results showed that HMGIM-S140529 was resistant to high temperature and could maintain a faster growth rate after high temperature stress. The average growth rate was 0.82cm / d, which was significantly faster than the market strains Hunong No. 1 (0.67cm / d) and Hanzhi 203 (0.73cm / d), as well as the high-yield polysaccharide HMGIM-W141201 (0.69cm / d), and the fast-growing HMGIM-Z150381 (0.40cm / d).

[0072] Example 3. Development of strain-specific molecular markers

[0073] The widely used commercial strains Shanghai Agricultural No. 1, Hanzhi 203 and wild Ganoderma lucidum HMGIM-S140529 were inoculated on a flat plate culture medium (enriched comprehensive PDA), the mycelium was collected and the total DNA was extracted. After the genomic DNA test was qualified, the DNA was fragmented by ultrasound, and then the fragmented DNA was purified, the end repaired, 3′ end A was added, and the sequencing adapter was connected. Then, the fragment size was selected by agarose gel electrophoresis, and PCR amplification was performed to form a sequencing library. The constructed library was first subjected to library quality inspection. The qualified library was sequenced with Illumina for double-end sequencing, and the sequencing sequence read length was 150bp. Each sample generated more than 5G of data. The raw sequencing sequence (Raw Reads) obtained by sequencing contained low-quality Reads with adapters. In order to ensure the quality of information analysis, the Raw Reads were filtered to obtain Clean Reads for subsequent information analysis. The main steps of data filtering are as follows: (1) remove reads with adapters; (2) filter reads with N content exceeding 10%; (3) remove reads with bases with quality values ​​below 10 exceeding 50%. Use BWA software to locate the obtained clean reads to the Ganoderma lucidum genome tested by our team, and use GATK's HaplotypeCaller (local haplotype assembly) algorithm to perform InDel mutation detection to obtain the final set of mutation sites. Select mutation sites with more than 20 bp of fragment insertion in HMGIM-S140529 and Shanghai Agricultural No. 1 and Hanzhi 203 that are consistent with the reference genome, and primer design from which the mutation sites with high coverage and genotype quality values ​​are selected. The forward primer was designed on the insert fragment, and the reverse primer was not restricted in position. The primer information is as follows: S529-1F / R (5'->3'): GCAGGCACAACTTTGACGAT / TATCACACATGCCACGCTCT; S529-2F / R (5'->3'): AAGCGCGTTGACATTGGTAA / ACCCCACAAGCAGGAAGATA. The primer pair was synthesized by Sangon Biotech (Shanghai) Co., Ltd. Domestically selected Longzhi and Izumizhi were added during PCR amplification. PCR amplification was performed on a BioRad PCR instrument, and the composition of the PCR reaction solution (30 μl in total) is shown in Table 3:

[0074] Table 3 HMGIM-S140529 molecular marker PCR system

[0075]

[0076]

[0077] The PCR program is: 95℃ pre-denaturation, 95℃ denaturation for 30sec, 58℃ annealing for 30sec, 72℃ extension for 30sec, GOTOstep2, execute 32 cycles, 72℃ extension for 5min, 12℃ storage to end the program. The PCR product was electrophoresed on a 1-1.5% agarose gel (5v / cm) for 25min and photographed in a gel imaging system. The results are shown in Figure 5 As shown, the primer pair was effectively amplified only in HMGIM-S140529 (S529), which indicated that primers S529-1F / R and S529-2F / R were InDel molecular marker primers of HMGIM-S140529. The sizes of DNA fragments amplified by these two primer pairs were 500-750 bp and 450-510 bp, respectively, and the specific DNA fragments of 500-750 bp and 450-510 bp were the InDel molecular markers of the new strain of Ganoderma lucidum HMGIM-S140529 of the present invention.

[0078] The PCR products were sent to BGI for double-end sequencing, and the results were all overlapping peaks. The purified DNA was subjected to TA cloning to obtain single clones. Six single clones were randomly selected for each DNA fragment, and specific sequence information was obtained by sequencing.

[0079] After comparison, the monoclonal clones obtained from S529-1 can be divided into two haplotypes, with 7 SNPs and 2 InDels, and the sequence lengths are 587bp and 588bp respectively. The specific sequences are as follows:

[0080] S529-1-A:

[0081] TGCAGGCACAACTTTGACGATGGATGTAAGAACTTGAAGACGCTTGCGATATACTTACCCCACTGTTTCTCGCGTGTGGTGCAAAAATGGCACACAGTATCCATCCGAGCCGCCGCACAGAGAAGATAGCACGATCCAAGCCGACTGCCATTGCCCCTAGAAGACCCCACCTGCGCGGGGAAACAAACCCAGTTCAGGGCTGCGCAGGGGTGTTCTCGGCGAACTACTGGCACTCGTGGTTGTCGGCGTTGAAGATCGCCCGGCCGGTAGCAGTCGAGTGCCTGCAGCTGTGCGTCCTCCTGACCGTACTTGCACGTAGTCCTTGCTCCCACCATTGGCGGTGAAGTGGGACGCCTAAGAGTTGGACAACGGCGGACGGATCGTCACCAAACTCATGTCGCAGGAACACAAACAAACACTCGAACCTTGCTGGCACCCACCCCCGGCCGCGGATTGTGAAGGCCGAATCCTTGAGGCGTCGCGACCCGGGCCCACGGTGCCTTCGAGTCCGTACAGCGGCTCGTACTAACAGAACCGTAGACATTTGACCCCTTTGGTGAGGGACAAGAGCGTGGCATGTGTGATAA (as shown in SEQ ID NO.1).

[0082] S140529-1-B:

[0083] (As shown in SEQ ID NO.2).

[0084] After comparison, the monoclonal clones obtained from S529-2 can be divided into two haplotypes, with 1 SNP and 2 InDels, and the sequence lengths are 503bp and 508bp respectively. The specific sequences are as follows:

[0085] S529-2-A: TAAGCGCGTTGACATTGGTAATGTCCCGTTAATCACCACGTCACTTGGAGGGCAGCGACCCCGTACTGAAACGACGTATCAAGCCACCCCTACAGCCCCGGCATATTATTGTGCAGGACCTACAACACCCGGACTTAGCGGGACCCGGTCAGGCCCCAACGCCATCAACGGTTTGTTAGGCAACAGTTTCGCAAGCAGCCGCCGAGATGGGCACTGAACATGGTCATCAGGTACGTTGTACTAGTAACTAGCTCAAAATCCACCGCTGTCCAGGCCTCCTTCGAACAAGGCACGGCGTAGATCGGGGGGGCATTGTTTCGTTAGCGCCAAGTGTGTATGACTACCTTCGAATTCGGGAACGAGCGCCGTCGCAAGCTCATGCGTTGCGCCACAGAATTATCAATACAAATAAGTACGCATATATAAAACACATTCTAACTGGAGCAGTACCCCCTATCGCCATTTTCCAGATGTATTGCGGATATCTTCCTGCTTGTGGGGTA (as shown in SEQ ID NO. 3).

[0086] S529-2-B:

[0087] TAAGCGCGTTGACATTGGTAATGTCCCGTTAATCACCACGTCACTTGGAGGGCAGCGACCCCGTACTGAAACGACGTATCAAGCCACCCCTACAGCCCCGGCATATTATTGTGCAGGACCTACAACACCCGGACTTAGCGGGACCCGGTCAGGCCCCAACGCCATCAACGGTTTGTTAGGCAACAGTTTCGCAAGCAGCCGCCGAGATGGGCACTGAACATGGTCATCAGGTACGTTGTACTAGTAACTAGCTCAAAATCCACCGCTGTCCAGGCCTCCTTCGAACAAGGCACGGCGTAGATCGGGGGGGGGCATTGTTTCGTTAGCGCCAAGTGTGTATGACTACCTTCGAATTCGGGAACGAGCGCCGTCGCAGCAAGCTCATGCGTTGCGCCACAGAATTATCAATACAAATAAGTACGCATATATAAAACACATTCTAGCTGGAGCAGTACCCCCTATCGCCATTTTCCAGATGTATTGCGGATATCTTCCTGCTTGTGGGGTA (as shown in SEQ ID NO.4).

[0088] According to the sequence information obtained by sequencing, specific primer pairs for quantitative detection of HMGIM-S140529 were designed using an online primer design website (https: / / primer3.ut.ee / ), and the information is as follows: S529-YF1 / R1 (5'->3'): CTTACCCCACTGTTTCTCGC / AACGCCGACAATCACGAGTA; S529-YF2 / R2 (5'->3'): GACCTACAACACCCGGACTTAG / GTACCTGATGACCATGTCCAGC. The primer pairs were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Fluorescence quantitative PCR reaction was performed using qPCR SYBR Green Master Mix kit (Nanjing Novogene Biotech Co., Ltd., catalog number: Q111). The genomic DNA of HMGIM-S140529, Shanghai Agricultural No. 1, Longzhi, Hanzhi, and Quanzhi was used as template, and primer pairs S529-YF1 / R1 and S529-YF2 / R2 were used for PCR amplification, respectively, with 3 technical replicates for each reaction. The reaction system was 20 μL total volume: qPCR SYBR Green Master Mix 10 μL, PCRprimer 1 (10 μmol / L) 1 μL, PCRprimer 2 (10 μmol / L) 1 μL, template DNA 1 μL, and ddH 2O was added to 20 μL. The reaction program was 95°C 2 min pre-denaturation, 95°C 15 s, 58°C 15 s, 72°C 20 s, and 40 cycles. The reaction was performed using a fluorescent quantitative PCR instrument (Applied Biosystems QuantStudio 6&7 Real Time PCR System, Thermo Fisher). Figure 6 As shown, the melting curve results showed that S529-YF1 / R1 and S529-YF2 / R2 produced a characteristic peak after PCR reaction, and the peak diagrams between repeats were similar, indicating that S529-YF1 / R1 and S529-YF2 / R2 could produce specific products. The amplification curve showed that S529-YF1 / R1 and S529-YF2 / R2 only stimulated fluorescence signals in the presence of HMGIM-S140529 DNA, and other Ganoderma lucidum strains were not effectively amplified during the entire PCR cycle.

[0089] In summary, S529-1F / 1R, S529-2F / 2R and S529-Y1F / 1R, S529-Y2F / 2R can be used to specifically detect HMGIM-S140529 by agarose gel electrophoresis and fluorescence PCR, respectively.

Claims

1. Lingzhi ( Ganoderma lucidum ) HMGIM-S140529, the deposit number is GDMCC No: 62208.

2. A cultivation method for the Ganoderma lucidum HMGIM-S140529 according to claim 1, characterized in that: The specific steps are:

1. Culture medium formula Mother culture medium: by mass fraction, including 20% ​​potato + 2% glucose + 1% peptone + 2% agar + 0.3% potassium dihydrogen phosphate + 0.15% magnesium sulfate + 0.001% vitamin B1, the solvent is water; Production seed culture medium: by mass fraction, including 98-99% sorghum + 1-2% calcium carbonate, natural pH; Cultivation material: by mass fraction, including 50% sawdust, 38% cottonseed hulls, 10% wheat bran, 2% calcium carbonate; water content 60-65%, natural pH; 2. Cultivation Process Mycelium culture: Under aseptic operation conditions, take the Ganoderma lucidum HMGIM-S140529 block and inoculate it into the mother culture medium, with a humidity of 50%-60%, and culture it at a constant temperature of 25℃ in the dark for 8-12 days until the mycelium covers the slant; transfer the mother culture mycelium to the production culture medium for expansion culture, and culture it at a constant temperature of 25℃ in the dark until the mycelium covers the bag, then inoculate the production mycelium into the cultivation material, and culture it at a constant temperature of 25℃ in the dark, with a humidity of 50%-60%, and ventilate regularly to keep the carbon dioxide concentration below 4000 ppm. After culturing for 18-20 days until the mycelium covers the bag, culture it under the same conditions for 7-10 days for post-ripening period culture; Management of mushroom production: After the mycelium matures, buds are promoted. The lids of the cultivation bags are opened and placed vertically. The temperature is 26-28℃ and the relative humidity of the air is maintained at 90%-95%. The diffuse light is applied for 8 h / d. After 8 days of management, primordia begin to form at the opening of the cultivation material. The humidity is adjusted to 80-90%. When the mushroom cap begins to differentiate, fresh air is exchanged twice a day for 1 h each time. The growth points on the edge of the fruiting body disappear. The air humidity is adjusted to 80% before spraying. Harvesting: Harvest the fruiting bodies when spores are ejected in large quantities from the back of the cap.

Images