Sulfonylurea herbicide hydrolase TsmE mutant, its encoding gene and use

Abstract

The present invention discloses a sulfonylurea herbicide hydrolase TsmE mutant, a coding gene and a use thereof. The present invention uses the wild-type sulfonylurea herbicide hydrolase TsmE as a starting template and obtains a mutant M5 (A183S) with significantly improved enzyme activity through directed evolution technology. Compared with the wild type, the specific enzyme activity of the mutant M5 to metsulfuron-methyl, sulfosulfuron-methyl, bensulfuron-methyl, benzylsulfuron-methyl and ethametsulfuron-methyl is increased by 1.0, 1.2, 3.6, 1.2 and 1.7 times, respectively. The mutant and its coding gene can be used to construct sulfonylurea herbicide-resistant transgenic crops, and can also be used to remove sulfonylurea herbicides in soil and water, and has very important theoretical and application value.

Description

Technical Field

[0001] The invention belongs to the technical field of protein engineering, and specifically relates to a sulfonylurea herbicide hydrolase TsmE mutant, a coding gene and use thereof. Background Art

[0002] In recent years, as highly toxic and long-residue herbicides are gradually restricted and eliminated, the herbicide market has gradually entered the era of low-toxic and high-efficiency products. Sulfonylurea herbicides have developed rapidly with their advantages of high efficiency, broad spectrum and low toxicity, and have become the third largest herbicide after organophosphorus and acetamide herbicides. According to the Food and Agriculture Organization of the United Nations (FAO), the use of sulfonylurea herbicides was only 129 tons in 1992, but by 2011, its use increased by 17 times, and in Europe and North America, its use even increased by more than 100 times. In my country, the annual application area of ​​sulfonylurea herbicides has exceeded 2 million hectares, and is still expanding. At present, the global annual sales of sulfonylurea herbicides exceed US$2 billion, accounting for about 10% of the total herbicide sales.

[0003] Although sulfonylurea herbicides are low in toxicity to mammals, some sulfonylurea herbicides, such as metsulfuron-methyl, sulfamethoxam, chlorimuron-methyl and ethametsulfuron-methyl, are chemically stable and have a long soil residual period, especially in alkaline soil, where the residual period can be as long as 2-3 years, causing serious phytotoxicity to subsequent crops. Some sulfonylurea herbicides with short residual periods, such as benzylsulfuron-methyl, thifensulfuron-methyl and bensulfuron-methyl, can be used as target herbicides for the construction of herbicide-resistant transgenic crops. Therefore, obtaining excellent sulfonylurea herbicide degradation and detoxification enzymes and gene resources has important application value for bioremediation of sulfonylurea herbicide residue pollution and herbicide-resistant transgenic engineering.

[0004] TsmE is from bacteria Hansschlegelia zhihuaiae The esterase identified in S113 can catalyze the hydrolysis, deesterification and detoxification of various sulfonylurea herbicides such as thifensulfuron-methyl, metsulfuron-methyl, sulfosulfuron-methyl, benzylsulfuron-methyl, bensulfuron-methyl, ethametsulfuron-methyl and chlorimuron-methyl. However, TsmE has an extremely high deesterification efficiency for thifensulfuron-methyl, but a lower deesterification efficiency for other sulfonylurea herbicides. In this context, the present invention improves the catalytic activity of the enzyme through directed evolution technology, so that it can more efficiently catalyze the deesterification and detoxification of sulfonylurea herbicides, thereby improving its practical application value. Summary of the invention

[0005] Technical problem to be solved: In response to the above technical problem, the present invention provides a sulfonylurea herbicide hydrolase TsmE mutant, its encoding gene and use, which can effectively solve the shortcoming of the above TsmE in having low deesterification efficiency for sulfonylurea herbicides other than thifensulfuron-methyl.

[0006] Technical solution: In the first aspect, the present invention provides a sulfonylurea herbicide hydrolase TsmE mutant, wherein the alanine at position 183 is mutated to serine, and the amino acid sequence of the mutant is shown in SEQ ID NO.4.

[0007] In a second aspect, the present invention provides a gene encoding the sulfonylurea herbicide hydrolase TsmE mutant described in the first aspect, wherein the encoding gene comprises a mutation of G at position 547 to T, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.3.

[0008] In a third aspect, the present invention provides a recombinant expression vector containing the gene encoding the sulfonylurea herbicide hydrolase mutant described in the second aspect, wherein the recombinant expression vector is obtained by inserting the gene encoding the sulfonylurea herbicide hydrolase mutant described in the second aspect into the Nde I and Hind III sites of pET-29a(+).

[0009] In a fourth aspect, the present invention provides a genetically engineered bacterium containing a gene encoding the sulfonylurea herbicide hydrolase TsmE mutant described in the second aspect, wherein the expression strain of the genetically engineered bacterium is Escherichia coli BL21 (DE3).

[0010] In a fifth aspect, the present invention provides the use of the mutant described in the first aspect in the preparation of a sulfonylurea herbicide for degradation;

[0011] Use of the mutant described in the first aspect in removing sulfonylurea herbicide residues in soil or water;

[0012] Use of the encoding gene of the second aspect in preparing transgenic crops that degrade sulfonylurea herbicides or construct sulfonylurea herbicide-resistant crops;

[0013] Use of the vector described in the third aspect or the genetically engineered bacteria described in the fourth aspect in the preparation of a sulfonylurea herbicide for degradation, wherein the sulfonylurea herbicide is bensulfuron-methyl, sulfosulfuron-methyl, thifensulfuron-methyl, bensulfuron-methyl, metsulfuron-methyl, ethametsulfuron-methyl or chlorimuron-methyl.

[0014] Beneficial effects: The present invention uses the wild-type sulfonylurea herbicide hydrolase TsmE as a starting template, and through directed evolution technology, obtains a mutant M5 (A183S) with significantly improved enzyme activity. Compared with the wild type, the specific enzyme activity of mutant M5 to metsulfuron-methyl, sulfuron-methyl, bensulfuron-methyl, benzylsulfuron-methyl and ethametsulfuron-methyl is increased by 1.0, 1.2, 3.6, 1.2 and 1.7 times, respectively. The mutant and its encoding gene can be used to construct sulfonylurea herbicide-resistant transgenic crops, and can also be used to remove sulfonylurea herbicides in soil and water, and has very important theoretical and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is a diagram of the construction of the mutant M5 recombinant expression vector;

[0016] Figure 2 It is the SDS-PAGE profile of the sulfonylurea herbicide hydrolase TsmE mutant; wherein, lane 1 is the protein marker, lane 2 is the wild-type TsmE, and lane 3 is the mutant M5. DETAILED DESCRIPTION

[0017] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments:

[0018] Example 1: Directed evolution screening of TsmE mutants with significantly improved enzyme activity

[0019] 1.1 Synthesis of wild-type TsmE gene

[0020] The wild-type TsmE gene was synthesized, and its nucleotide sequence (1197 bp) is shown in SEQ ID NO. 1, which encodes 398 amino acids of TsmE protein, and its sequence is shown in SEQ ID NO. 2. The synthesized TsmE was cloned into the pUC57 vector, and the recombinant vector was named pUC-tsmE, and then transformed into Escherichia coli DH5α.

[0021] 1.2 Construction of TsmE gene mutation library

[0022] Using plasmid pUC-tsmE as template, error-prone PCR was performed with primer 1 (SEQ ID NO.5) and primer 2 (SEQ ID NO.6), causing TsmE gene to mutate due to random base mismatch. Error-prone PCR products were cloned into pMD19-T vector, and enzyme-linked products were heat-shock transformed into Escherichia coli DH10B (ilvG + ). The random mutation library was spread on LB plates supplemented with 100 mg / L Amp, 200 mg / L IPTG and 200 mg / L X-Gal and cultured at 37°C overnight;

[0023] The PCR primer sequences are as follows:

[0024] SEQ ID NO.5

[0025] ATGGAAACCGATAAAAAAACCG

[0026] SEQ ID NO.6

[0027] TCAGCTTTCGTTCTGATCTAAG

[0028] The error-prone PCR reaction system is:

[0029]

[0030] PCR amplification procedure:

[0031] a. Pre-denaturation at 95℃ for 3min;

[0032] b. Denaturation at 94°C for 0.5 min, annealing at 52°C for 1.0 min, and extension at 72°C for 1.5 min for 30 cycles;

[0033] c. Extend at 72℃ for 10 min and cool to room temperature.

[0034] 1.3 Screening of TsmE gene mutation library

[0035] The transformation products in the above mutant library were inoculated into a basal salt medium containing 50 μM metsulfuron-methyl (5 g / L glucose, 200 mg / L valine, 200 mg / L leucine and 100 mg / L ampicillin were also added) and cultured for 3 days. + ) is very sensitive to high concentrations of metsulfuron-methyl. The resistance gene can convert metsulfuron-methyl into an acid product that is non-toxic to bacteria, thereby eliminating the effect of metsulfuron on Escherichia coli DH10B (ilvG + ) growth inhibition, and thus the above mutant library was subjected to high-throughput screening using this principle. Recombinant strain colonies that can grow well on the screening plate were selected, and the resistance and deesterification ability of the selected strains to sulfonylurea herbicides were determined, and recombinant strains with significantly improved deesterification activity of sulfonylurea herbicides were selected, and the TsmE sequence mutations in the recombinant strains were analyzed;

[0036] The basic salt medium used was formulated as follows: 1.0 g NH4Cl, 0.5 g NaCl, 1.5 g K2HPO4, 0.5 g KH2PO4, 0.2 g MgSO4·7H2O, and deionized water was added to make up to 1 L. 2% agar powder was added to the solid medium and sterilized before use.

[0037] 1.4 Obtaining mutated resistance genes

[0038] After several rounds of screening, a TsmE mutant was obtained, named M5. The 547th position of the M5 nucleotide sequence was mutated from the original G to T, and the nucleotide sequence of the mutant M5 is shown in SEQ ID NO.3, resulting in the 183rd position of its amino acid sequence being mutated from the original alanine to serine, and the amino acid sequence of the mutant M5 is shown in SEQ ID NO.4.

[0039] Example 2: High-efficiency expression of TsmE mutant gene in BL21 (pET-29a (+))

[0040] 2.1 PCR amplification of TsmE mutant gene

[0041] Primer 3 (SEQ ID NO.7): TGCAGA CATATG GAAACCGATAAAAAAAC (underlined Nde I restriction site) and primer 4 (SEQ ID NO.8): CCC AAGCTT TCAGCTTTCGTTCTGATCTAAGCCGTGC (the underline indicates the Hind Ⅲ restriction site), using the screened mutant recombinant strain as a template, the gene of TsmE mutant M5 (containing Nde I and Hind Ⅲ restriction sites at the end) was amplified using the following PCR amplification system:

[0042] PCR amplification system:

[0043]

[0044] PCR amplification procedure:

[0045] a. Pre-denaturation at 98℃ for 3min;

[0046] b. Denaturation at 98°C for 0.5 min, annealing at 55°C for 0.5 min, and extension at 72°C for 1.0 min for 30 cycles;

[0047] c. Extend at 72°C for 10 min and cool to room temperature.

[0048] 2.2 Construction of bacterial expression vectors and acquisition of recombinant microorganisms

[0049] The PCR product was recovered and purified using a gel purification recovery kit. For specific methods, refer to the kit instructions. The purified PCR product and pET-29a (+) plasmid were digested with restriction endonucleases Nde I and Hind Ⅲ, respectively. The digestion system is as follows:

[0050]

[0051] The enzyme digestion was carried out at 37°C for 12 h, and then the mutant gene fragments were ligated with the expression vector pET-29a(+) after the enzyme digestion. The constructed recombinant expression vector was named pET29a-M5. Figure 1 The recombinant expression vector was transformed into the expression host bacteria BL21 (DE3) to obtain the recombinant microorganism BL21 (M5).

[0052] 2.3 Expression and purification of TsmE mutants

[0053] BL21 (M5) was inoculated into LB medium and cultured at 37°C with a shaker at 200 rpm until OD 600nm The concentration of IPTG was 0.4-0.6, and IPTG was added to a concentration of 0.4 mM. The cells were induced at 16°C for 12 hours. 100 mL of bacterial solution was centrifuged to collect the cells, and the cells were washed twice with PBS (50 mM, pH 7.4). The cells were resuspended with 10 mL of PBS buffer, ultrasonically disrupted (Auto Science, UH-650Bultrasonic processor, 30% intensity) for 5-10 minutes, and centrifuged at 12000 rpm for 30 minutes. The supernatant was collected and purified using a nickel ion affinity chromatography column. The purified enzyme was subjected to protein electrophoresis. Figure 2 , indicating that mutant M5 was successfully expressed.

[0054] Example 3: Determination of enzyme activity of TsmE mutant

[0055] Enzyme activity reaction system (1 mL): Purified TsmE mutant enzyme and 100 μM sulfonylurea herbicide substrate were added to 50 mM PBS buffer (pH 7.4). Each reaction was started with the addition of the reaction enzyme, and the reaction was terminated by adding an equal volume of acetonitrile immediately after 10 min at 30°C. The activity of the mutant was determined by high performance liquid chromatography (HPLC) to detect the reduction of each sulfonylurea substrate, with no enzyme added as a control. HPLC conditions were: UltiMate ®3000 Titanium System high performance liquid chromatograph; Thermo Scientific Syncronis C18 column (5 μm, 250 mm×4.6 mm); mobile phase was acetonitrile / water (60 / 40, v / v), with 0.5% acetic acid added to water; flow rate was 1 mL / min; injection volume was 20 μL; detection wavelengths were 230 nm and 255 nm; column temperature was 40°C. One unit of enzyme activity is defined as: the amount of enzyme required to catalyze the hydrolysis of 1.0 μmol of substrate in 1 min at pH 7.4 and temperature 30°C is defined as 1 unit of enzyme activity (U). The experimental results are shown in Table 1.

[0056] Table 1 Enzyme activities of wild-type TsmE and mutant M5 against various sulfonylurea herbicides

[0057]

[0058] The above experimental results show that compared with the wild-type TsmE, the specific enzyme activities of mutant M5 to metsulfuron-methyl, sulfamethoxazole-methyl, bensulfuron-methyl, benzylsulfuron-methyl and ethametsulfuron-methyl were increased by 1.0, 1.2, 3.6, 1.2 and 1.7 times, respectively.

[0059] The sources of the microorganisms used in the above examples are as follows: Escherichia coli DH5α was purchased from Takara Biotechnology (Dalian) Co., Ltd., the Escherichia coli high expression vector pET-29a(+) was purchased from Novegen, and the expression host bacteria Escherichia coli BL21(DE3) was purchased from Shanghai Yingjun Biotechnology Co., Ltd.

[0060] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A sulfonylurea herbicide hydrolase TsmE mutant, characterized in that: The mutant comprises a mutation of alanine at position 183 to serine, and the amino acid sequence of the mutant is shown in SEQ ID NO.

4.

2. A gene encoding the sulfonylurea herbicide hydrolase TsmE mutant according to claim 1, characterized in that: The coding gene comprises a mutation of G to T at position 547, and the nucleotide sequence of the coding gene is shown in SEQ ID NO.

3.

3. A recombinant expression vector containing the gene encoding the sulfonylurea herbicide hydrolase mutant according to claim 2.

4. The recombinant expression vector according to claim 3, characterized in that: The sulfonylurea herbicide hydrolase mutant encoding gene of claim 2 is inserted between the Nde I and Hind III sites of pET-29a(+).

5. A genetically engineered bacterium containing the gene encoding the sulfonylurea herbicide hydrolase TsmE mutant according to claim 2.

6. The genetically engineered bacterium according to claim 5, characterized in that: The expression strain of the genetically engineered bacteria is Escherichia coli BL21 (DE3).

7. Use of the mutant according to claim 1 in the preparation of a sulfonylurea herbicide for degradation.

8. Use of the mutant according to claim 1 in removing sulfonylurea herbicide residues in soil or water.

9. Use of the coding gene according to claim 2 in preparing transgenic crops capable of degrading sulfonylurea herbicides or constructing sulfonylurea herbicide-resistant transgenic crops.

10. Use of the vector according to claim 3 or the genetically engineered bacteria according to claim 5 in the preparation of a sulfonylurea herbicide for degradation.

Images