Double-stranded RNA for killing schistosoma and use thereof

Abstract

The application discloses double-stranded RNA for killing schistosoma and application thereof, wherein the nucleotide sequence of the positive strand of the double-stranded RNA is shown as SEQ ID NO:1. Through animal experiments, the double-stranded RNA has good killing effect on the early infection establishment stage (1-30 dpi) of the worm body, the worm development stage (18-30 dpi) after infection establishment, and the mature worm stage (26-42 dpi) after infection establishment, can not only prevent schistosoma from establishing infection in the host body and effectively inhibit the growth and development of the worm body, but also can reduce the oviposition of female worms, even kill the worm body with established infection, and reduce the pathological damage to the host, has great treatment potential, and can be used for treating schistosoma infection at different development stages.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology and biomedicine technology, and in particular to a double-stranded RNA for killing schistosoma japonicum and its application. Background Art

[0002] Schistosomiasis is an important zoonotic parasitic disease. The deposition of large numbers of worm eggs is the main pathogenesis of schistosomiasis. When the worm eggs are deposited in surrounding tissues and organs, such as in the liver or bladder, they can cause inflammatory immune responses (such as granulomas), leading to intestinal, liver, spleen and urogenital system diseases.

[0003] Currently, the treatment for schistosomiasis relies on a single drug, praziquantel, which boasts high efficacy, minimal side effects, convenient oral administration, and low cost. Even with this single drug, approximately 250 million people have been treated. Studies have reported the emergence of drug resistance in schistosomes in some areas. Furthermore, praziquantel is ineffective against larval worms, making it ineffective in preventing larval maturation and acute reinfection. Therefore, identifying new drug targets remains a hot topic for researchers in the field of schistosomiasis. The lack of an effective vaccine, the limited availability of therapeutic agents, and the emergence of drug resistance in the parasites all necessitate the urgent development of new treatments.

[0004] The development of gene editing for schistosomes has been very slow due to factors such as their complex life cycle, lack of immortalized cell lines, large genomes, and strong resistance to genetic manipulation. This lack of genetic manipulation tools has significantly limited the study of schistosome gene function, hindering the development of anti-schistosomal drugs or vaccines. Currently, the only widely used technique for schistosomes is RNA interference (RNA interference), which works by triggering the degradation of homologous mRNA transcripts using an exogenous, gene-specific double-stranded RNA, leading to post-transcriptional silencing of the target gene. In 2018, Li et al. first used tail vein injection to inject dsRNA into mice infected with schistosomes, demonstrating that this method effectively inhibited SjCB1 expression and blocked reproductive development. This method was then further extended to studying the function of genes related to parasitism and reproductive development within the host, providing a new therapeutic approach for schistosomes. Summary of the Invention

[0005] In response to the shortcomings of the existing technology, the present invention aims to provide a double-stranded RNA for killing schistosomiasis infection and its application. The double-stranded RNA can target schistosomes infected at different developmental time points and can be used to treat schistosomes in the early infection establishment stage (1-30dpi), the development stage after infection is established (18-30dpi), and the mature stage after infection is established (26-42dpi), and can effectively treat schistosomiasis.

[0006] To solve the above technical problems, the present invention provides a double-stranded RNA for killing schistosomes and its application, characterized in that the nucleotide sequence of the sense strand of the double-stranded RNA is as shown in SEQ ID NO: 1.

[0007] The present invention also provides the use of the double-stranded RNA in preparing anti-schistosoma drugs.

[0008] Specifically, the schistosoma is Schistosoma japonicum.

[0009] Specifically, the double-stranded RNA is used to inhibit the early establishment stage (1-30 dpi) of Schistosoma japonicum infection in vivo.

[0010] Specifically, the double-stranded RNA is used to inhibit the development of Schistosoma japonicum in vivo after infection is established (18-30 dpi).

[0011] Specifically, the double-stranded RNA is used in vivo to inhibit the mature parasite stage (26-42 dpi) of Schistosoma japonicum after infection is established.

[0012] Specifically, the double-stranded RNA is used to inhibit Schistosoma japonicum egg laying and egg vitality in vivo.

[0013] Specifically, the double-stranded RNA is used in vivo to reduce the pathological damage of Schistosoma japonicum to the host liver.

[0014] Specifically, the dosage form of the drug is injection, oral preparation, buccal tablet, spray, suspension, capsule, tablet, pill or granule.

[0015] Specifically, the drug further includes one or more of a pharmaceutically acceptable carrier, diluent or excipient, and also includes a Schistosoma japonicum dsRNA SRP54 solution prepared with physiological saline as a solvent.

[0016] The present invention provides a double-stranded RNA for killing schistosome infections, establishes its therapeutic dosage form, and explores its usage and dosage. Through animal experiments, it is found that the double-stranded RNA has a good killing effect on schistosomes in the early infection establishment stage, the worm development stage after infection establishment, and the mature worm stage. It can not only prevent schistosomes from establishing infection in the host and effectively inhibit the growth and development of the worm, but also reduce the egg laying of female worms and kill the worms that have established infection, and reduce pathological damage to the host. It has great application potential, can be used to treat schistosome infections at different developmental stages, and can effectively treat schistosomiasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solution of the present invention, the following briefly introduces the drawings required for use in the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0018] Figure 1 Schematic diagram of the usage and dosage of double-stranded RNA for the early stage of Schistosoma japonicum infection establishment;

[0019] Figure 2 A and Figure 2 B is a schematic diagram of the recovery rate and worm length of Schistosoma japonicum after injection of dsRNA SRP54 in the early stage of Schistosoma infection establishment;

[0020] Figure 3 Schematic diagram of the usage and dosage of double-stranded RNA for infection establishment of post-parasite developmental stages;

[0021] Figure 4 A and Figure 4 B is a schematic diagram showing the recovery rate and worm length of Schistosoma japonicum after injection of dsRNA SRP54 at the worm development stage after infection establishment;

[0022] Figure 5 Schematic diagram of the usage and dosage of double-stranded RNA for infection establishment of mature parasite stages;

[0023] Figure 6 A and Figure 6 B is a schematic diagram of the statistical results of the recovery rate and worm length of Schistosoma japonicum after injection of dsRNA SRP54 at the mature worm stage after infection is established;

[0024] Figure 7 Schematic diagram of the changes in the worm envelope caused by injection of dsRNA SRP54 into mature worms after infection is established;

[0025] Figure 8 A and Figure 8 B is a schematic diagram of the egg count and egg hatching rate detection in the liver of mice after injection of dsRNA SRP54 at the mature worm stage after infection is established;

[0026] Figure 9 Schematic diagram of antibody level detection in mice after injection of dsRNA SRP54 at the mature worm stage after infection is established;

[0027] Figure 10 Schematic diagram of antibody level detection in mice after injection of dsRNA SRP54 at the mature worm stage after infection is established;

[0028] Figure 11HE staining and Masson staining of mouse liver after injection of dsRNA SRP54 at the mature worm stage after infection was established. DETAILED DESCRIPTION

[0029] The following is a clear and complete description of the technical solutions of the present invention in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0030] Example 1. Preparation of double-stranded RNA

[0031] 1. Synthesis of DNA template

[0032] (1) Amplification of target gene SRP54

[0033] Primers were designed for Schistosoma japonicum SjSRP54 (FN326745.1) (the nucleotide sequence of which is shown in SEQ ID NO: 3), and amplification was performed using upstream and downstream primers containing a T7 promoter sequence (5'-TAATACGACTCACTATAGGGAGA-3').

[0034] Upstream primer F: TAATACGACTCACTATAGGGAGAATTCAGTCTGCCGTATTCA (SEQ ID NO: 4)

[0035] Downstream primer R:TAATACGACTCACTATAGGGAGACATGTTCACCAGTTCCAATA (SEQ ID NO: 5)

[0036] PCR amplification program: the reaction program is 94 ° C pre-denaturation for 5 minutes; 94 ° C denaturation for 30 seconds, 55 ° C annealing for 30 seconds, 72 ° C extension for 40 seconds, 37 cycles; 72 ° C final extension for 10 minutes; 16 ° C temporary storage.

[0037] Gel excision and recovery: Cut the gel block containing a single target DNA band into a 1.5 mL centrifuge tube, add 500 μL of sol solution, and place in a 55°C water bath until the gel block is completely dissolved. Place it in a DNA recovery column, let it stand for 2 minutes, centrifuge at 12,000 r / min for 1 minute, and discard the waste liquid; add 600 μL of rinse solution to the recovery column, centrifuge at 12,000 r / min for 1 minute, and discard the waste liquid. Repeat the operation twice; centrifuge at 12,000 r / min for 2 minutes without a column, discard the waste liquid, and dry at room temperature for 5 minutes; add double-distilled water preheated at 65°C to the recovery column, let it stand for 10 minutes, centrifuge at 12,000 r / min for 2 minutes, collect the DNA solution and save it for later use.

[0038] The nucleotide sequence of the amplified fragment of the SRP54 gene is shown in SEQ ID NO:6.

[0039] (2) Amplification of the control gene GFP

[0040] Primers were designed based on the sequence of the GFP (Green fluorescent protein) vector plasmid constructed in the laboratory. The primer sequences (5'-3') are as follows:

[0041] Upstream primer F: TAATACGACTCACTATAGGGAGAAGTCAGTGGAGAGGGTGAAG (SEQ ID NO: 7)

[0042] Downstream primer R: TAATACGACTCACTATAGGGAGAACTAGTTCTACGGATCCATC (SEQ ID NO: 8)

[0043] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 40 s, 37 cycles; final extension at 72°C for 10 min; and temporary storage at 16°C.

[0044] Gel excision and recovery: Cut the gel block containing a single target DNA band into a 1.5 mL centrifuge tube, add 500 μL of sol solution, and place in a 55°C water bath until the gel block is completely dissolved. Place it in a DNA recovery column, let it stand for 2 minutes, centrifuge at 12,000 r / min for 1 minute, and discard the waste liquid; add 600 μL of rinse solution to the recovery column, centrifuge at 12,000 r / min for 1 minute, and discard the waste liquid. Repeat the operation twice; centrifuge at 12,000 r / min for 2 minutes without a column, discard the waste liquid, and dry at room temperature for 5 minutes; add double-distilled water preheated at 65°C to the recovery column, let it stand for 10 minutes, centrifuge at 12,000 r / min for 2 minutes, collect the DNA solution and save it for later use.

[0045] The nucleotide sequence of the amplified fragment of the GFP gene is shown in SEQ ID NO:9.

[0046] 2. Synthesis of double-stranded RNA

[0047] The reaction system for dsRNA synthesis is shown in the table below:

[0048] Ingredient Addition T7 reaction buffer 2 μL T7 enzyme mix 2 μL ATP solution 2 μL UTP solution 2 μL GTP solution 2 μL CTP solution 2 μL DNA template 200 ng DEPC-treated water q.s. to 20 μL

[0049] Two sets of dsRNA synthesis systems were prepared using the two DNA templates mentioned above, respectively, and the mixtures were mixed and incubated at 37°C overnight.

[0050] 3. Purification of double-stranded RNA

[0051] 1) Place the overnight product in a 75°C water bath for 5 minutes to terminate the reaction;

[0052] 2) Add 1 μL of TURBO DNase, mix thoroughly, and incubate at 37°C in a water bath for 15 minutes to remove the DNA template.

[0053] 3) Add 115 μL Nuclease-free water and 15 μL Ammonium Acetate Stop Solution and vortex to mix.

[0054] 4) Add 150 μL of pre-chilled isopropanol, shake to mix, and precipitate at -20°C for at least 1 hour;

[0055] 5) Centrifuge at 13,000 rpm and 4°C for 15 min. During this process, transparent crystals may be observed to precipitate.

[0056] 6) Discard the supernatant, add 700 μL of 75% ethanol prepared with DEPC water to wash the precipitate, and centrifuge at 13,000 rpm and 4°C for 5 min;

[0057] 7) Discard any remaining ethanol and leave the container uncovered at room temperature for 15 minutes to allow the ethanol to evaporate.

[0058] 8) Dissolve the precipitate in 40 μL of nuclease-free water, shake and mix thoroughly, and denature in a 65°C water bath for 15 min.

[0059] 9) Detect dsRNA concentration using NanoDrop2000;

[0060] 10) Use agarose gel electrophoresis to check whether the size of the synthesized fragment is consistent with the target gene. The loading volume is 0.2 μL of synthesized product + 1 μL of 10x loading buffer + 8.8 μL of DEPC water;

[0061] 11) After testing, the two synthesized dsRNAs were named dsRNA SRP54 and dsRNA GFP and stored at -80°C for future use.

[0062] 12) The nucleotide sequence of the sense strand of the synthesized dsRNA SRP54 is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 2.

[0063] 13) The nucleotide sequence of the sense strand of the synthesized dsRNA GFP is shown in SEQ ID NO: 10, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 11.

[0064] Example 2: In vivo interference experiment of double-stranded RNA

[0065] 1. In vivo interference of double-stranded RNA during the early stages of Schistosoma japonicum infection

[0066] Mice infected with 60 cercariae of Schistosoma japonicum were randomly divided into groups of 4 mice each. 20 μg / mice of dsRNA SRP54 (diluted with saline) of the target gene were injected through the tail vein on the 1st, 6th, 10th, 14th, 18th, 22nd, and 26th day after infection, for a total of 7 injections. The control group was injected with an equal amount of dsRNA GFP of the irrelevant interference fragment GFP (Green Fluorescent Protein). On the 30th day after infection, the worms were harvested by perfusion and the number of worms was counted (as shown in Figure 2). Figure 1 ).

[0067] 2. In vivo interference of double-stranded RNA during the developmental stage of the parasite after infection

[0068] Mice infected with 60 cercariae of Schistosoma japonicum were randomly divided into four groups. On days 18, 22, and 26 after infection, mice were injected with 20 μg / mice of the target gene dsRNA SRP54 (diluted with saline) via the tail vein for a total of four injections. A control group was injected with an equal amount of dsRNA GFP, an irrelevant interfering fragment. On day 30 after infection, parasites were harvested by perfusion and the number of parasites was counted (see Table 1). Figure 3 ).

[0069] 3. In vivo interference of double-stranded RNA in mature parasites after infection is established

[0070] Mice infected with 40 cercariae of Schistosoma japonicum were randomly divided into four groups. On days 26, 30, 34, and 38 after infection, mice were injected with 20 μg / mice of the target gene dsRNA SRP54 via the tail vein for a total of four injections. A control group was injected with an equal amount of dsRNA GFP, an irrelevant interfering fragment. On day 42 after infection, parasites were harvested by perfusion and the number of parasites was counted (see Table 1). Figure 5 ).

[0071] 4. In vivo interference effect of double-stranded RNA

[0072] (1) Evaluation of treatment effect

[0073] 1) Evaluation of insect recovery rate and insect growth and development

[0074] Place the perfused Schistosoma japonicum in a cell culture dish, add DMEM solution containing 0.25% ethyl 3-aminobenzoate and 10% FBS; place the dish on a shaker and gently shake for about 2 hours to completely separate the male and female worms, then add AFA solution to fix the worms overnight. Figure 2 A, Figure 4 A, Figure 6 A: Place the fixed insect body on a slide with a ruler, take pictures under a stereoscope, and count the number of male and female insects. Figure 2 B, Figure 4 B, Figure 6 B: The body length of the insect was measured and converted using ImageJ software.

[0075] 2) Detection of the number of eggs laid by insects and the hatching rate of insects

[0076] Four mice were infected with 40 cercariae from each experimental group. The day of infection was designated as day 0, and mouse survival was recorded. On days 26, 30, 34, and 38 after infection, mice were injected with 20 μg / mouse of the target gene, dsRNA SRP54, through the tail vein. Liver samples were harvested on day 42, and the number of worm eggs and hatching rate in the livers were measured.

[0077] Among them, the number of eggs (such as Figure 8 A) Statistics:

[0078] ① The liver of mice infected with Schistosoma japonicum (42 dpi) was cut into pieces and placed in 1.2% saline;

[0079] ② Place the liver fragments in a tissue homogenizer and crush them at 8000 rpm / min for 3-5 times, each time for 45-60 seconds, with an interval of 2-3 minutes;

[0080] ③ Filter the liver tissue homogenate through 80-mesh and 200-mesh sieves respectively, and collect the filtrate;

[0081] ④ Centrifuge the filtrate in a 50 mL centrifuge tube and remove the supernatant. The golden substance at the bottom of the centrifuge tube is the desired eggs.

[0082] ⑤ Gently scrape off the upper red liver residue, then re-add physiological saline, shake and resuspend, and then centrifuge;

[0083] ⑥ Repeat the steps in step ⑤ to remove as much liver debris as possible;

[0084] ⑦ Resuspend the liver egg pellet in normal saline, add Type IV collagenase (200 U / mL), and digest in a 37°C water bath for 1 h;

[0085] 8. The filtered solution of digested eggs was washed with 1.2% NaCl solution for several times to remove the Type IV collagenase, and the residual material on the filter was the desired eggs.

[0086] The hatching rate of eggs was calculated as follows: Figure 8 B) Statistics:

[0087] 1. About 200 eggs were put into a 24-well cell culture plate containing dechlorinated water, and each sample was duplicated. The number of empty eggshells was counted under a dissecting microscope.

[0088] 2. The plate was placed under light for 3 days.

[0089] 3. The number of empty eggshells and total eggs in each well of the plate was recorded on the 3rd day.

[0090] 4. The hatching rate of eggs was calculated as follows: hatching rate (%) = (number of empty eggshells - initial number of empty eggshells / total number of eggs) x 100%.

[0091] 3) Effect on host antibody level and pathological damage

[0092] Four mice in each group were infected with 40 cercariae. The survival time of the mice was recorded on the day of infection (0d). The mice were injected with 20 μg of dsRNA of the target gene via the tail vein on the 26th, 30th, 34th, and 38th day after infection, and the serum and liver of the mice were collected on the 42nd day. The liver was sectioned for pathological examination, as follows:

[0093] 1. The serum collected on the 42nd day after infection was used to detect IgG1, IgG2a, and IgE antibody subclasses (e.g. Figure 9 ) in the serum.

[0094] 2. The serum collected on the 42nd day after infection was used to detect the levels of GM-CSF and IL-5 cytokines (e.g. Figure 10 ) in the serum.

[0095] 3. The liver of the mice infected with Schistosoma japonicum was sectioned for pathological examination (HE staining and Masson staining) (e.g. Figure 11 ).

[0096] (2) Effect of in vivo interference on the early establishment stage of schistosome infection

[0097] The experimental results are shown in Table 1. Figure 2As shown in the results, the recovery rate of schistosomes in the experimental group mice was 56.54% lower than that in the control group mice (P<0.05). The statistical results of the worm length showed that the development of both male and female worms in the experimental group was significantly retarded, with the length of male worms shortened by 60.23% (4.78±0.48mm) and the length of female worms shortened by 48.75% (3.90±0.67mm) compared with the control group (P<0.05).

[0098] (3) In vivo interference effects during the developmental stage of the worm after infection

[0099] The experimental results are as follows Figure 4 As shown in the results, the recovery rate of schistosomes in the experimental group mice was 30.96% lower than that in the control group mice (P<0.05); the statistical results of the worm length data showed that the development of both male and female worms in the experimental group was significantly inhibited, among which the length of male worms was shortened by 27.06% (2.50±0.32mm) and the length of female worms was shortened by 44.37% (4.13±0.54mm) compared with the control group (P<0.05).

[0100] (4) In vivo interference effect at the mature worm stage after infection is established

[0101] The experimental results are as follows Figure 6 As shown in the results, the recovery rate of Schistosoma japonicum in the experimental group mice was reduced by 81.63% compared with the control group mice (P<0.05); the statistical results of the worm length showed that the development of both male and female worms in the experimental group was significantly inhibited, with the length of male worms shortened by 10.24% (1.43±0.18mm) and the length of female worms shortened by 49.71% (8.60±0.65mm) compared with the control group (P<0.05). Figure 6 As shown, the capsule of Schistosoma japonicum obtained from the experimental group mice showed obvious damage, while the capsule of the worms obtained from the control group was intact.

[0102] (5) Effects on insect egg production and egg vitality

[0103] The experimental results are as follows Figure 8 As shown in the results, liver egg counts in mice showed that the experimental group had 19,032 ± 2,577 eggs per gram of liver, while the control group had 79,220 ± 7,255 eggs, a 75.98% reduction (P < 0.05). The egg hatching rate in the control group was 36.82%, while that in the experimental group was 25.64% (P < 0.05), indicating that dsSRP54 injection inhibited Schistosoma japonicum egg production and affected the normal egg viability.

[0104] (6) Effects on host antibody levels and pathological damage

[0105] The experimental results are as follows Figure 9and Figure 10 As shown in the results, ELISA assays showed that at 42 days post-inoculation (dpi), IgG1 and IgG2a antibody levels in the experimental group were significantly higher than those in the control group (P<0.05), but there was no significant difference in IgE (P>0.05). Cytokines associated with eosinophil activation, such as IL-5 and GM-CSF, were significantly elevated (P<0.05), indicating that the host's clearance of parasites was significantly enhanced. HE staining revealed that the livers of the experimental group had less inflammatory cell infiltration and smaller granulomas caused by parasite eggs. Masson staining revealed that liver fibrosis surrounding the parasite eggs in the experimental group was less severe, significantly reducing pathological damage to the host.

[0106] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A double-stranded RNA for killing schistosoma japonicum, characterized in that: The nucleotide sequence of the sense strand of the double-stranded RNA is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand of the double-stranded RNA is shown in SEQ ID NO:

2.

2. Use of the double-stranded RNA according to claim 1 in the preparation of anti-schistosomal drugs.

3. The use according to claim 2, characterized in that: The schistosoma is Schistosoma japonicum.

4. The use according to claim 3, characterized in that: The double-stranded RNA is used to inhibit the early stage of Schistosoma japonicum infection in vivo, and the infection establishment stage is 1-30 days after infection.

5. The use according to claim 3, characterized in that: The double-stranded RNA is used in vivo to inhibit the developmental stage of Schistosoma japonicum after infection is established, and the developmental stage is 18-30 days after infection.

6. The use according to claim 3, characterized in that: The double-stranded RNA is used to inhibit the mature worm stage of Schistosoma japonicum in vivo after infection is established, and the mature worm stage is 26-42 days after infection.

7. The use according to claim 3, characterized in that: The double-stranded RNA is used in inhibiting the egg laying and egg vitality of Schistosoma japonicum in vivo.

8. The use according to claim 3, characterized in that: The double-stranded RNA is used in vivo to reduce the pathological damage of Schistosoma japonicum to the host liver.

9. The use according to claim 2, characterized in that: The dosage form of the medicine is injection, oral preparation, spray or suspension, and the oral preparation is buccal tablet, capsule, pill or granule.

10. The use according to claim 2, characterized in that: The drug further comprises one or more pharmaceutically acceptable carriers, diluents or excipients.

Images