Application of Nilaparvata lugens PHD gene or encoded protein as target in preparation of drug for controlling Nilaparvata lugens
By using the RNA interference technology of the PHD gene of brown planthopper, dsRNA drugs were prepared and microinjected into the insect body, the problem of chemical prevention and control of environmental pollution was solved and the efficient biological control effect on brown planthoppers was achieved.
Patent Information
- Application Number
- CN202211037697.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-25
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2042-08-25
AI Technical Summary
The existing technology is difficult to effectively prevent and control brown planthoppers. Chemical control methods have serious environmental pollution and are not effective, and lack the target genes for biological control.
Using the PHD gene of brown planthoppers as a target, the gene expression level is reduced through RNA interference technology, and dsRNA drugs are prepared to interfere with its development and reproduction. DsRNA is injected into the insect body by microinjection to achieve the RNAi effect.
Significantly inhibit the reproduction and growth of brown planthoppers, reduce egg laying and hatching rates, achieve effective prevention and control of pests, and reduce environmental pollution.
Smart Images

Figure CN115927353B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to the application of the brown planthopper PHD gene or the encoded protein as a target in the preparation of drugs for controlling the brown planthopper. Background Art
[0002] Plant homeodomain (PHD) proteins are widely present in various eukaryotes and are an important zinc finger transcriptional regulator. They mainly function by participating in various histone modifications, chromatin remodeling, and recognizing certain DNA sequences. In 1993, the PHD domain was first identified in the transcription factors HAT3.1 of Arabidopsis thaliana and the homologous protein Zmhoxla of maize. Through in vitro DNA binding assays, it was found that when the N-terminal PHD domain was removed, HAT3.1 completely lost its ability to bind to DNA, indicating that the PHD domain may play an important role in protein-protein binding or protein-DNA binding. Subsequently, a series of proteins containing the PHD domain were identified in metazoans.
[0003] There are also reports indicating that multiple PHD domains contained in the same protein can perform different functions. For example, plant homeodomain finger protein 1 (PHF1), whose N-terminal PHD domain can recognize histone arginine methylation, while the C-terminal PHD domain only participates in the ubiquitination process (Liu R, Gao J, Yang Y, et al. PHD finger protein 1 (PHF1) is a novel reader for histone H4R3 symmetric dimethylation and coordinates with PRMT5-WDR77 / CRL4B complex to promote tumorigenesis. Nucleic Acids Res, 2018. 46(13): 6608-6626.). In Drosophila, some proteins containing PHD domains have been confirmed to only participate in the chromosomal structure composition and not in histone modification. The typical PHD domain is a cysteine-rich functional domain, generally composed of 50-80 amino acid residues, and there are also two zinc atoms fixed on the Cys4-His-Cys3 motif to form a topological structure. The conserved PHD fold contains two antiparallel β-strands, and there is also an α-helix at the C-terminal in part. The PHD domain can specifically bind a series of histone modifications, thereby regulating downstream genes. In 2006, the PHD domain was first found to be able to recognize trimethylated lysine histone H3. Since then, a large number of PHD domains have been found to have histone-binding activity.
[0004] The brown planthopper (scientific name: Nilaparvata lugens, English name: brown planthopper) only feeds on the sap of rice plants, causing the plants to wither and die, and it is an important pest in current rice production in China and even Asia. The brown planthopper often shows an intermittent rampant situation, and the insect population surges sharply in outbreak years. At present, there is not enough understanding of the occurrence pattern and disaster-causing mechanism of the brown planthopper outbreak. In order to contain the damage of the brown planthopper to rice crops, chemical control measures are generally adopted at present, but often with little effect. The application of insecticides not only kills the natural enemies of the brown planthopper but also stimulates the reproduction of pests, forming a situation of population resurgence, and at the same time exacerbates environmental pollution and brings risks to the quality and safety of agricultural products. Given that the brown planthopper has become the most serious biological disaster endangering the rice food security and ecological security in China, finding effective pest target genes and reducing the economic losses caused by target pests to rice crops through biological control methods have important scientific significance. The brown planthopper has a systemic RNAi phenomenon, and systemic RNAi can efficiently and long-term silence the expression of host genes. Therefore, the brown planthopper has become a new model insect for studying gene functions using RNAi. Although the PHD gene exists in a variety of insects, its conservation is not high among insects of different orders. Therefore, using this gene to produce transgenic plants is expected to specifically control rice pests such as planthoppers, thus playing an important role in ensuring food security.
[0005] Due to the unclear function of the insect PHD gene, there has been no report on the physiological function of this gene so far. Summary of the Invention
[0006] The present invention provides the application of the brown planthopper PHD gene as a target in the preparation of drugs for controlling the brown planthopper, as well as the dsRNA of the brown planthopper PHD gene and its application in the preparation of drugs for controlling the brown planthopper. This gene can achieve an environmentally friendly green pest control strategy, improve the insect resistance of transgenic rice crops, and provide new gene resources for cultivating new varieties of rice pests-resistant.
[0007] The specific technical solutions of the present invention are as follows:
[0008] The present invention provides the application of the brown planthopper PHD gene or the encoded protein as a target in the preparation of drugs for controlling the brown planthopper.
[0009] The present invention provides the application of the brown planthopper PHD gene or the encoded protein as a target in the preparation of drugs for reducing the egg-laying amount of the brown planthopper.
[0010] The nucleotide sequence of the PHD gene is shown as SEQ ID NO.1; the amino acid sequence of the protein encoded by the PHD gene is shown as SEQ ID NO.2.
[0011] Preferably, the brown planthopper is a 3-5 instar nymph.
[0012] The present invention also provides an application of a compound for reducing the expression level of the PHD gene of the brown planthopper or reducing the activity of the protein encoded by the PHD gene in the preparation of a drug for controlling the brown planthopper.
[0013] The present invention provides a dsRNA of the PHD gene of the brown planthopper, and the dsRNA is composed of two complementary sequences. The nucleotide sequence of the sense strand is as shown in SEQ ID NO.4, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of the sequence shown in SEQ ID NO.4.
[0014] Nucleotide sequences that can still achieve substantially the same inhibitory effect as the sequences shown in the present invention after simple deletions, modifications and other transformations should also fall within the protection scope of the present invention.
[0015] The present invention also provides a coding gene of the dsRNA, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO.3.
[0016] The present invention also provides a drug for controlling the brown planthopper, and its active ingredient is one of the following (1) or (2):
[0017] (1) dsRNA or siRNA for reducing the expression of the PHD gene of the brown planthopper;
[0018] (2) A coding gene for encoding the dsRNA in (1).
[0019] The present invention also provides a method for controlling the brown planthopper, using the said drug.
[0020] The said brown planthopper is a nymph at the 3rd - 5th instar stage.
[0021] Whether interfering with low - instar (3rd instar) nymphs or high - instar (5th instar) nymphs, the survival rate is less than 7% on the 10th day after interference.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] (1) The present invention discovers the role of the PHD gene of the rice pest brown planthopper in controlling the brown planthopper. Since the brown planthopper has an efficient RNA interference (RNAi) effect, this advantage can be utilized to interfere with the expression of the PHD gene in the insect body of the brown planthopper. By obtaining the dsRNA of the PHD gene and using the RNAi technology to reduce the transcription level of the PHD gene through microinjection, it can effectively inhibit the individual development of the brown planthopper, reduce the egg - laying amount and hatching rate, achieve the ability to inhibit the growth, development and reproduction of pests, thereby inhibiting the reproduction of the brown planthopper and realizing the control of the brown planthopper.
[0024] (2) When studying the function of the PHD gene of the present invention, it was found that when using RNAi technology to interfere with the expression of this gene in the 3rd to 5th instar nymphs of the brown planthopper, an obvious lethal effect was produced. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 It is the PCR identification diagram of the PHD gene fragment of the present invention.
[0026] Figure 2 It is the identification diagram of the double-stranded dsPHD synthesized by the present invention.
[0027] Figure 3 It is the mortality rate diagram of the 3rd to 5th instar nymphs interfering with the PHD gene of the present invention.
[0028] Figure 4 It is the death phenotype of the 4th to 5th instar nymphs and adults interfering with the PHD gene of the present invention.
[0029] Figure 5 It is the oviposition situation diagram of the newly emerged female adults interfering with the PHD gene of the present invention; ** indicates p < 0.01, * indicates p < 0.05.
[0030] Figure 6 It is the formation situation diagram of the eggs interfering with the PHD gene of the present invention in rice. DETAILED DESCRIPTION OF THE INVENTION
[0031] Example 1
[0032] The PHD gene of the rice pest brown planthopper.
[0033] Step 1: Extraction of total RNA from the brown planthopper and cloning of the PHD gene
[0034] After collecting the adult brown planthoppers (100 mg), place them in a 1.5 mL grinding tube containing grinding beads. Add 1 mL of RNAiso Plus reagent in a fume hood. After balancing in a grinder, use the settings of 60 Hz and 40 s and repeat grinding 3 times to ensure that the sample is fully ground. Place the ground sample in a centrifuge at 4°C and centrifuge at 12,000 rpm for 5 min. Transfer the supernatant to a new 1.5 mL RNase-free centrifuge tube in a fume hood. Add 200 μL of chloroform and shake vigorously until the liquid in the centrifuge tube turns light pink. Let it stand at room temperature for 5 min. Centrifuge at 12,000 rpm at 4°C for 15 min. Transfer the supernatant to a new 1.5 mL RNase-free centrifuge tube, add 500 μL of isopropanol, invert and mix well, and let it stand at room temperature for 15 min. Centrifuge at 12,000 rpm at 4°C for 10 min and discard the supernatant. Add 1 mL of 75% ethanol (v / v) to wash the precipitate, pipette to resuspend the precipitate and wash thoroughly. Centrifuge at 12,000 rpm at 4°C for 5 min, discard the supernatant and retain the precipitate, and blow-dry the precipitate in a laminar flow hood for 10 - 15 min to make it fully dry. Dissolve the precipitate by adding 20 - 50 μL of RNase-free ddH2O according to the amount of the dried precipitate, incubate in a metal bath at 55°C for 5 min and mix well. Use NanoDrop2000 to detect the quality and concentration of RNA and store it in a -80°C refrigerator.
[0035] Step 2: RNA reverse transcription
[0036] Use a reverse transcription kit II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing). Perform RNA reverse transcription according to the instructions: The required amount of RNA is 1 μg, and calculate the corresponding volume according to the concentration of the sample RNA. Take an RNase-free PCR small tube, add 4 μL of 4×gDNA wiper Mix, and the total volume of RNase-free ddH2O and the template RNA prepared in Step 1 is 16 μL. Gently pipette and mix well, briefly centrifuge, and incubate in a PCR instrument at 42°C for 2 min. Add 4 μL of 5×HiScript II qRT superMix II, gently pipette and mix well, briefly centrifuge, place it in a PCR instrument, incubate at 50°C for 15 min, and incubate at 85°C for 5 s. Transfer the reverse transcription product to a 1.5 mL centrifuge tube, dilute it 10 times with sterilized ddH2O, and store it in a -20°C refrigerator.
[0037] Step 3: Cloning of PHD gene fragment
[0038] First, synthesize the following specific PCR primers containing the T7 promoter sequence:
[0039] Forward:
[0040] TAATACGACTCACTATAGGGAGA CAATGAGGTCAGCATCCAA;
[0041] Reverse:
[0042] TAATACGACTCACTATAGGGAGA TTCAACGGAAGCAGTCTG;
[0043] The underlined sequence is the T7 promoter sequence.
[0044] The PCR reaction system is shown in Table 1.
[0045] Table 1 PCR reaction system
[0046] Reagent Volume cDNA 1 μL PCR Forward Primer(10 μM) 1 μL PCR Reverse Primer(10 μM) 1 μL Green Taq Mix 25 μL <![CDATA[ddH2O]]> 22 μL
[0047] PCR reaction parameters: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; incubation at 72°C for 10 min. The PCR products were confirmed by agarose gel electrophoresis, and the corresponding fragments were recovered using a DNA gel extraction kit. Then, the target gene obtained from the gel extraction was cloned into the pMD19-T vector using a TA cloning kit.
[0048] Step 4: Transformation of Escherichia coli
[0049] Take out the TG1 competent cells and thaw them on ice; add the recombinant pMD19-T vector ligation product to the thawed TG1 competent cells, gently shake well, and place it on ice for 15 - 30 min; incubate in a 42°C metal bath for 90 s, and immediately place it on ice for 3 - 5 min; add 1 mL of antibiotic-free LB liquid medium in a laminar flow hood, incubate at 37°C with shaking for about 1 h; centrifuge at 5000 rpm for 2 min, aspirate 4 / 5 of the supernatant, mix the remaining liquid, and spread it on an LB screening medium containing AMP, and incubate it upside down at 37°C overnight (about 10 h). Pick a single colony into 1 mL of LB liquid medium containing AMP resistance and culture it in a shaker at 37°C and 220 rpm for 3 h. Aspirate 500 μL of the bacterial solution and send it to a biological company for sequencing (ABI3730XL automatic sequencer; Zhejiang Shangya Biotechnology Co., Ltd.) to obtain the target PHD gene fragment (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2). The extracted plasmid was named pMD-PHD.
[0050] Example 2
[0051] 1. Synthesis of dsRNA
[0052] Use the following specific primers containing the T7 promoter sequence:
[0053] Forward:
[0054] TAATACGACTCACTATAGGGAGA CAATGAGGTCAGCATCCAA;
[0055] Reverse:
[0056] TAATACGACTCACTATAGGGAGA TTCAACGGAAGCAGTCTG;
[0057] The underlined sequence is the T7 promoter sequence.
[0058] The dsGFP primer sequences are as follows
[0059] dsGFP-F:
[0060] taatacgactcactatagggAGAATGAGTAAAGGAGAAGAACTTTTC;
[0061] dsGFP-R:
[0062] taatacgactcactatagggAGATTTGTATAGTTCATCCATGCCATGT.
[0063] Using the recombinant plasmid pMD-PHD extracted in Example 1 as a template, a 529-bp high-concentration DNA fragment was amplified by PCR with the above primers (as shown in Figure 1 , and the nucleotide sequence is as shown in SEQ ID NO.3). Using this as a template, dsPHD was synthesized (as shown in Figure 2 , the nucleotide sequence of the sense strand is as shown in SEQ ID NO.4, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of the sequence shown in SEQ ID NO.4). The template for dsGFP synthesis is a known sequence.
[0064] Prepare a double-stranded RNA synthesis reaction system:
[0065] 2 μL each of ATP solution, UTP solution, CTP solution, and GTP solution, 2 μL of 10×Reaction buffer, 2 μL of T7 RNAPolimerase mix, and 8 μL of DNA template. Mix the reaction system well and place it in a 37°C incubator for about 16 h. Add 1 μL of DNase I and incubate in a 37°C metal bath for 15 minutes to remove the DNA template. Take 1 μL of the dsRNA product, detect the quality of dsRNA by agarose gel electrophoresis, and store it at -80°C.
[0066] 2. dsRNA Microinjection
[0067] Preparation of microinjection needles. A 0.6 mm diameter capillary glass tube was made into a microinjection needle using a microelectrode puller (P-97 Micropipette Puller). The puller program was set as follows: Heat = 750, Pull = 300, Velocity = 150, Time = 150. dsRNA microinjection. The brown planthoppers were anesthetized with CO2 for 15 - 30 s, and then picked up with a brush and placed on a pre-cooled shallow groove of 2% agarose gel (m / v) with their ventral side up. The synthesized dsRNA was added to the microinjection needle, and the needle was fixed on the moving robotic arm. According to the instar of the brown planthopper, it was pinched into a suitable size with dissecting forceps. The parameters of the microinjector (FemtoJet 4×) were set as follows: injection pressure 950 pah, injection time 0.1 s, compensation pressure 10 pah. The robotic arm was manipulated to inject dsRNA into the insect body through the soft part between the second and third pairs of leg bases on the thorax of the brown planthopper. The injected brown planthoppers were placed in a transparent jar with fresh rice seedlings, sealed with a gauze net, and cultured and observed in an artificial climate chamber.
[0068] 3. Effects of RNAi on the growth and development of brown planthoppers
[0069] Third, fourth, and fifth instar nymphs reared on rice seedlings were selected, and about 100 ng of dsPHD was injected into each. After injection, they were placed on rice seedlings and observed for 24 hours, and then transferred to new rice seedlings to observe the growth and development of brown planthoppers and count the mortality rate. The results are shown in Figure 3 and 4 As shown, for the 3rd instar nymphs with dsPHD interference, the survival rate on the third day after interference was 95%, and on the tenth day it was 2%. The survival rate of the 4th instar nymphs also decreased from 91% on the fourth day to 3% on the tenth day. The survival rate of the 5th instar nymphs was 86% on the second day after interference and only 6% on the tenth day. As a control group, the survival rate of the 3rd and 4th instar nymphs treated with dsGFP was greater than 90% on the tenth day; the survival rate of the 5th instar nymphs on the tenth day was also not less than 80%. It shows that there is a highly significant difference in the survival rate between the brown planthoppers injected with dsPHD and dsGFP.
[0070] 4. Effects of RNAi on the reproduction of brown planthoppers
[0071] Female adults within 2 h after initial eclosion were selected, and about 100 ng of dsPHD was injected into each. After injection, they were placed on rice seedlings. Three days later, male and female insects were allowed to mate for 3 days. Then, the male and female adults were removed from the rice seedlings, and the hatching of nymphs on the rice seedlings was observed and the hatching rate was counted.
[0072] The results are shown in Figure 5 and 6As shown, the female adults in the dsGFP control group laid an average of 53 eggs within three days, while the female adults in the dsPHD interference group laid less than 30 eggs. By counting the hatching rate of the eggs laid by female adults, it was found that the average hatching rate of the eggs produced by the dsGFP control group reached 95%, while the hatching rate of the eggs produced by the dsPHD interference group was 0%. This indicates that there are extremely significant differences in the egg-laying rate and hatching rate between the female brown planthoppers injected with dsPHD and dsGFP. Among the eggs laid by the female adults in the dsPHD treatment group, about 8% of the eggs had normal eye spots, about 48% of the eggs had no eye spots, and the remaining about 44% of the eggs had inverted eye spots. Among the unhatched eggs in the dsGFP control group, about 2% of the eggs had normal eye spots, about 2% of the eggs had no eye spots, and the percentage of eggs with inverted eye spots was 0%.
[0073] Whether the young nymphs (3rd instar) or the old nymphs (5th instar) were interfered, less than 7% of the brown planthoppers could survive after ten days. In addition, interfering with the expression of the PHD gene in newly emerged female adults significantly reduced the egg-laying amount and hatching rate after they mated with normal untreated male adults. The results show that the PHD gene plays an important role in the growth, development and reproduction of brown planthoppers. Therefore, the PHD gene can be applied to the field of rice crop breeding, which is of great significance for screening and cultivating rice varieties resistant to brown planthoppers. By cultivating transgenic rice lines that can express double-stranded RNA of the PHD gene of brown planthoppers, RNAi effects can be produced when brown planthopper nymphs and adults feed on rice, so as to achieve the goal of inhibiting the development, mutation and egg-laying of brown planthoppers.
Claims
1. Use of dsRNA for reducing the gene expression level or reducing the activity of the protein encoded by the gene in the preparation of a drug for reducing the egg-laying amount of the brown planthopper; PHD in reducing the gene expression level or reducing PHD the activity of the protein encoded by the gene in the preparation of a drug for reducing the egg-laying amount of the brown planthopper; The said PHD The nucleotide sequence of the gene is shown in SEQ ID NO.1; PHD The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2; The dsRNA consists of two complementary sequences. The nucleotide sequence of the sense strand is as shown in SEQ ID NO.4, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of the sequence shown in SEQ ID NO.4; The brown planthopper is a newly emerged female adult within 2 hours.
2. The application according to claim 1, characterized in that, The nucleotide sequence of the coding gene of the dsRNA is as shown in SEQ ID NO.
3.
3. An application of dsRNA for reducing the gene expression level or reducing the activity of the protein encoded by the gene in the preparation of a drug for controlling the brown planthopper PHD in the preparation of a drug for controlling the brown planthopper PHD in the preparation of a drug for controlling the brown planthopper; The said PHD The nucleotide sequence of the gene is shown in SEQ ID NO.1; PHD The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2; The dsRNA consists of two complementary sequences. The nucleotide sequence of the sense strand is as shown in SEQ ID NO.4, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of the sequence shown in SEQ ID NO.4; The brown planthopper is a nymph at the 3rd to 5th instar stage.
4. The application according to claim 3, wherein The nucleotide sequence of the coding gene of the dsRNA is as shown in SEQ ID NO.
3.
5. A method for controlling brown planthopper, characterized in that, Use a drug for controlling brown planthoppers, and its active ingredient is one of the following (1) or (2): (1)dsRNA for reducing the gene expression of Nilaparvata lugens PHD ; The dsRNA consists of two complementary sequences. The nucleotide sequence of the sense strand is as shown in SEQ ID NO.4, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of the sequence shown in SEQ ID NO.4; (2) The coding gene for encoding the dsRNA in (1), and the nucleotide sequence of the coding gene of the dsRNA is as shown in SEQ ID NO.3; The brown planthopper is a nymph at the 3rd to 5th instar stage or a newly emerged female adult within 2 hours.