Application of Cotton Gene GthICE2 in Plant Drought and Cold Stress Tolerance
By overexpressing the cotton gene GthICE2 in plants, the problem of insufficient tolerance to abiotic stresses such as cold and drought is solved, and the effect of significantly improving plant tolerance is achieved.
Patent Information
- Application Number
- CN202210626875.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-06
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2042-06-06
AI Technical Summary
The prior art is difficult to effectively improve the tolerance of plants to abiotic stresses such as cold and drought.
By overexpressing the cotton gene GthICE2 in plants, the GthICE2 gene was introduced into Arabidopsis by using transgenic technology to improve the tolerance of plants to cold and drought.
The tolerance of plants to cold and drought stresses was significantly improved, including increased germination rate and root length during seed germination period, as well as protection of leaf size and morphology after stress.
Smart Images

Figure CN115927362B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of genetic engineering, in particular to the application of cotton gene GthICE2 in plant drought resistance and cold stress. Background Art
[0002] Abiotic stresses, such as low temperature, high temperature, drought, salinity, etc., can affect the normal growth and development of plants and crop yields. Among them, low temperature and drought are key factors affecting plant growth and development, growth cycle and geographical distribution in nature. Abiotic stresses can inhibit plant growth and development, causing varying degrees of damage to plants and even leading to plant death. However, plants are not completely at their mercy. In the long-term evolutionary process of nature, plants have developed complex physiological, biochemical and stress response mechanisms to enhance tolerance to various abiotic and biotic stress factors. Activating the expression of induced genes is considered to be one of the mechanisms used by plants to enhance their adaptability to abiotic stress. Under abiotic stress, ABA in plants is rapidly synthesized, resulting in an increase in plant water content, stomata closure, rapid expression of induced stress genes, and improved plant tolerance to abiotic stress.
[0003] ICE (Inducer of CBF expression) is a cold-induced gene in plants. It is inactive under normal temperature and activated under low temperature stress. The gene is located upstream of the cold response signal regulation pathway of the ICE-CBF-COR transcription cascade. When plants are subjected to low temperature stress, the gene can specifically bind to the promoter of CBF, induce CBF transcription and translation, increase CBF expression, and upregulate the expression of the downstream key cold resistance gene COR, thereby regulating the cold tolerance of plants. After the protein encoded by ICE is synthesized at low temperature, it can cause a series of physiological and biochemical reactions in cells, enhancing the adaptability of plants to low temperature environments. Therefore, the ICE gene plays a vital role in adverse stress. Summary of the invention
[0004] In view of the problems existing in the prior art, the purpose of the present invention is to provide a new application of cotton gene GthICE2 in improving plant tolerance to abiotic stress and to expand the application scope of gene GthICE2.
[0005] The present invention provides an application of GthICE2 in improving abiotic stress tolerance of plants. The gene ID of the cotton gene GthICE2 is EVM0016027.1, and the nucleotide sequence thereof is shown in SEQ ID NO:1.
[0006] SEQ ID NO:1
[0007] ATGGGCGTTTCCTTCCTTAGCTGTGAAACTGAAAAGTCTCTCTTGCTTTCTCTCCCTCCCTCAAGTATCTTCTCTTCGCAGGCAAACAAACATAGCTCAATTTCTTTTCTTATTCCGAGTCTTGGTTATCAGGAAGGGCTGTCAACATTCACATGTTTTGTGCTCATGAGGCCAGGTCTCTTGCTCTCCACCATGAGAGCTCTAGACAACCTTGGATTGGACATACAACAAGCTGTAATCAGCTGTTTTAATGGGTTTGCACTGGATGTTTTCCGAGCTGAGGTGCCCTTCTTTTTTCTCTTCATCTACTTCGTTGATTTCCATTTAAAATCAATTTTAATTTGCACATCTATCCAACAGATTTCAACTAAAATCTGTCTAACAATTTTTGATGAATGCGATTTCTTTCAAAGTCTAGCC。AACTCTAGTGCAAAAAATAAGGCCATATAG。
[0008] Furthermore, the abiotic stress includes but is not limited to cold stress and drought stress.
[0009] Furthermore, the application is to overexpress the cotton gene GthICE2 in plants, thereby improving the tolerance of plants to cold and drought.
[0010] The present invention also discloses a method for improving the cold and drought stress tolerance of plants. By using a plant overexpression vector, the GthICE2 gene of Gossypium thurberi is introduced into the model organism Arabidopsis thaliana to obtain transgenic plants that are more tolerant to drought and cold stress than the model organism.
[0011] Through the analysis of the transcriptome data of Gossypium thurberi under cold stress, the present invention found that the cold-induced gene ICE2 of the bHLH family MYC-type transcription factor has a significantly different expression level and is significantly up-regulated. By overexpressing the cotton gene GthICE2 in plants, it was found that this gene has a significant regulatory effect under cold and drought stress, indicating that this gene is involved in the cold stress response of Gossypium thurberi.
[0012] The advantages and positive effects of the present invention are:
[0013] The present invention discloses the application of the Gossypium thurberi gene GthICE2 in improving the drought and cold stress tolerance of plants. The gene ID of the Gossypium thurberi gene GthICE2 is EVM0016027.1. Through transgenic technology, the present invention obtains a homozygous line of Arabidopsis thaliana overexpressing the GthICE2 gene. After drought and cold treatment, it is found that its tolerance to drought and cold stress is significantly improved, mainly manifested in: (1) The GthICE2 gene can be highly up-regulated under cold and drought stress, and the transcriptional expression of the GthICE2 gene is induced by exogenous ABA. (2) During the seed germination period, compared with the wild type (WT) under drought and cold stress, the germination rate of the transgenic lines (OE-4, OE-7, OE-9) is significantly increased, and the root elongation length is longer. Under ABA stress, the seed vigor of the transgenic lines (OE-4, OE-7, OE-9) is inhibited, while the seed vigor of the wild type is better, indicating that the GthICE gene transgenic lines are more sensitive to ABA. (3) From the phenotypes and leaf size and morphology of the transgenic lines and the wild type after stress, it can be seen that compared with the wild type, the impact of drought and cold stress on the transgenic lines is smaller. (4) Overexpressing the GthICE2 gene can, to a certain extent, reduce the impact of oxidative stress on the plant, reduce the degree of damage to the cell membrane, and enhance the tolerance of the plant to abiotic stress. Therefore, the present invention has important significance in the breeding and research of improving the drought and cold tolerance of cotton and can be applied to the selection of stress-resistant cotton varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 It is a schematic diagram showing the relative expression level of the GthICE2 gene analyzed by qRT-PCR provided in the embodiment of the present invention. Among them, A: The expression level of the GthICE2 gene in different tissues of cotton under normal conditions; B: The expression level of GthICE2 in cotton seedlings under cold stress (4°C); C: The expression level of GthICE2 in cotton seedlings after treatment with 2 μm ABA; D: The expression level of GthICE2 in cotton seedlings after treatment with 15% PEG.
[0015] Figure 2 It shows the acquisition of the GthICE2 transgenic Arabidopsis thaliana provided in the embodiment of the present invention and the detection of the expression level of the GthICE2 gene in the T2 generation. Among them, A: The positive screening process of the GthICE2 transgenic line; B: The expression level of the GthICE2 gene in the T2 generation transgenic line.
[0016] Figure 3Show the seed germination and root development of Arabidopsis thaliana overexpressing GthICE2 provided by the embodiments of the present invention. Among them, A: Seed germination of transgenic lines (OE-4, OE-7, OE-9) and wild type (WT) grown for 7 days under normal conditions and cold stress (4°C); B: Germination rate statistics; C: Cotyledon greening rate statistics; D: After the seedlings germinated for 7 days were transferred to 1 / 2MS, the main root growth was observed after growing for 5 days under normal conditions and cold stress; E: Root elongation.
[0017] Figure 4 Show the sensitivity of Arabidopsis thaliana overexpressing GthICE2 provided by the embodiments of the present invention to ABA during seed germination. Among them, A: Seed germination of transgenic lines (OE-4, OE-7, OE-9) and wild type (WT) grown for 7 days under normal conditions and ABA stress (0.5, 1, 2 μM ABA); B, C: Germination rate statistics; D: After the seedlings germinated for 7 days were transferred to 1 / 2MS, the main root growth was observed after growing for 5 days under normal conditions and ABA stress (0.5, 1, 2 μM); E: Root elongation.
[0018] Figure 5 Show the seed germination and root development of Arabidopsis thaliana overexpressing GthICE2 provided by the embodiments of the present invention under drought stress. Among them, A: Seed germination of transgenic lines (OE-4, OE-7, OE-9) and wild type (WT) grown for 7 days under normal conditions and osmotic stress (100, 200, 300 mM Mannitol); B, D: Germination rate statistics; C: Cotyledon greening rate statistics; E: After the seedlings germinated for 7 days were transferred to 1 / 2MS, the main root growth was observed after growing for 5 days under normal conditions and osmotic stress (100, 200, 300 mM Mannitol); F: Root elongation.
[0019] Figure 6 Show the phenotypes and physiological indexes of GthICE2 transgenic lines and wild type under cold and drought stress conditions provided by the embodiments of the invention. Among them, A: Phenotypes of GthICE2 transgenic lines and wild type; B: Survival rate statistics; C: Expression levels of GthICE2 gene in transgenic and wild type under normal conditions and abiotic stress; D: Ion permeability measurement; E: Relative water content measurement of leaves; F: Water loss rate measurement of detached leaves; G: Comparison of the size and morphology of rosette leaves of GthICE2 transgenic lines and wild type.
[0020] Figure 7Show the determination of biochemical traits of GthICE2 transgenic lines and wild type under cold and drought stress conditions provided by the embodiments of the present invention. Among them, A: DAB staining of rosette leaves; B: Trypan blue staining of rosette leaves; C: Chlorophyll content determination; D: POD activity determination; E: MDA activity determination; F: SOD activity determination. Detailed implementation manners
[0021] Unless otherwise specified, the methods used in the following embodiments are all conventional methods.
[0022] Unless otherwise specified, the materials, reagents, etc. used in the following embodiments can all be obtained from commercial channels.
[0023] Example 1 RNA extraction from cotton tissues and qRT-PCR analysis of target genes
[0024] Determine the tissue expression pattern of the GthICE2 gene:
[0025] Under normal conditions, when the seedlings of Gossypium thurberi grew to the three-leaf and one-heart stage, appropriate samples of roots, stems and leaves of Gossypium thurberi seedlings were taken, and the total RNA of the samples was extracted using the RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit (Tiangen Biotech, Beijing, China). In addition, after cold, ABA and drought stress treatments were carried out on Gossypium thurberi at the three-leaf and one-heart stage, young cotton leaves were taken at 0, 0.5, 3, 6, 12 and 24 h, and the RNA of the samples was extracted.
[0026] The quality and concentration of each RNA sample were determined by agarose gel electrophoresis and spectrophotometer (NanoDrop 2000). The extracted RNA was reverse transcribed into cDNA using the TranScript-All-in-One First-Strand cDNA Synthesis SuperMix reverse transcription kit (Transgen Biotech, Beijing, China). Using the SYBR dye method, with Arabidopsis thaliana Atactin2 (F: TTGTGCTGGATTCTGGTGATGG; R: CCGCTCTGCTGTTGTGGTG) as the internal reference gene, qRT-PCR analysis was carried out through the specific primers of the target gene GthICE2 (F: CTTCGCAGGCAAACAAACATAG; R: ACATCCAGTGCAAACCCATTAA) on the ABI 7500fast platform. Calculate the relative expression level of the target gene by the 2 -ΔΔCt method, and each sample was repeated at least 3 times biologically.
[0027] The relative expression level of the GthICE2 gene is as Figure 1As shown. The results showed that the expression of the GthICE2 gene in the leaf tissues of cotton seedlings was analyzed after cold, ABA, and drought stress treatments. The leaf tissues of cotton seedlings used for expression analysis were sampled at 0, 0.5, 3, 6, 12, and 24 h for testing. This gene was highly expressed in cotton leaves and slightly expressed in roots and stems. This gene was highly up-regulated at 0.5 h under cold stress and reached the peak of expression at 6 h of treatment. Under drought stress, the expression level of the GthICE2 gene in cotton leaf tissues was relatively high at 3 h. Under ABA stress, the expression level of the GthICE2 gene was continuously up-regulated from 0.5 h to 12 h and decreased at 24 h. It indicated that the GthICE2 gene could be highly up-regulated under cold and drought stresses, and the transcriptional expression of the GthICE2 gene was induced by exogenous ABA.
[0028] Example 2 Changes in the Tolerance of Transgenic Plants to Abiotic Stresses
[0029] 2.1 Construction of the Plant Overexpression Vector pBI121-35S:GthICE2
[0030] Gene cloning primers were designed according to the CDS coding region sequence of the GthICE2 gene (F: GCCATGGAGGCCAGTGAATTCATGGGCGTTTCCTTCCTTAGCTGT; R: CAGCTCGAGCTCGATGGATCCCTATATGGCCTTATTTTTTGCACT). Using the cDNA of Gossypium thurberi as a template, the target fragment of the GthICE2 gene was obtained by PCR amplification. The plant overexpression vector pBI121 was digested with the restriction endonucleases BamH I and Sac I, and the vector fragment was recovered. The recovered product was ligated with the yeast bait vector fragment, and the ligation product was transformed into Escherichia coli DH5α competent cells. The recombinant vector pBI121-35S:GthICE2 containing the 35S promoter was obtained and transformed into Agrobacterium tumefaciens LBA4404 competent cells. The bacterial cells were stored at -80 °C for later use. It was indicated that the plant overexpression recombinant vector pBI121-35S:GthICE2 was successfully constructed.
[0031] 2.2 Transformation of Arabidopsis thaliana and Screening of Transgenic Arabidopsis thaliana
[0032] Arabidopsis thaliana was transformed by the floral dip method. The resuspension solution for infection contained MS 2.15 g / L, sucrose 50 g / L, Silweet-77 200 μL / L, AS 200 mmol / mL, and pH 6.0. To improve the transformation efficiency, the infection was carried out once a week for a total of three times. After each infection, it was cultured in the dark for 24 h, and then continued to be cultured at 22 °C with a 16 h light / 8 h dark cycle. The seeds harvested after maturity were the T0 generation. The T0 generation seeds were on the medium containing 50 mg / L Kan +Continue to screen on 1 / 2MS solid medium. Those that can grow normally on the selection medium are positive seedlings. Transplant the positive seedlings and cultivate to harvest T1 generation seeds. Sow the T1 generation seeds on 1 / 2MS selection medium containing 50 mg / L Kan + for positive screening. Identify the single-copy lines of the transgenic lines by counting the ratio of positive seedlings to non-positive seedlings (about 3:1) in the selection medium. Harvest the seeds of the identified positive lines as T2 generation seeds. Sow the T2 generation seeds again on solid selection medium containing 50 mg / L Kan + to germinate, and determine the single-copy positive lines by counting the survival rate. Take T2 generation leaf samples, and detect the quality and expression level of the positive lines by PCR detection and qRT-PCR analysis. As Figure 2 shown, among them, the expression levels of the three transgenic lines OE-4, OE-7, and OE-9 are relatively high, and they are determined to be homozygous lines overexpressing the GthICE2 gene. After the T2 generation grows to maturity, harvest the T3 generation seeds for the next experiment.
[0033] 2.3 Determination of germination rate and root length of Arabidopsis thaliana during germination
[0034] (1) Prepare solid medium: Add 0.5, 1, 2 μM ABA to 1 / 2MS medium to treat Arabidopsis thaliana seeds with ABA. Add 100, 200, 300 mM Mannitol to 1 / 2MS medium to simulate drought environment for drought treatment during Arabidopsis thaliana germination.
[0035] (2) Determination of germination rate: Take T3 generation seeds of transgenic lines (OE-4, OE-7, OE-9) and wild type (WT). First, disinfect with absolute ethanol for 2 minutes, wash 3 times with ddH 2 O, then wash with sodium hypochlorite for 5 minutes, wash 5 times with ddH 2 O, leave the ddH 2 O from the 5th wash, and place at 4°C for vernalization for 2 - 3 days. For cold stress, sow on 1 / 2MS solid medium, treat at 4°C for 8 days, then place in a light incubator and culture at 22°C with 16 h light / 8 h dark for 7 days. For ABA and drought treatments, sow on the above different treated 1 / 2MS solid medium, place in a light incubator, culture at 22°C with 16 h light / 8 h dark for 7 days, then take pictures and count the germination rate.
[0036] (3) Root length measurement: The transgenic lines (OE-4, OE-7, OE-9) and wild type (WT) were sown on 1 / 2 MS solid medium under different treatments. After growing in a light incubator for 7 days, the root lengths were measured. Then they were transferred to the corresponding 1 / 2 MS solid medium under different treatments and grown vertically for 5 days. The root lengths were measured again, and the elongation of the main root was calculated. All experiments were performed with at least three biological replicates.
[0037] The germination rate and root length measurement results of Arabidopsis thaliana during the germination period are as Figure 3 , 4 , and shown in Figure 5. The results showed that during the seed germination period, compared with the wild type (WT) under drought and cold stress, the germination rates of the transgenic lines (OE-4, OE-7, OE-9) were significantly increased, and the root elongation lengths were longer. Under ABA stress, the seed vigor of the transgenic lines (OE-4, OE-7, OE-9) was inhibited, while the seed vigor of the wild type was better.
[0038] 2.4 Response of Arabidopsis thaliana overexpressing GthICE2 to cold and drought stress
[0039] After the transgenic lines (OE-4, OE-7, OE-9) and wild type (WT) sown on 1 / 2 MS solid medium grew in a light incubator for 7 days, when the seedlings grew to 3 - 4 cotyledons, the seedlings were transplanted into nutrient soil. After growing for 4 weeks, the transgenic lines and wild type were subjected to stress treatments. For cold stress, the seedlings were placed at -15 °C for 3 hours, and then transferred to 4 °C for 3 hours. The phenotypes were observed and the chlorophyll content was measured with a SPAD meter. For drought stress, an aqueous solution containing 15% PEG-6000 was used to simulate drought stress, and it was watered once every 4 days for a total of 3 times. The chlorophyll content was measured with a SPAD meter on the 8th day, and the phenotypes were observed on the 12th day.
[0040] The phenotypes of the GthICE2 transgenic lines (OE-4, OE-7, OE-9) and wild type (WT) are as Figure 6 shown in Figures A and B of
[0041] Results showed that before stress application, the growth conditions of the GthICE2 transgenic lines (OE-4, OE-7, OE-9) and the wild type (WT) were good. After stress treatment, the plants were damaged to varying degrees. After cold treatment, most of the wild type (WT) plants withered and died, while the plants of the GthICE2 transgenic lines (OE-4, OE-7, OE-9) only showed water loss and wilting. After drought treatment, most of the leaves of the wild type (WT) turned yellow and died, with severe water loss and deep damage, while the plants of the transgenic lines (OE-4, OE-7, OE-9) could maintain a better state and bolted 12 days after drought treatment. Under drought and cold stresses, the leaves of wild-type Arabidopsis were smaller, with obvious wilting and yellow-brown color, while the leaves of the transgenic line plants were larger. Although there was chlorosis, the degree of damage was lighter. It can be seen that compared with the wild type, the impacts of drought and cold stresses on the transgenic lines were smaller.
[0042] 2.5 Determination of ion permeability, relative leaf water content and excised leaf water loss rate
[0043] The transgenic lines (OE-4, OE-7, OE-9) and the wild type (WT) were grown under normal conditions for 4 weeks, and after 8 days of drought stress and 3 h of cold stress (-15 °C), their physiological characteristics were detected, including ion permeability (Ion Leakage, IL), relative leaf water content (Relative Leaf Water Content, RLWC) and excised leaf water loss rate (Excised Leaf Water Loss, ELWL). All experiments were repeated at least three times biologically.
[0044] (1) Ion permeability: Ten Arabidopsis leaves of basically the same size were incubated in 10 mL of distilled water at room temperature for 12 h, and the initial conductivity (L1) was measured with a Seven Easy conductivity meter. The samples were boiled for 30 min to release ions, and the electrolyte conductivity (L2) was measured after cooling. Calculation formula:
[0045] Ion Leakage (IL) = L1 / L2 × 100%
[0046] (2) Relative leaf water content: Ten Arabidopsis leaves of basically the same size were taken, and the fresh weight (FW) of the samples was immediately weighed. The samples were soaked in distilled water at room temperature for 24 h, the water on the leaf surface was wiped off, and the saturated weight (SW) of the samples was weighed. The samples were dried in an oven at 50 °C for 24 h, and the dry weight (DW) of the samples was weighed. Calculation formula:
[0047] Relative Leaf Water Content (RLWC) = [(FW - DW) / (SW - DW)] × 100%
[0048] (3) Excised Leaf Water Loss (ELWL): Take 10 Arabidopsis leaves of basically the same size, weigh the fresh weight (FW) of the sample, then place the leaves at room temperature for 24 hours, weigh the withered weight (WW) of the sample, put the sample in an oven at 50 °C for 24 hours, and weigh the dry weight (DW) of the sample. Calculation formula:
[0049] Excised Leaf Water Loss(ELWL): (FW - WW) / DW
[0050] The measurement results of IL, RLWC, and ELWL are as Figure 6 shown in Figures D, E, and F of
[0051] The results showed that: Under normal conditions, there were no significant differences in the physiological index measurements between the transgenic lines (OE-4, OE-7, OE-9) and the wild type (WT). However, when stress was applied to each line, the transgenic lines showed a positive effect compared to the wild type. When plants were exposed to adverse stress, the cell membrane would be damaged, leading to an increase in ion permeability. The ion permeability of wild-type Arabidopsis (WT) was significantly higher than that of the transgenic lines, indicating that the cell damage of wild-type Arabidopsis was more severe than that of the transgenic lines after being stressed. Under cold and drought stress, the relative water content of the leaves of the transgenic lines was significantly higher than that of the wild type, while the excised leaf water loss rate was lower than that of the wild type. The above results all indicate that overexpression of the GthICE2 gene can, to a certain extent, reduce the degree of cell membrane damage and enhance the tolerance of plants to abiotic stress.
[0052] 2.6 Determination of MDA, SOD, and POD
[0053] The transgenic lines (OE-4, OE-7, OE-9) and the wild type (WT) were grown under normal conditions for 4 weeks, and after 8 days of drought stress and 3 h of cold stress (-15 °C), their biochemical indexes were measured. The measurement of biochemical indexes was completed using an activity detection kit (Solarbio, Beijing, China), including the determination of the activities of MDA (malondialdehyde), SOD (superoxide dismutase), and POD (peroxidase). The visible spectrophotometry method was adopted in the experiment.
[0054] MDA (malondialdehyde) is a product formed by oxygen free radicals attacking unsaturated fatty acids in lipids. By measuring the content of MDA in tissues, the degree of lipid peroxidation in the body can be reflected, thereby indirectly reflecting the level of cell damage. The absorbances of each sample at 450 nm, 532 nm, and 600 were measured to calculate the content of MDA in each sample tissue. The specific methods and operating steps can be referred to the instruction manual.
[0055] SOD (superoxide dismutase) can catalyze superoxide into H2O2 and O2 through dismutation reaction, thereby removing oxygen free radicals in the body and effectively protecting cells from damage by oxygen free radicals. Superoxide anions can undergo reduction reaction to generate blue substances, and the activity of SOD can be determined by measuring the absorbance of the blue substance at 560nm. Please refer to the instructions for specific methods and operating steps.
[0056] POD (peroxidase) can catalyze various oxidative polymerization reactions involving hydrogen peroxide, such as catalyzing the oxidation reaction of phenolic and amine compounds, and can remove peroxides to maintain a dynamic level of oxygen free radicals in the body. Because POD has characteristic light absorption at 470nm, the absorbance value of each sample at 470nm is recorded to calculate the POD content of each sample. For specific methods and operating steps, please refer to the instructions.
[0057] The results of MDA, SOD and POD determination are as follows Figure 7 The results show that in the control group, there was no significant difference in the activities of MDA, SOD and POD between the transgenic lines (OE-4, OE-7, OE-9) and the wild type (WT). After cold and drought treatment, the activities of POD and SOD in the transgenic lines increased significantly compared with the wild type, and the content of MDA decreased significantly. This indicates that the transgenic lines are less affected by oxidative stress and the cell membrane is less damaged.
[0058] 2.7 DAB and Trypan Blue Staining of Arabidopsis Rosette Leaves
[0059] (1) DAB staining: DAB staining was performed using a DAB staining kit (Jiancheng Bioengineering Institute, Nanjing, China). Reagents A and B were mixed at a volume ratio of 1:19 and shaken to prepare a color working solution. Leaves of transgenic lines (OE-4, OE-7, OE-9) and wild-type (WT) Arabidopsis thaliana from the control and treatment groups were placed in a 5 ml centrifuge tube, and the color working solution was added to cover the leaves. The leaves were incubated in the dark at room temperature for 12 h, and then the color working solution was discarded. Anhydrous ethanol was used for decolorization. The anhydrous ethanol was replaced once every 12 hours, and replaced twice until the background color of the leaves faded.
[0060] (2) Trypan blue staining: First, prepare trypan blue dye solution (20 mL / L lactic acid, 20 mL / L glycerol, 20 g / L phenol, 20 g / L trypan blue). Take the transgenic lines (OE-4, OE-7, OE-9) and wild-type (WT) Arabidopsis leaves from the control group and the treatment group and put them into a 5 ml centrifuge tube, add trypan blue dye solution to cover the leaves, and boil at 100 °C for 2 min. After cooling, use 2.5 g / ml chloral hydrate for decolorization. Replace the chloral hydrate solution every 3 hours, and replace it 3 times until the background color disappears. Use ddH2 O cleaning.
[0061] The DAB and trypan blue staining results are shown in Figures A and B of Figure 7 . The results show that the degree of cell damage can be detected by DAB staining and trypan blue staining. Under normal conditions, there is no significant difference in the staining of the transgenic lines (OE-4, OE-7, OE-9) and the wild type (WT). However, when stress is applied to each line, the wild type Arabidopsis thaliana is darker in color and more severely damaged, while the transgenic lines are lighter in color, indicating that the transgenic lines are less damaged than the wild type Arabidopsis thaliana after cold and drought stress.
[0062] In this invention, homozygous lines of Arabidopsis thaliana overexpressing the GthICE2 gene were obtained through transgenic technology. After drought and cold treatment, it was found that their tolerance to drought and cold stress was significantly improved, mainly manifested in:
[0063] (1) The GthICE2 gene can be highly up-regulated under cold and drought stress, and the transcriptional expression of the GthICE2 gene is induced by exogenous ABA.
[0064] (2) During the seed germination period, compared with the wild type (WT) under drought and cold stress, the germination rates of the transgenic lines (OE-4, OE-7, OE-9) are significantly increased, and the root elongation lengths are longer. Under ABA stress, the seed vigor of the transgenic lines (OE-4, OE-7, OE-9) is inhibited, while the seed vigor of the wild type is better, indicating that the transgenic lines of the GthICE gene are more sensitive to ABA.
[0065] (3) From the phenotypes and leaf size and morphology of the transgenic lines and the wild type after stress, it can be seen that compared with the wild type, the effects of drought and cold stress on the transgenic lines are smaller.
[0066] (4) Overexpressing the GthICE2 gene can, to a certain extent, reduce the impact of oxidative stress on the plant, reduce the degree of damage to the cell membrane, and enhance the plant's tolerance to abiotic stress.
[0067] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principles of the present invention shall be included within the protection scope of the present invention. Sequence Listing <110> Zhengzhou University Cotton Research Institute, Chinese Academy of Agricultural Sciences <120> Application of Cotton Gene GthICE2 in Plant Drought and Cold Stress Tolerance <160> 1 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 450 <212> DNA <213> Cotton (Gossypium spp.) <400> 1 atgggcgttt ccttccttag ctgtgaaact gaaaagtctc tcttgctttc tctccctccc 60 tcaagtatct tctcttcgca ggcaaacaaa catagctcaa tttcttttct tattccgagt 120 cttggttatc aggaagggct gtcaacattc acatgttttg tgctcatgag gccaggtctc 180 ttgctctcca ccatgagagc tctagacaac cttggattgg acatacaaca agctgtaatc 240 agctgtttta atgggtttgc actggatgtt ttccgagctg aggtgccctt cttttttctc 300 ttcatctact tcgttgattt ccatttaaaa tcaattttaa tttgcacatc tatccaacag 360 atttcaacta aaatctgtct aacaattttt gatgaatgcg atttctttca aagtctagcc 420 aactctagtg caaaaaataa ggccatatag 450
Claims
1. Use of cotton gene GthICE2 in improving cold stress tolerance of plants, Characterized in that, The nucleotide sequence of the cotton gene GthICE2 is as shown in SEQ ID NO: 1, and the plant is cotton or Arabidopsis thaliana.
2. Use of the cotton gene GthICE2 according to claim 1 in improving cold stress tolerance of plants, Characterized in that, Overexpressing the cotton gene GthICE2 in the plant to improve the cold stress tolerance of the plant.
3. Use of cotton gene GthICE2 in improving drought tolerance of plants, Characterized in that, The nucleotide sequence of the cotton gene GthICE2 is as shown in SEQ ID NO: 1, and the plant is cotton or Arabidopsis thaliana.
4. Use of the cotton gene GthICE2 according to claim 3 in improving drought tolerance of plants, Characterized in that, Overexpressing the cotton gene GthICE2 in the plant to improve the drought tolerance of the plant.
5. A method for improving cold stress tolerance of plants, Characterized in that, The method includes the step of overexpressing the cotton gene GthICE2 in the plant, wherein the nucleotide sequence of the cotton gene GthICE2 is as shown in SEQ ID NO: 1, and the plant is cotton or Arabidopsis thaliana.
6. The method for improving cold stress tolerance of plants according to claim 5, Characterized in that, Construct an overexpression vector containing the gene of the cotton gene GthICE2 and introduce it into the plant.
7. A method for improving drought tolerance of plants, Characterized in that, The method includes the step of overexpressing the cotton gene GthICE2 in the plant, wherein the nucleotide sequence of the cotton gene GthICE2 is as shown in SEQ ID NO: 1, and the plant is cotton or Arabidopsis thaliana.
8. The method for improving drought tolerance of plants according to claim 7, Characterized in that, Construct an overexpression vector containing the gene of the cotton gene GthICE2 and introduce it into the plant.