Wheat grain size-related gene TaHDA9, its expression vector and application

Abstract

The present application discloses a wheat grain size-related gene <h2 style=";text-align:left;direction:ltr">TaHDA9 The purpose of this paper is to solve the technical problem of the lack of new genes related to wheat grain size and provide more options for wheat high-yield breeding. <h2 style=";text-align:left;direction:ltr"> TaHDA9 , its gene sequence is shown in SEQ ID NO.2; its amino acid sequence is shown in SEQ ID NO.3; a specific primer pair for identifying the gene is provided; a plant expression vector is constructed and a recombinant bacterium is prepared based on the above gene, and the function of the gene in regulating wheat grain size is verified. The isolation and application of wheat grain size-related genes in this application not only helps to reveal the molecular genetic basis for regulating wheat grain size, but also can provide important gene resources for wheat yield breeding.

Description

Technical Field

[0001] The present application relates to the field of plant genetic engineering technology, specifically to a gene related to wheat grain size. TaHDA9 , its expression vector and application. Background Art

[0002] Wheat is one of the most important food crops in my country, providing 50% of human food sources. Increasing wheat production is a demand of the growing world population, and cultivating high-yield and stable wheat is crucial to world food security. Since wheat has a complex genome, it is more difficult to clone genes related to wheat yield. Studies have shown that in wheat breeding programs, increasing any one of the three traits of grain width, grain length and grain thickness can increase the weight of wheat grains. Grain size and weight are important components of crop yield and are also important target traits for current breeding. So far, many QTL loci related to grain size or grain weight have been found in wheat, mainly located on chromosomes 4A, 4B, 5A and 6A. However, due to its large and complex genome, it is difficult to directly isolate genes related to yield based on map-based cloning strategies.

[0003] The research on rice grain size-related genes started early, and the related mechanism of action has been studied more thoroughly, mainly involving the following pathways: ubiquitin-proteasome degradation pathway (DA1, GW2, SAMBA, RPT2 and WTG1, etc.), G protein signaling pathway (GPA1, GS3 and DEP1, etc.), MAPK kinase signaling pathway (SMG2, MKK4 and OsMAPK6, etc.), plant hormones (D11, GS5, qGL3, GW5, TGW3, ARF18 and BG1, etc.), transcriptional regulation-related pathways (GLW7, GW8, GS2 and AP2, etc.), and other regulators (CYP78A13, GL7 and SRS5, etc.).

[0004] At present, wheat researchers mainly obtain wheat grain size-related genes through homologous cloning. For example, the negative regulators of wheat grain width and thousand-grain weight TaGW2 Homologous genes were first extensively studied. As negative regulators of wheat grain size TaDA1 Genes through TaGW2 The interaction affects the weight of wheat grains, and there is an additive genetic effect between the two. Subsequently, the wheat sucrose synthase gene ( TaSus1 ) , cytokinin oxidase gene ( TaCKX ), serine carboxypeptidase gene ( TaGS5 ), genes related to wheat starch synthesis (T aAGP-S1 and TaAGP-L ), protein phosphatase gene (T aGL3), negatively regulating wheat grain width and thousand-grain weight TaGW2 and TaGW7 Genes were also isolated.

[0005] Although these genes have been cloned and their functional characteristics have been partially interpreted, they were mainly cloned from the model crop rice. The discovery of new genes related to wheat grain size has been slow. So far, there are still few reports on the cloning of genes related to wheat grain size. Using new methods to discover and utilize new grain size-related genes, clarify their genetic mechanisms at the molecular level, and explore the regulatory pathways in which they participate will play an important role in increasing wheat yields and ensuring food security.

[0006] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0007] The present application provides a wheat grain size-related gene TaHDA9 , its expression vector and application are intended to solve the technical problem of the lack of new genes related to wheat grain size, so as to provide more options for high-yield wheat breeding.

[0008] According to one aspect of the present disclosure, a wheat grain size-related gene was screened and obtained. TaHDA9 , whose genomic nucleotide sequence is shown in the sequence table SEQ ID NO.1, and its full-length CDS nucleotide sequence is:

[0009] (1) the nucleotide sequence shown in SEQ ID NO.2;

[0010] (2) Nucleotide sequences with equivalent functions derived from the nucleotide sequence defined by SEQ ID NO.2; including sequences with more than 80% homology to the sequence of SEQ ID NO.2 and encoding proteins related to controlling wheat grain size.

[0011] According to another aspect of the present disclosure, a wheat grain size-related gene is provided. TaHDA9 The amino acid sequence of the encoded protein is:

[0012] (1) the amino acid sequence shown in SEQ ID NO.3;

[0013] (2) A translatable fragment or conservative variant obtained by deleting, adding or replacing one or more amino acids based on the amino acid sequence defined in SEQ ID NO.3.

[0014] According to another aspect of the present disclosure, there is provided a method for identifying genes related to wheat grain size.TaHDA9 The full-length primer pair is as follows:

[0015] TaHDA9 -1F:5'- ATGTTGGAGAAAGACAGGAT-3';

[0016] TaHDA9 -1R:5'- TCAATGTCCGCCGTCATCAT-3'.

[0017] According to another aspect of the present disclosure, a method is provided which contains a gene related to wheat grain size. TaHDA9 For example, a recombinant expression vector for wheat grain size-related genes TaHDA9 By restriction endonuclease BamHI and SacI Insert LGY-OE3 to construct an overexpression vector. TaHDA9 The expression vector can be used to transform plant cells or tissues through conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants; the transformed host can be either monocotyledonous plants or dicotyledonous plants.

[0018] According to another aspect of the present disclosure, the wheat grain size-related gene TaHDA9 , the primers or the recombinant expression vector are used in the breeding of wheat grain size varieties / lines. For example, regulating wheat grain length and / or grain weight; overexpressing the wheat grain size-related gene TaHDA9 , in order to increase wheat grain length and / or grain weight.

[0019] According to another aspect of the present disclosure, the wheat grain size-related gene TaHDA9 , the primers or the recombinant expression vector are used to regulate wheat yield and / or grain number per ear.

[0020] One or more technical solutions provided in the embodiments of the present application have at least the following technical effects or advantages:

[0021] 1. A new wheat grain size-related gene was first disclosed and confirmed, named TaHDA9 , the protein it expresses can regulate wheat grain size.

[0022] 2. Identification of genes related to wheat grain size TaHDA9 The genomic nucleotide sequence and encoded protein sequence lay the foundation for the application practice of wheat breeding.

[0023] 3. Use the Agrobacterium-mediated transformation system to transform the TaHDA9The plant expression vector was used to transform wheat embryos, and the expression of TaHDA9 The wheat grain length and grain weight increased significantly, indicating TaHDA9 Genes involved in regulating wheat grain size.

[0024] 4. It helps to reveal the molecular genetic basis of wheat grain size, and plays an important role in using genetic engineering technology to increase wheat yield and quickly and efficiently breed high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 In one embodiment of this application TaHDA9 and TaSRK Yeast two-hybrid interaction results.

[0026] Figure 2 This is the plasmid map of the LGY-OE3-GAI vector in one embodiment of the present application.

[0027] Figure 3 In one embodiment of this application TaHDA9 Relative expression levels in overexpressing transgenic lines (OE1, OE2, and OE3) and the control Fielder.

[0028] Figure 4 This is a phenotypic and statistical comparison of the grain size of the overexpressing transgenic lines (OE1, OE2 and OE3) and the control Fielder in an example of the present application.

[0029] Figure 5 This is a statistical comparison of the agronomic traits of the overexpressing transgenic lines (OE1, OE2 and OE3) and the control Fielder in one embodiment of the present application. DETAILED DESCRIPTION

[0030] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0031] Unless otherwise specified, the instruments and equipment involved in the following examples are all conventional instruments and equipment; the reagents, carriers and other test materials involved are all commercially available conventional products unless otherwise specified; the test methods, detection methods, etc. involved are all conventional methods unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged. Primer synthesis and sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0032] Example 1: Genes related to wheat grain size TaHDA9 Acquisition

[0033] By screening the interacting proteins of known functional genes, other new genes in the metabolic pathway can be isolated and identified, as follows:

[0034] 1. TaSRK Yeast library screening

[0035] The interaction between proteins constitutes a major component of the cell biochemical reaction network and is of great significance for regulating cells and their signals. Screening and identifying interacting proteins in known functional gene pathways can dig out other key genes in the gene pathway, such as some enzyme genes with regulatory effects. In this case, the key gene TaSRK (see CN112226442A) that controls wheat grain length and grain weight was used as bait to construct the pGBKT7-TaSRK recombinant vector, and the cDNA yeast library of the wheat variety dwarf resistance 58 constructed in the laboratory in 2017 was screened for TaSRK interacting proteins. The screening steps were carried out according to the Matchmaker™ Gold Yeast Two-Hybrid System User Manual. The blue spots on the SD / -Leu / -Trp / -His / -Ade / AbA / X-α-Gal four-deficient plate were sequenced, and the sequencing results were subjected to Chinese Spring BLAST and the genes were annotated. A total of 26 sequences were sequenced, and 14 sequences of normal translated proteins were sequenced.

[0036] 2. TaHDA9 Cloning in wheat

[0037] Five candidate genes were cloned and verified by yeast two-hybrid (Y2-H) interaction. One of the candidate genes was annotated as histone deacetylase 9. TaHDA9 ). Since enzymes often have important regulatory functions, they are used as target genes. The gene is cloned and sequenced. The specific steps are as follows:

[0038] ① DNA extraction: The DNA of Dwarf Kang 58 seedlings was extracted using the SLS method.

[0039] ② Total RNA extraction and synthesis of the first chain of cDNA: TRIZOL reagent was used to extract total RNA of Dwarf Anti-58 seedlings. Total RNA that met the quality requirements was taken and the first chain of cDNA was synthesized according to PrimeScript TM The first-chain cDNA was synthesized according to the instructions of RT Reagent Kit (perfect Real time).

[0040] ③ TaHDA9 Gene cloning and sequence analysis: design of PCR primers, TaHDA9 -1F and TaHDA9-1R is designed at both ends of the start codon ATG and the stop codon TAA, respectively, as follows:

[0041] TaHDA9 -1F: 5'- ATTGTTGGAGAAAGACAGGA-3';

[0042] TaHDA9 -1R:5'- TCAATGTCCGCCGTCATCAT-3'.

[0043] Using DNA of dwarf anti-58 as template, TaHDA9 -1F and TaHDA9 -1R primer pair for PCR amplification. PCR reaction solution (50 μl system): 10×PCR Buffer (25 μl), ddH2O (9 μl), dNTP (10 μl), TaHDA9 -1F (1.5 μl), TaHDA9 -1R (1.5μl), DNA (2μl), TaKaRa LA Taq enzyme (1μl); PCR parameters: 94℃ for 4 min; then 94℃ for 30 s, 60℃ for 30 s, 72℃ for 5 min 30 s, for a total of 35 cycles; then 72℃ for 10 min. The PCR product was subjected to 1% agarose gel electrophoresis, recovered and connected to the PMD18-T vector (TAKARA), and sent to Bioengineering for sequencing;

[0044] A similar method was used to use the cDNA of dwarf anti-58 as a template. TaHDA9 -1F and TaHDA9 -1R primer pair for PCR amplification; PCR reaction system and parameters are the same as above. After gel running and recovery, connect to PMD18-T vector (TAKARA) and send to Bioengineering for sequencing;

[0045] The sequencing results showed that the DNA fragment obtained by PCR amplification using the DNA of wheat dwarf resistance 58 as a template was TaHDA9 The genomic level sequence of the gene is shown in the sequence listing SEQ ID NO.1, which is 4560bp in length and contains 14 exons and 13 introns; its CDS nucleotide sequence is shown in SEQ ID NO.2, which is 1293bp in length and encodes an amino acid sequence as shown in the sequence listing SEQID NO.3, with 430 amino acids.

[0046] 3. TaHDA9 Verification of interaction with TaSRK at yeast level

[0047] The specific steps are as follows: TaHDA9The complete CDS was connected to pGADT7 to construct the pGADT7-TaHDA9 recombinant vector; the pGBKT7-TaSRK recombinant vector and the pGBKT7 empty vector were respectively transformed into the Y2H yeast strain for self-activation and toxicity tests; TaHDA9 The recombinant vector and pGADT7 empty vector were respectively transferred into the Y187 yeast strain for self-activation and toxicity detection. After verification of no self-activation activity and toxicity, pGBKT7-TaSRK and pGADT7- TaHDA9 The positive control group (pGBKT7-53 and pGADT7- TaHDA9 ) and negative control groups (pGBKT7-lam and pGADT7- TaHDA9 ), spread them on SD / -Leu / -Trp two-deficiency medium, invert and culture at 28-30℃ for 3-5 days; randomly select colonies in good condition on the two-deficiency medium, resuspend them with 50μL sterile water, and perform bacterial liquid PCR detection; simultaneously transfer 10μL of the positive bacterial liquid to SD / -Leu / -Trp / AbA / X-α-Gal (two-deficiency + A+X), SD / -Leu / -Trp / -His / AbA / X-α-Gal (three-deficiency + A+X), SD / -Leu / -Trp / -His / -Ade / AbA / X-α-Gal (four-deficiency + A+X) medium, invert and culture at 28-30℃ for 3-5 days, and observe the growth of the plate and the color change of the colonies. The results are as follows Figure 1 As shown. Figure 1 It can be seen that pGBKT7-TaSRK (BD-TaSRK) and pGADT7- TaHDA9 (BD- TaHDA9 ) The co-transfected yeast plaques grew and turned blue on SD / -Leu / -Trp / -His / AbA / X-α-Gal (three deficiencies + A+X), and grew and turned blue on SD / -Leu / -Trp / -His / -Ade / AbA / X-α-Gal (four deficiencies + A+X), confirming TaHDA9 It has a strong interaction with TaSRK at the yeast level.

[0048] Embodiment 2: TaHDA9 Acquisition and Identification of Transgenic Wheat

[0049] 1. TaHDA9 Construction of plant overexpression vector

[0050] According to the cloned TaHDA9 Primers were designed based on the full-length cDNA sequence and restriction endonucleases were introduced at both ends of the primers. BamHI and SacIRecognition site and protection base, primer sequence is as follows:

[0051] TaHDA9 -2F:5'- CGGGATCCATGTTGGAGAAAGACAGGAT -3';

[0052] TaHDA9 -2F: 5'- CGGAGCTCTCAATGTCCGCCGTCATCAT -3';

[0053] The expression vector LGY-OE3-GAI was selected, and its vector map is as follows Figure 2 shown.

[0054] The 1293 bp DNA fragment was cloned into the restriction site of the plant expression vector LGY-OE3-GAI. BamHI and SacI Between, get wheat TaHDA9 The recombinant expression vector of the gene was named LGY-OE3-GAI- TaHDA9 .

[0055] 2. TaHDA9 Obtaining genetically modified wheat

[0056] Place LGY-OE3-GAI- TaHDA9 The immature embryo callus of wheat Fielder was transformed by Agrobacterium infection, and transgenic wheat plants were obtained through screening, pre-differentiation and differentiation.

[0057] 3. PCR Identification of Transgenic Wheat

[0058] The T1 transgenic plants were positively identified using the hygromycin tag (Hyg) primers Hyg-F and Hyg-R. The primer sequences are as follows:

[0059] Hyg-F: 5'-TCTGCACCATCGTCAACCAC-3';

[0060] Hyg-R: 5'-AAACCCACGTCATGCCAGTT-3';

[0061] A total of 8 positive transgenic plants were obtained. After additional generations of reproduction, T2 generation homozygous transgenic lines OE#2, OE#3 and OE#4 were obtained.

[0062] Example 3: Expression identification of transgenic wheat

[0063] Fluorescence quantitative analysis was performed on the transgenic lines OE#2, OE#3, OE#4 and Fielder; the extraction of total RNA and the inversion of cDNA were the same as in Example 1.

[0064] against TaHDA9 The specific primers for fluorescence quantitative analysis were designed based on the gene sequence as follows:

[0065] TaHDA9 -3F:5'-TGTGGGGCTGATTCATTGGC-3';

[0066] TaHDA9 -3R: 5'-CCCAACAGCGTGCTACATTC-3'.

[0067] Selection of internal reference genes β -actin (GenBank accession no. AB181991), the primer sequences are as follows:

[0068] β -actin-F:GTTCCAATCTATGAGGGATACACGC;

[0069] β -actin-R:GAACCTCCACTGAGAACAACATTACC.

[0070] Fluorescence quantification was performed using the Bio-Rad IQ5 Real-Time PCR Detection System (USA). A 20 μL reaction system contained 0.4 μL of each upstream and downstream primer, 10 μL of Go Taq® qPCR Master Mix (Perfect Real Time; Promega), and 7.2 μL of nuclease-free water. PCR program: 95°C for 3 min, 95°C for 5 s, 60°C for 30 s, 72°C for 30 s, and 40 cycles. TaHDA9 -3F and TaHDA9 -3R primer, with Fielder as control, using 2 -△△CT Gene detection TaHDA9 The expression level in the leaves of T2 positive transgenic lines was as follows. Figure 3 As shown in the figure, TaHDA9 The expression levels in the leaves of T2 generation positive transgenic lines OE#2, OE#3 and OE#4 were significantly higher than those of the control, which were 54, 58 and 44 times of those of the control, respectively.

[0071] Embodiment 4: TaHDA9 Phenotypic Identification of Transgenic Wheat

[0072] The length and width of 10 seeds of the T2 generation overexpression transgenic lines (OE#2, OE#3 and OE#4) and the control Fielder were photographed and measured, and the 100-seed weight was counted. The results are as follows Figure 4 shown.

[0073] Depend on Figure 4 As shown in A, compared with the control Fielder, the seed length of the overexpressing transgenic lines (OE#2, OE#3 and OE#4) increased, while the seed width did not change significantly.

[0074] Depend on Figure 4 B shows that in terms of grain length, the overexpression transgenic lines (OE#2, OE#3 and OE#4) were significantly longer than the control Fielder.

[0075] like Figure 4 As shown in C, there was no significant difference in grain width between the overexpression transgenic lines (OE#2, OE#3 and OE#4) and the control Fielder.

[0076] like Figure 4 As shown in D, the grain weight of the overexpressing transgenic lines (OE#2, OE#3, and OE#4) was significantly increased compared with the control Fielder.

[0077] The agronomic traits of the T2 generation overexpression transgenic lines (OE#2, OE#3 and OE#4) and the control Fielder were investigated and recorded in the field. Figure 5 shown.

[0078] Depend on Figure 5 As shown in A, compared with the control Fielder, the plant height of the overexpressing transgenic lines (OE#2, OE#3 and OE#4) was significantly reduced.

[0079] Depend on Figure 5 B shows that in terms of ear length, there is no significant difference between the overexpression transgenic lines (OE#2, OE#3 and OE#4) and the control Fielder.

[0080] like Figure 5 As shown in C, there was no significant difference in the number of spikelets between the overexpressing transgenic lines (OE#2, OE#3 and OE#4) and the control Fielder.

[0081] like Figure 5 As shown in D, the number of grains per ear in the overexpressing transgenic lines (OE#2, OE#3, and OE#4) was significantly increased compared with the control Fielder.

[0082] In the review, genes related to wheat grain size TaHDA9It can increase the grain length and weight of wheat. It can be used to study the molecular mechanism of wheat grain size regulation and has important application value in wheat high-yield breeding.

[0083] Although some preferred embodiments of the present application have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present application.

[0084] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the spirit and scope of the invention. Thus, if these modifications and variations fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A wheat grain size-related gene whose nucleotide sequence is shown in SEQ ID NO.1 or whose CDS nucleotide sequence is shown in SEQ ID NO.2 <h2 style=";text-align:left;direction:ltr">TaHDA9 , primers or an overexpression vector containing a DNA fragment as shown in SEQ ID NO.2 in the breeding of wheat grain size varieties / lines, characterized in that: Overexpression of wheat grain size-related genes <h2 style=";text-align:left;direction:ltr"> TaHDA9 , in order to increase the grain length and / or grain weight of wheat; the nucleotide sequence of the primer is: <h2 style=";text-align:left;direction:ltr"> TaHDA9 -1F:5'- ATGTTGGAGAAAGACAGGA-3'; <h2 style=";text-align:left;direction:ltr"> TaHDA9 -1R:5’- TCAATGTCCGCCGTCATCAT-3’。 2. A wheat grain size-related gene whose nucleotide sequence is shown in SEQ ID NO.1 or whose CDS nucleotide sequence is shown in SEQ ID NO.2 <h2 style=";text-align:left;direction:ltr"> TaHDA9 Or use of an overexpression vector containing the DNA fragment as shown in SEQ ID NO.2 in regulating wheat yield and / or ear grain number, characterized in that: Overexpression of wheat grain size-related genes <h2 style=";text-align:left;direction:ltr"> TaHDA9 , to increase wheat grain length, grain weight and / or number of grains per ear.

Images