A soybean GmAP2-a gene and its application

Abstract

The present invention discloses a soybean GmAP2-a gene and its application. The gene is a member of the soybean AP2 subfamily, the nucleotide sequence of the GmAP2-a gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein expressed by it is shown in SEQ ID NO.4. Studies have found that overexpression of the gene in Arabidopsis thaliana can improve the plant's resistance to abiotic stress, while causing abnormal stamen development, and soybean plants knocked out of the gene show male sterility. This feature of the gene has great application value in breeding.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a soybean GmAP2-a gene and an application thereof. Background Art

[0002] Floral organ development is an important process in which plants change from vegetative growth to reproductive growth, and its molecular basis is the participation of many related genes. Using model plants, researchers divided flowers into four whorls from the outside to the inside: sepals, petals, stamens, and pistils, with A having different functions.

[0003] The three types of genes A (AP1-APETALA1 and AP2-APETALA2), B (AP3-APETALA3 and PI-PISTILLATA), and C (AG-AGAMOUS) are controlled and act in two adjacent rounds of organs, which is the famous ABC model of flower development. Male sterility refers to the phenomenon that the stamens develop abnormally and cannot produce functional pollen or male gametes, but the pistils develop normally and can accept normal pollen and fertilize and bear fruit. Male sterility can be used to improve plant quality, provide excellent seed sources, bring material benefits to mankind, and save a lot of manual emasculation. In the process of crop production, the male sterility phenomenon in the development of flower organs has been applied to realize the promotion and application of "cross breeding" and hybrids of various crops. At present, the application of male sterility hybrid breeding technology in crops such as rice and corn is the most successful, and in tobacco, tea oil, corn, petunia and other plants, the related genes of male sterility have been cloned. So far, the genes related to soybean male sterility have not been cloned, and soybean male sterile hybrids have not been applied in actual production. Therefore, it is urgent to solve the problem of soybean male sterile hybrid production. Summary of the invention

[0004] The purpose of the present invention is to provide a soybean GmAP2-a gene and its application. The gene is a member of the soybean AP2 subfamily. The present invention is to explore some functions of the gene and explain its application in breeding.

[0005] In order to achieve the above object, the present invention provides a soybean GmAP2-a gene, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0006] The present invention also provides a protein encoded by the GmAP2-a gene, the amino acid sequence of which is shown in SEQ ID NO.4.

[0007] The present invention also provides an overexpression recombinant vector comprising the soybean GmAP2-a gene.

[0008] The present invention also provides a gene knockout recombinant vector comprising the soybean GmAP2-a gene.

[0009] The present invention also provides a recombinant bacterium comprising the overexpression recombinant vector or the gene knockout recombinant vector.

[0010] Preferably, the empty bacteria of the above-mentioned recombinant bacteria are selected from Agrobacterium tumefaciens.

[0011] The soybean GmAP2-a gene provided by the present invention can be applied to soybean breeding, and in particular can be applied to the preparation of soybean male sterile lines.

[0012] The soybean GmAP2-a gene and its application of the present invention analyze part of the function of the gene for the first time, solve the problems of slow cloning and functional exploration of soybean male sterility-related genes, and have the following advantages:

[0013] The present invention obtains the GmAP2-a gene sequence, analyzes the location of the gene in detail, explores and verifies the stress resistance and other effects of its overexpression, and soybeans with the gene knocked out show male sterility. The gene and its function have great application value in breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the electrophoresis diagram of the cDNA amplification of the GmAP2-a gene in the present invention.

[0015] Figure 2 This is a schematic diagram of the Arabidopsis thaliana overexpression vector of the present invention.

[0016] Figure 3 This is the electrophoresis diagram for PCR amplification identification of the overexpression plasmid constructed in the present invention.

[0017] Figure 4 This is the electrophoresis diagram of PCR amplification for identification of Agrobacterium colonies transformed with the constructed overexpression plasmid in the present invention.

[0018] Figure 5 The results are a comparison of the drought stress resistance of the Arabidopsis wild-type plants and the overexpression plants in the present invention.

[0019] Figure 6 The results are a comparison of root growth between wild-type Arabidopsis plants and overexpression plants under mannitol stress and high salt stress conditions in the present invention.

[0020] Figure 7 This is the comparison result of Arabidopsis wild-type plants and overexpression plants under low temperature germination stress in the present invention.

[0021] Figure 8 The results are a comparison of the plant phenotype and anther morphology of the Arabidopsis wild-type plant and the overexpression plant in the present invention.

[0022] Fig. 9 This is the PCR identification result of the bacterial solution after the gene knockout recombinant vector in the present invention was transformed into Agrobacterium.

[0023] Fig.10 This is an electrophoresis diagram of PCR identification of the resistance gene bar in the T0 generation regenerated seedlings of the transgenic plants after gene knockout in the present invention.

[0024] Fig.11 This is a diagram showing the identification results of the PAT / bar transgenic detection test paper in the T0 generation regenerated seedlings of the transgenic plants of the present invention.

[0025] Fig.12 This is a diagram of the bar smear identification results of the T1 generation resistance gene of the transgenic plants of the present invention.

[0026] Fig.13 This is the comparison result of the DNA sequencing sequence of the target site of the GmAP2-a gene in the present invention.

[0027] Fig.14 The results are a comparison of the plant morphology and anther morphology of the soybean wild type and Cas9 mutant in the present invention.

[0028] Fig.15 The results are paraffin section comparisons of the anther morphology and microstructure of the soybean Cas9 mutant and wild-type plants in the present invention. DETAILED DESCRIPTION

[0029] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] illustrate:

[0031] The soybean AP2 gene was named GmAP2-a;

[0032] The reagents and methods used in the examples without specific description are all conventional reagents and conventional techniques in the art.

[0033] Experimental Example 1 GmAP2 gene cloning

[0034] 1. Obtaining the cDNA sequence of GmAP2 gene

[0035] 1.1 Obtaining single-stranded cDNA template

[0036] The incompletely differentiated florets at the top of the cultivated soybean inflorescence were collected, frozen in liquid nitrogen, and placed in a -80°C refrigerator for later use. A small amount of total RNA was extracted by combining TRIzol (Invitrogen) and LiCl (Sigma) precipitation. After DNA was digested by RQ1RNase-FreeDNaseI (Promega), the concentration and quality of total RNA were detected by 1.0% agarose electrophoresis combined with ThermoScientificNaNodrop2000c. The first single-strand cDNA was synthesized using the SuperScript III First-Strand Synthesis System for RT-PCR Kit (Invitrogen) with 1.5 μg RNA as a template. 2 μg of total RNA, OligodT

[0037] (100μM) 1μL, dNTP (10mM) 1μL, add ddH2O (RNase-free) to 29μL; react at 65℃ for 5min on PCR instrument, then quickly take out and cool in ice bath for 10min; add 11μL of the mixture to the tube

[0038] (5×first strand buffer 8μL, 0.1M DTT solution 2μL, 200U / μL M-MLV 1μL); gently mix with a pipette, react at 37℃ for 60min on a PCR instrument, and place at 70℃ for 15min to terminate the reaction.

[0039] Store at -20℃ until used.

[0040] 1.2 Bioinformatics analysis of soybean AP2 subfamily genes

[0041] By searching the published cultivated soybean genome sequence in https: / / phytozome-next.jgi.doe.gov / info / Gmax_Wm82_a2_v1 (BLAST), bioinformatics analysis of 355 soybean AP2-ERF family gene sequences was performed, and relevant information of 42 AP2 subfamily genes was obtained. Through analysis and comparison, RT-PCR primers were designed for 42 AP2 subfamily genes using Primer Premier5, and then amplified using soybean inflorescence cDNA as template. The obtained AP2 subfamily gene cDNA full sequence was named GmAP2-a, and the primer pair for amplifying the sequence was GmAP2-aF / R, the nucleotide sequence of which is shown below, and the PCR reaction conditions were: 94℃, 5min, 35 cycles (94℃1min, 60℃30s, 72℃30s), 72℃10min, PCR system was 50μL system, and conventional PCR amplification kit was used.

[0042] The sequence is as follows (5'→3'):

[0043] GmAP2-a F (SEQ ID NO.1): ATGTTAGATCTTAATCTCAATGCGGAGGmAP2-a R (SEQ ID NO.2): TTAACTAACATTGGTTTCCATC

[0044] The obtained RT-PCR amplification products were prepared and separated and detected by electrophoresis using 1.0% agarose gel electrophoresis. Figure 1 As shown, lane M in the figure is the D2000 molecular weight standard; lane 1 is the PCR amplified fragment, indicating that a PCR product of about 1000 bp was successfully amplified. The gel was placed under ultraviolet light, and the gel of the target fragment was cut with a scalpel and collected in a sterilized centrifuge tube. The recovery was performed according to the instructions of the Promega gel recovery kit.

[0045] according to T1 cloning vector (Promega) instructions T1 cloning vector connection. 10μL reaction system is as follows: 3μL of PCR recovery product, T1 Cloning Vector 1μL, T4 ligase 1μL, 2×T4 ligase Buffer 5μL. Mix gently and react at 37℃ for 5min. After the reaction is completed, place the centrifuge tube on ice.

[0046] Add 10μL of the ligation product to 50μL of Trans1-T1 competent cells, flick to mix, place on ice for 30min, heat shock at 42℃ for 45s, and immediately place on ice for 2min. Add 800μL of antibiotic-free LB liquid culture medium, shake and culture at 37℃, 200rpm for 1h. Mix 8μL of 500mM IPTG and 40μL of 20mg / mL X-gal, and evenly apply it on an LB plate containing a final concentration of 100mg / L ampicillin. After IPTG and X-gal are absorbed, take 100μL of bacterial solution and evenly apply it on the plate culture medium, and invert and culture at 37℃ overnight.

[0047] The white colonies were picked and inoculated into LB liquid culture medium containing ampicillin (100 mg / L), and cultured at 37°C with shaking for 12 hours, and PCR reaction identification was performed. The amplified products were sent to Invitrogen for sequencing, and the CDS of the obtained GmAP2-a gene was analyzed using bioinformatics software. The results showed that the CDS sequence of the GmAP2-a gene was 1119 bp in length, and its nucleotide sequence was shown in SEQ ID NO.3, and the open reading frame was 1119 bp, encoding 372 amino acids, and its amino acid sequence was shown in SEQ ID NO.4.

[0048] Experimental Example 2: Functional Study in Arabidopsis

[0049] 1. Obtaining Arabidopsis plants overexpressing the GmAP2-a gene

[0050] 1.1 Arabidopsis overexpression vector construction

[0051] Using the full-length cDNA sequence of the cultivated soybean AP2-a gene as a template, Xba I and Sac I restriction sites were selected at the multiple cloning site of the overexpression vector pMDC100IG, and amplification primers with Xba I and Sac I restriction sites added to both ends were synthesized by Invitrogen. The schematic diagram of the Arabidopsis overexpression vector is shown in the figure. Figure 2As shown. The reaction system and PCR conditions were the same as those for amplifying the cDNA sequence of the GmAP2-a gene. The PCR amplification products were separated by 1% agarose electrophoresis and recovered by the kit, then connected to the Trans1-T1 vector (Promega) and sent to Invitrogen for sequencing to verify the correctness of the sequence. The pMDC-100IG vector and the related plasmids containing the GmAP2-a gene were double-digested (Takara), 50μL of the enzyme digestion system: 1μg template, 1.5μL of Sac I and Xba I enzymes, 5μL of 10×BufferM, and 32μL of ddH2O. The reaction was carried out in a metal bath at 37℃ for 1h, separated by 0.8% agarose electrophoresis, cut the gel, and recovered the kit. The concentration was detected by Thermo Scientific NaNodrop 2000c. The GmAP2-a cloned fragment after restriction digestion was connected to the pMDC 100IG vector by T4 ligase (promega) (10 μL system: 4 μL of restriction digested cloned fragment, 1 μL of pMDC100IG restriction digested vector, 1 μL of 10×T4 ligase Buffer, 1 μL of T4 ligase, 3 μL of ddH2O), and the reaction was carried out in a metal bath at 37°C for 1 hour. The constructed recombinant was named pMDC 100IG-AP2-a. Using the heat shock method, 10 μL of pMDC 100IG-AP2-a was transformed into Escherichia coli DH5ɑ competent cells (same method as above), and the plates were coated (50 mg / L, kana + ), invert and culture at 37℃ overnight, and after a single colony grows, pick a single colony and inoculate it into 5mL liquid LB medium (50mg / L kana + ) and cultured at 37°C for about 8 h. The plasmid was extracted and the recombinant plasmid was identified by PCR and sequencing (Invitrogen). Figure 3 As shown, M in the figure is the D2000 molecular weight standard; lanes 1 to 5 are all PCR amplification fragments, and the results show that the overexpression recombinant plasmid to be detected was successfully constructed.

[0052] 1.2 Transformation of Arabidopsis thaliana with Agrobacterium tumefaciens GV3101

[0053] According to the operation (heat shock method) of the Molecular Cloning Experiment Guide (4th Edition), 1 μL of the recombinant overexpression vector pMDC 100IG-AP2-a plasmid successfully constructed above was transformed into competent cells of Agrobacterium tumefaciens GV3101, and PCR amplification and identification were performed. The amplification electrophoresis results were as follows: Figure 4 As shown, M in the figure is the D2000 molecular weight standard; lanes 1 to 4 are PCR amplified fragments; lane 5 is the positive control; and lane 6 is the negative control.

[0054] Cut off the top of the main inflorescence of Columbia wild-type Arabidopsis plants grown in a light incubator (24°C, 16h light / 8h dark) for about three weeks, and prepare for infection when a large number of buds grow on the side branches and a few open. Water thoroughly the day before infection, remove the fruit pods and opened flowers, and prepare for transformation. Inoculate Agrobacterium containing the recombinant gene GmAP2-a overexpression vector pMDC100IG-AP2-a into LB liquid culture medium containing resistance (50mg / L kanamycin and 25mg / L rifampicin), and shake and culture overnight at 30°C and 200rpm. Inoculate the overnight culture into LB liquid culture medium containing the corresponding antibiotics at a ratio of 1:50, and shake and culture at 28°C and 200rpm for about 15h until OD600 is 0.8-1.0. Collect the bacteria by centrifugation and resuspend them in an equal volume of buffer (containing 1 / 2MS culture solution, 5% sucrose and 0.02% silwet-77).

[0055] Arabidopsis infection was carried out using the pollen tube channel method. The upper part of the Arabidopsis plant prepared in advance was gathered into a bunch and slowly immersed in a container containing Agrobacterium resuspension, and gently shaken to make the flower organs evenly contact the bacterial solution for 30 seconds, incubated in the dark for 12 hours, and repeated infection once after 3 days. When the top fruit pods turned yellow and the seeds were about to mature, watering was stopped and seeds were collected one after another (T0 generation).

[0056] Use screening medium (1 / 2MS medium with 50 mg / L kanamycin resistance) to screen T1 generation seeds (24°C, 20 h light / 4 h dark), select single plants that can grow normally and transplant them into nutrient pots for culture (24°C, 20 h light / 4 h dark), and harvest seeds (T1 generation); repeat the above screening steps, replant them on the screening medium, count and select plants with a phenotypic trait segregation ratio of 3:1 to obtain T2 generation seeds, continue screening to obtain T3 generation pure lines without trait segregation, perform PCR amplification verification on the pure line plants, and select strains with obvious phenotypic traits for various treatments, observations, and photography.

[0057] 1.3 Phenotypic identification of transgenic Arabidopsis

[0058] 1.3.1 Water shortage and rehydration treatment of adult plants: The T3 generation seeds of the strains obtained by screening Arabidopsis thaliana (here four transgenic Arabidopsis thaliana strains a-3, b-4, c-7, and d-11 were selected) were directly planted in seedling trays (nutrient soil: vermiculite is 1:1), placed in a light incubator (24°C, 16h light / 8h dark) for growth, and watered with 1 / 2MS culture solution every 7 days when two rosette leaves unfolded. At 5 weeks, the plants were dehydrated for 3 weeks, rehydrated, and the survival rate of the plants was calculated after one week. The growth comparison results after drought stress are shown in the figure. Figure 5 As shown in A, the quantitative results are shown in Figure 5As shown in B, after rehydration, the survival rate of the transgenic lines was above 70%, which was significantly higher than that of the control group (Col-0, 36%), and the difference was extremely significant.

[0059] 1.3.2 Seedling growth stress treatment: The four T3 generation seeds obtained from the screening of Arabidopsis thaliana were sterilized routinely, planted in culture dishes (1 / 2MS) containing 300mM mannitol and 150mM sodium chloride, and cultured vertically in the light culture phase. After 3 weeks, the growth status of the plants was observed and the root length was measured. The results in mannitol were as follows: Figure 6 As shown in C, the quantitative results are as follows Figure 6 As shown in D, the result in sodium chloride is as follows Figure 6 As shown in E, the quantitative results are Figure 6 As shown in F. The results showed that the root lengths of the Arabidopsis transgenic lines (a-3, b-4, c-7, d-11) were significantly longer than those of the control group (Col-0), and the performance of different lines under the stress of mannitol and sodium chloride was also different.

[0060] 1.3.3 Low temperature seed germination treatment: The four T3 generation seeds obtained from the Arabidopsis thaliana screening were sterilized routinely, inoculated in 1 / 2MS medium, and germinated in the dark at -4℃ for 14 days. After that, the germination rate of the plants was counted. Figure 7 As shown in G, the quantitative results are as follows Figure 7 As shown in H. It can be seen that the low temperature germination rate of seeds of Arabidopsis transgenic lines (a-3, b-4, c-7, d-11) is above 80%, which is higher than that of the control group (Col-0), and the difference is extremely significant.

[0061] 1.3.4 Plant morphological observation: The four T3 generation seeds obtained from the Arabidopsis screening were directly planted in seedling pots (nutrient soil: vermiculite is 1:1), placed in a light incubator (24°C, 16h light / 8h dark) for growth, and watered with 1 / 2MS culture solution every 7 days when two rosette leaves unfolded. The growth of Arabidopsis wild type and overexpressing recombinant gene GmAP2-a plants was observed and counted. The results are as follows Figure 8 As shown in Figure 2, the growth comparison results of the control group (Col-0) and the overexpression gene plants (b-4) during the growth period are shown in Figure 2. Figure 8 As shown in I, Figure 8 J in the figure is the anther morphology of the plants in the control group (Col-0). Figure 8K in the figure is the anther morphology of the overexpressed plant. The results showed that the growth period of the Arabidopsis plant (b-4) with overexpression of the recombinant gene GmAP2-a was significantly later than that of the control (Col-0) by about 7-10 days, and the stamen development was abnormal, with a significant increase in the number of stamens, indicating that the overexpression of the GmAP2-a gene was involved in regulating the stamen development of the transgenic Arabidopsis, and this result suggests that it may play a positive role in the research related to soybean male sterility.

[0062] Experimental Example 3 Obtaining transgenic cultivated soybean plants

[0063] 1. Site-directed editing of the GmAP2-a gene mediated by CRISPR / Cas9

[0064] 1.1 Targeting site design and vector construction for CRISPR / Cas9 gene editing

[0065] Targeting site sgRNA design platform using CRISPR / Cas9 technology: CRISPR-P

[0066] (http: / / cbi.hzau.edu.cn / CRISPR2 / ) was used to design sgRNA primers. The primers of GmAP-a-cas9-3F / R were designed according to the 20bp recognition sequence of the gRNA target site. The specific sequence is shown below and was synthesized by Invitrogen;

[0067] The sequence is as follows (5'→3'):

[0068] GmAP-a-cas9-3F (SEQ ID NO.5): TTGCCTCCGTGGTGAATGCGGACGmAP-a-cas9-3R (SEQID NO.6): AACGTCCGCATTCACCACGGAGGCRISPR / Cas9 plasmid construction used the Cas9 / sgRNA plasmid construction kit developed by Weishanglide Biotechnology Co., Ltd. The company's vector (named VK005-102) used the promoter sequence of Arabidopsis thaliana AtU6-26 (to start sgRNA transcription), the codon-optimized dpCas9 gene of dicotyledonous plants, and the Ubi promoter of corn activated the expression of dpCas9. The screening marker gene was glufosinate resistance bar. Refer to the operating instructions of the kit for subsequent operations:

[0069] (1) Formation of oligo dimers: The oligo primers synthesized by Invitrogen were diluted to 10 μM respectively and mixed in the following proportions: 25 μL of the system (5 μL of GmAP-a-cas9-3F; 5 μL of GmAP-a-cas9-3R; 15 μL of ddH2O), incubated at 95°C for 3 min in a PCR instrument; then slowly cooled from 95°C to 25°C (PCR cooling range: -1°C / 30 s); and then incubated at 16°C for 5 min to obtain oligo dimers.

[0070] (2) Insertion of oligo dimer into the vector: The reaction system is 10 μL, including (saCas9 / gRNA Vector (prepared in the kit) 1 μL; oligo dimer of step (1) 1 μL; Solution 1 (prepared in the kit) 1 μL; Solution 2 (prepared in the kit) 1 μL; H2O 6 μL), and react in a PCR instrument at 16°C for 120 min.

[0071] (3) Transformation: Take 10 μL of the final product of step (2) and add it to 50 μL of E. coli competent cells DH5α that have just been thawed on ice, flick to mix, place on ice for 30 min, heat shock at 42°C for 90 s, let stand on ice for 2 min, add 200 μL of antibiotic-free liquid LB, place in a 37°C constant temperature shaker, and resuscitate at 180 rpm for 1 h. Then, take 100 μL of the bacterial solution and evenly apply it to the Kanamycin-resistant strain. + , 50 mg / L) on LB solid plates and cultured inverted at 37°C overnight.

[0072] (4) Identification of positive clones

[0073] Pick the white colonies on the plate obtained in step (3) and inoculate them into 20 mL of liquid LB (containing Kana + ) and shake the bacteria at 170 rpm for 8 hours at 37°C; perform bacterial solution PCR detection, wherein the 25 μL system includes: 1 μL bacterial solution, 1 μL GmAP-a-cas9-3F primer, 1 μL Sq primer with a nucleotide sequence as shown in SEQ ID NO.9, 12.5 μL 2×TaqMasterMix, and 9.5 μL Autoclaved ddH2O. The PCR reaction program is 94°C for 3 minutes; 35 cycles (94°C for 30 seconds; 55°C for 30 seconds; 72°C for 30 seconds); 72°C for 5 minutes, and the clones positive for electrophoresis detection are selected for sequencing, and the clones successfully inserted into the designed sgRNA target site sequence are screened.

[0074] Among them, Sqprimer is a nucleotide sequence that comes with the cas9 vector company, located on the side of the insertion site, and is only used for PCR sequencing detection operated by this kit. The specific sequence is as follows (5'→3'):

[0075] Sqprimer(SEQ ID NO.9):GATGAAGTGGACGGAAGGAAGGAG

[0076] (5) Transformation and identification of Agrobacterium strains

[0077] The Agrobacterium tumefaciens strain EHA105 was transformed by freeze-thaw method. Refer to the operation (heat shock method) of the Molecular Cloning Experiment Guide (Fourth Edition) (add 2 μL of the plasmid successfully assembled by sequencing verification to 200 μL of ice-thawed Agrobacterium EHA105 competent cell tube, flick to mix, and stand on ice for 30 minutes; cool with liquid nitrogen for 5 minutes; 37°C water bath for 5 minutes, add 800 μL of antibiotic-free YEP solution culture medium (1L solution: 10g tryptone, 5g yeast extract, 5g NaCl, pH = 7.0); shake and culture at 150rpm in a constant temperature shaker for 4 hours, and draw 100 μL of bacterial solution and evenly apply it on YEP solid culture medium (Rif, 25mg / L; Kana + , 50mg / L; YEP liquid + 12.5g / L agar powder) and inverted culture at 28℃ for 1-2 days; after the bacterial plaques are clearly visible, pick a single colony and perform PCR identification again (PCR and electrophoresis methods are the same as (4), the results are as follows Fig. 9 As shown, lane M in the figure is the D2000 molecular weight standard; lane 1 is the negative control of the empty vector; lanes 2 to 5 are all PCR amplified fragments. Take 500 μL of the bacterial solution of the positive plaque (the plaque corresponding to lanes 2 to 5), add 500 μL of 50% sterile glycerol, and store in a -80°C refrigerator.

[0078] 1.2 Genetic transformation of soybean cotyledonary nodes mediated by Agrobacterium tumefaciens

[0079] (1) Surface sterilization of soybeans using chlorine: Select about 200 plump, smooth-skinned, wrinkle-free and damaged seeds from Dongnong small-grain soybeans and spread them flat in a glass culture dish with a diameter of 22 cm; separate the glass culture dishes and place them in a desiccator in a fume hood with their lids uncovered. Place a beaker containing 90 mL of sodium hypochlorite solution (about 5% active chlorine content) at the same time, slowly add 4 mL of concentrated hydrochloric acid along the wall of the beaker, quickly cover the desiccator lid coated with vaseline, and sterilize with chlorine for 16 h.

[0080] (2) Seed germination: After sterilization, the glass dish was opened in a fume hood to release residual chlorine for 1 h. The lid was moved to a clean bench, and the soybean seeds were picked up with sterile tweezers and inoculated on germination medium (1 / 2×MS salt, 5 g / L sucrose, 3.5 g / L gelatin, pH=5.8), and the lid was closed and cultured for 2 days (25°C, 16 h light / 8 h dark).

[0081] (3) Preparation of bacterial culture: Take 50 μL of the identified and preserved Agrobacterium culture carrying the target vector and inoculate it into 20 mL YEP liquid culture medium (Rif, 25 mg / L; Kana + , 50 mg / L) and cultured overnight at 28°C with shaking to complete the primary activation of the bacterial solution. Add 200 μL of the activated bacterial solution to 200 mL of YEP liquid medium (Rif, 25 mg / L; Kana + , 50 mg / L), cultured with shaking at 28°C until OD600 was about 1.0, collected the bacteria by centrifugation (4000 rpm, 30 min), and resuspended in liquid resuspension medium (1 / 10 B5 medium, 30 g sucrose, 3.9 g MES, 1.67 mg 6-BA, 0.25 mg GA3, 40 mg AS (pH 5.4)) to OD600 of about 0.8.

[0082] (4) Infection and co-cultivation: Under sterile conditions, take explants with good germination (green cotyledons and no obvious cracks), retain about 0.5 cm of the hypocotyl, peel off the seed coat, cut the cotyledons and hypocotyls longitudinally, remove the embryo, and scratch the axils of the cotyledons to create wounds. The scratched explants were immersed in the resuspended bacterial solution for 30 min (28°C, 120 rpm), stirred from time to time, and the bacterial solution was poured out. Then, the cut wound was placed face down on a co-cultivation medium (1 / 10 B5 medium, 30 g / L sucrose, 3.9 g / L MES, 5 g / L agarose, 1.67 mg / L 6-BA, 0.25 mg / L GA3, 40 mg / LAS, 400 mg / L L-cys, 154.2 mg / L DTT, 158 mg / L NaTHio (pH 5.4)) covered with a layer of sterile filter paper, covered with a lid and sealed, and placed in co-cultivation at 25°C (dark) for 4 days.

[0083] (5) Flushing and inducing budding: The explants were removed from the co-cultured culture medium and washed several times with a flushing solution (1×B5 medium, 30 g / L sucrose, 3.9 g / L MES, 1.67 mg / L 6-BA, 0.25 mg / L GA3, 50 mg / L Cef, 500 mg / L Carb (pH 5.6)) until the wash solution became clear. After drying with sterile filter paper, the explants were inserted obliquely into SIM medium (1×B5 medium, 30 g / L sucrose, 3.5 g / L gelatin, 0.58 g / L MES, 1.67 mg / L 6-BA, 50 mg / L Cef, 500 mg / L Carb (pH 5.6)) at 25°C.

[0084] Cultivate under 16h light / 8h dark conditions. After 2 weeks, the large buds of the sprouting explants were removed and transferred to SIM medium containing 5mg / L glufosinate, and screened and cultured for 14 days (25°C, 16h light / 8h dark); after 14 days, the dead buds, yellow leaves and yellow cotyledons of the explants were removed, and after forming new wounds at the base, they were moved to new SEM medium containing 4mg / L glufosinate (1×B5 medium, 30g / L sucrose, 3.5g / L gel, 0.58g / LMES, 0.5mg / LGA3, 0.1mg / LIAA, 1mg / LZR, 50mg / LAsp, 100mg / LL-pyro, 75mg / LCef, 500mg / LCarb, 3mg / LGlu (pH5.6)) and cultured for 6-8 weeks (25°C, 16h light / 8h dark), subcultured every two weeks, and the growth conditions were the same as above.

[0085] (6) Root induction and seedling hardening: When the regenerated buds extend to about 3-5 cm and have 3 or more leaves, cut the clustered buds from the base and transfer them to RM rooting medium (1 / 2 B5 medium, 15 g sucrose, 0.59 g MES, 8 g agar powder, 1 mg IBA (pH 5.7)), and culture them at 25°C, 16 h light / 8 h dark for about 10 days to induce rooting; when the root system grows to have 2-3 taproots and the root length is more than 3 cm, open the culture jar and harden the seedlings for 3 days (put on a fresh-keeping bag and add sterile distilled water to the jar to keep it moist).

[0086] (7) Transplantation: The green regenerated seedlings were removed from the culture tank, the root culture medium was cleaned with distilled water, and then transplanted into sterilized mixed nutrient soil (a mixture of nutrient soil and vermiculite, volume ratio = 2:1). The pots were tightly wrapped with plastic wrap and placed in an artificial culture incubator (25°C, 16 h light / 8 h dark) for acclimatization for 1-2 weeks. The seeds can be harvested after 2-3 months.

[0087] 1.3 Detection of bar gene in T0 plants

[0088] When the plants transformed from the cotyledon nodes of the T0 generation were transplanted from the culture pots to the nutrient soil, 1 / 3 of the young leaves were cut, and the DNA was extracted using a plant genomic DNA extraction kit (Tiangen) for PCR detection of transgenics. The resistance gene bar (the sequence of bar-F / R is shown below) was screened, 30μL system: 1μL DNA template, 15μL 2×PCRBuffer, 2μL rTaq (Takara), 1μL each of 10μM primers bar-F / R, 10μL ddH2O, reaction conditions: 94℃, 5min, 35 cycles (94℃1min, 60℃30s, 72℃30s), 72℃10min. 1% agarose electrophoresis separation imaging, the results are shown in Fig.10 As shown, lane M in the figure is the D2000 molecular weight standard; lane 1 is the positive control; lane 2 is the negative control; lanes 3 to 9 are all PCR amplified fragments. The above DNA solution for PCR identification was used to detect the positive transgenic plants using QuickStix PAT / bar transgenic detection test strips (LibertyLinkRstrip; Catalog Number AS013LS, purchased from EnviroLogix, USA). The results are shown in Fig.11 As shown, 1 in the figure is a non-transgenic plant; 2 is a negative transgenic plant; 3 to 9 are all T0 generation regenerated seedlings, which once again verified the screening results. At the same time, plants with positive resistance gene bar were selected for screening (plants with target bands indicated by arrows in PCR amplification and detection test paper).

[0089] The sequences used are as follows (5'→3'):

[0090] bar-F(SEQ ID NO.7):AGAAACCCACGTCATGCCAGT

[0091] bar-R(SEQ ID NO.8):TCTGCACCATCGTCAACCACT

[0092] 1.4 Identification of T1 generation plants

[0093] A total of 13 positive plants were obtained in the T0 generation identification, of which 6 plants were harvested with a total of 11 seeds, and 7 plants were fruitless. The obtained seeds were planted in nutrient soil (a mixture of nutrient soil and vermiculite, volume ratio = 2:1), placed in an artificial culture incubator (25°C, 16h light / 8h dark) for cultivation, and named M-1, M-2, ..., M-11 in sequence. The T1 generation plants were further identified and compared for transgenics.

[0094] (1) Glufosinate application: When the third trifoliate compound leaf of the T1 soybean plant is fully expanded, mark the 1 / 3 of the tip of the leaf with a marker pen and apply 150 mg / L glufosinate with a brush. Observe the condition of the leaves after 3-5 days. The results are as follows: Fig.12 As shown, A in the figure shows the leaves of the wild type plant smeared with glufosinate; B in the figure shows the leaves of the positive transgenic plant smeared with glufosinate. The results show that after the wild-type soybean leaves were smeared with glufosinate, a large area of ​​chlorosis appeared on the upper end of the leaves, while among the 11 transgenic T1 generation mutant plants, 5 mutant soybean leaves did not show obvious chlorosis, and the leaves of the remaining 6 mutant plants also showed varying degrees of chlorosis and plant death. The lines with no chlorosis (M-1, M-2, M-3, M-7, and M-9) were selected for PCR identification again.

[0095] (2) PCR identification: Cut 1 / 3 of the young leaves, extract DNA using the Plant Genomic DNA Extraction Kit (Tiangen), and perform PCR detection of transgenics. The reaction system (primers are bar-F / R) and reaction conditions of the bar gene are the same as those in 1.3 above; the reaction system and PCR conditions of the GmAP2-a gene are the same as those of the above RT-PCR amplification, the primers are GmAP2-aF / R, 1% agarose gel electrophoresis separation, gel excision and recovery, and sent to the company for sequencing. The sequencing results are compared with the sequence of the mutation site. The sequencing comparison results are as follows: Fig.13 As shown, compared with the wild-type plant WT, in the target site region of the GmAP2-a gene, mutants M-1 and M-3 had a four-base deletion at the same position; M-2 had a single-base deletion; M-7 and M-9 did not change.

[0096] 1.5 Phenotypic identification of transgenic cultivation

[0097] The wild type and 11 seeds were planted in nutrient soil and cultured in an artificial climate chamber (24°C, 16h light / 8h dark). After the above-mentioned multiple technical identification and sequencing detection, only 3 plants (M-1, M-2, and M-3) were true positive plants (target site base deletion). The morphological characteristics of the plants were observed, and the results were as follows Fig.14 As shown, WT in the figure is a wild-type plant, M-1, M-2, and M-3 are mutant T1 generation plants, respectively. The results show that compared with the wild type, the T1 generation mutant seedlings obtained by gene editing showed dwarfing, shortened internodes, smaller floral organs, and self-sterility in the mutant plants.

[0098] 1.6 Preparation of paraffin sections

[0099] The floral organs of wild-type and positive mutant plants were fixed with 70% FAA, prepared by conventional paraffin sections with a thickness of 10 μm, stained with safranin-fast green, sealed with neutral glue, observed and photographed under a microscope (Olympus BH2-C5060WZ), and the specific steps were as follows:

[0100] (1) Sectioning: The material fixed with 70% FAA was dehydrated with alcohol, transparentized with xylene, immersed in wax, embedded in paraffin, and then sliced, double-stained with safranin and fast green, and sealed with Canada gum. The operation method is as follows:

[0101] ① Dehydration: After the material was fixed with 70% FAA, it was dehydrated by 70% ethanol (2h) → 85% ethanol (2h) → 95% ethanol (overnight) → 100% ethanol (1h) → 100% ethanol (1h);

[0102] ② Transparent: After dehydration, go through 1 / 3 xylene + 2 / 3 anhydrous ethanol (2h) → 1 / 2 xylene + 1 / 2 anhydrous ethanol → 2 / 3 xylene (2h) + 1 / 3 anhydrous ethanol (2h) → pure xylene (pure xylene is changed once every 1h);

[0103] ③ Wax dipping: Add wax scraps to the transparent material until it is saturated, place it in a 37℃ incubator overnight, and place the sample in a wax dipping chamber at 56-61℃ (2℃ higher than the melting point of paraffin) the next day, and replace half of the xylene with pure wax. After 2 hours, replace half of the original solution, and after another 2 hours, replace all with pure wax, and finally replace the pure wax twice, with an interval of 1 hour each time;

[0104] ④Embedding: Prepare a paper box of appropriate size in advance, pour in the dissolved paraffin, and embed the material into wax blocks.

[0105] ⑤ Slicing: Determine the direction of the section, trim the wax block into a shape that is convenient for slicing, and then slice and glue the slices. The slice thickness is 10μm, and continuous slices are made.

[0106] (2) Safranin-Fast Green Double Staining: After drying, spread the slices and soak them in xylene for 15 min. Then rehydrate them: add 1-2 drops of xylene and immerse the slices for 1-2 min. The time interval between each drop of staining is 1-2 min. The steps are: 2 / 3 xylene + 1 / 3 ethanol, 1 / 2 xylene + 1 / 2 ethanol, 1 / 3 xylene + 2 / 3 ethanol, anhydrous ethanol, 95% alcohol, 85% alcohol, 70% alcohol, 50% alcohol, 30% alcohol, distilled water, safranin staining for 2-3 minutes, wash off the floating color with distilled water, then dehydrate, 30% alcohol, 50% alcohol, 70% alcohol, 85% alcohol, add fast green staining for about 30 seconds, quickly wash off the floating color with 95% ethanol, 100% ethanol, 100% ethanol, 1 / 3 xylene + 2 / 3 ethanol, 1 / 2 xylene + 1 / 2 ethanol, 2 / 3 xylene + 1 / 3 ethanol, xylene, each step for 1 minute, and finally seal the slide with neutral gum.

[0107] The results of paraffin section microscopy were as follows Fig.15 As shown, a is the wild type and b is the mutant. The results show that the pollen of the stamens of the mutant plants develops normally, but the anther tapetum cannot crack normally, which makes the pollen of the mutant unable to spread normally to the stigma of the pistil, resulting in abnormal self-pollination and male sterility.

[0108] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A soybean GmAP2-a A gene characterized by The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

2. A soybean as claimed in claim 1 GmAP2-a The protein encoded by the gene is characterized in that The amino acid sequence of the protein is shown in SEQ ID NO.

4.

3. A soybean comprising as claimed in claim 1 GmAP2-a Gene overexpression recombinant vector.

4. A recombinant bacterium comprising the overexpression recombinant vector as claimed in claim 3.

5. The recombinant bacterium according to claim 4, characterized in that The recombinant bacteria is selected from Agrobacterium tumefaciens.

6. The soybean according to claim 1 GmAP2-a The application of the gene in soybean breeding is characterized in that: The application is to prepare soybean male sterile strains.

Images