A molecular marker related to sex of largemouth bass, amplification primers and their application

By developing molecular markers and primers related to largemouth bass, combined with enzyme cutting and Taqman probe technology, the problem of gender identification of largemouth bass was solved, rapid and accurate gender identification was achieved, and efficient breeding and economic benefits of largemouth bass breeding were promoted.

CN115927575BActive Publication Date: 2025-08-19FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211015986.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-24
Publication Date
2025-08-19
Estimated Expiration
2042-08-24

AI Technical Summary

Technical Problem

The prior art is difficult to accurately judge the gender of largemouth bass, making it difficult to increase their yields through gender-controlled breeding.

Method used

A molecular marker related to the gender of largemouth bass was developed, using A/T polymorphisms in the nucleotide sequence, combined with restriction endonuclease TaaI cleavage and Taqman probe technology, to design specific amplification primers to achieve rapid and accurate gender identification.

Benefits of technology

It has achieved rapid and accurate identification of the gender of largemouth black bass, supported whole female or whole male breeding, and improved breeding output and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115927575B_ABST
    Figure CN115927575B_ABST
Patent Text Reader

Abstract

The present invention provides a molecular marker, amplification primer, and application related to the sex of largemouth bass, belonging to the field of molecular marker technology. The present invention provides a molecular marker related to the sex of largemouth bass, the nucleotide sequence of which is shown in SEQ ID NO:1, wherein the sequence shown in SEQ ID NO:1 exhibits an A / T polymorphism at position 56. Furthermore, the present invention develops a method for rapidly and accurately identifying the sex of largemouth bass based on the molecular marker in combination with restriction endonuclease technology and / or Taqman probe technology, requiring only a small amount of tail fin sample, without any harm to the fish.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a molecular marker related to the sex of largemouth bass, an amplification primer and an application thereof. Background Art

[0002] The largemouth bass is native to California, USA. It was introduced to Taiwan in the 1970s, and Guangdong Province followed in 1983, with successful artificial breeding achieved in 1985. According to the latest fishery statistics, aquaculture production has reached 478,000 tons, with a 10% increase, making it the second-highest annual growth rate for fish in my country. Due to its delicious meat, strong disease resistance, and rapid growth, it has become a popular aquaculture species in my country. Studies have shown that female largemouth bass grow and develop faster than males. However, the external morphology of male and female largemouth bass is not distinct, making it difficult to distinguish between males and females by sight. Determining their genetic sex through morphology or histological observation is extremely difficult.

[0003] Developing sex-linked molecular markers is an effective means of breeding monosex largemouth bass to increase their production. Primers that amplify sex-linked molecular markers are the most effective and feasible prerequisite for rapidly screening for bisexual populations. Therefore, sex-linked molecular markers can be used to accurately identify the genetic sex of organisms, playing a crucial role in research on sex-controlled breeding and the molecular mechanisms of sex determination. Currently, sex-linked DNA markers have been identified for many fish species, and PCR-based genetic sexing techniques have been established. However, relatively mature molecular marker techniques for sexing largemouth bass have been reported. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a molecular marker related to the sex of largemouth bass, determine the presence of A / T polymorphism at the SNP3 (35142120) site, which is closely linked to the male and female sex of largemouth bass and can be used to accurately determine the sex of largemouth bass.

[0005] The invention provides an amplification primer for identifying the male and female sex of largemouth bass, which can quickly and accurately amplify molecular markers related to the male and female sex of largemouth bass.

[0006] The present invention provides a molecular marker related to the sex of largemouth bass. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. There is an A / T polymorphism at position 56 of the sequence shown in SEQ ID NO: 1.

[0007] The present invention provides a primer for detecting the sex of largemouth bass, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 3.

[0008] The invention provides a kit for detecting the sex of largemouth bass, which comprises a restriction endonuclease TaaI digestion reagent or a qPCR detection reagent.

[0009] Preferably, the restriction endonuclease TaaI enzyme digestion reagent comprises restriction endonuclease TaaI and enzyme digestion buffer;

[0010] The qPCR detection reagents include Taqman probes and qPCR amplification primers.

[0011] Preferably, the qPCR amplification primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 6 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 7;

[0012] The nucleotide sequences of the Taqman probes are shown in SEQ ID NO:8 and SEQ ID NO:9.

[0013] The present invention provides application of the molecular marker or the kit in detecting the sex of largemouth bass.

[0014] The present invention provides a method for detecting the sex of largemouth bass, comprising the following steps:

[0015] Extracting genomic DNA of the largemouth bass to be tested;

[0016] The genomic DNA is used as a material to perform detection based on the polymorphic sites of the molecular markers, and the sex of the largemouth bass to be tested is determined according to the detection results.

[0017] Preferably, the detection includes restriction endonuclease TaaI digestion detection and / or Taqman probe detection.

[0018] Preferably, the method of using restriction endonuclease TaaI enzyme digestion detection is to digest the PCR product with TaaI, and perform electrophoresis analysis on the enzyme digestion product. If a 988bp band is obtained, it is judged that the largemouth bass to be tested is a female fish; if a 988bp band is obtained, a 1268bp band and a 1508bp band are also included, it is judged that the largemouth bass to be tested is a male fish.

[0019] Preferably, the Taqman probe detection method is used to determine the SNP site genotype of the largemouth bass to be tested based on the fluorescent color of the probe on the qPCR product: the sex of the largemouth bass is determined based on the specific genotype:

[0020] The fluorescent color shows the TT genotype, and the largemouth bass being tested is judged to be female;

[0021] The fluorescent colors showed the AT and AA genotypes, indicating that the largemouth bass being tested was male.

[0022] The molecular marker related to the sex of largemouth bass provided by the present invention has a nucleotide sequence as shown in SEQ ID NO: 1. There is an A / T polymorphism at position 56 of the sequence shown in SEQ ID NO: 1, which is a SNP molecular marker. The present invention develops SNP molecular markers based on the resequencing data of male and female largemouth bass. The SNP molecular marker is closely linked to the performance of largemouth bass and can accurately distinguish the performance of largemouth bass, wherein the TT genotype is female largemouth bass, and the AT and AA genotypes are male largemouth bass. It can be seen that the molecular marker provided by the present invention provides a feasible method for all-female or all-male breeding of largemouth bass to obtain higher yields, improve economic benefits, and promote the development of the industry, and at the same time has the characteristics of fast and accurate detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The electrophoresis results of SNP2 in male and female largemouth bass (n=8);

[0024] Figure 2 The electrophoresis results of SNP3 in male and female largemouth bass (n=16);

[0025] Figure 3 The electrophoresis results of SNP3 in male and female largemouth bass "Youyu No. 3" (n=80);

[0026] Figure 4 Taqman probe was used to detect male and female largemouth bass (n=16).

[0027] Figure 5 Taqman probe was used to identify male and female largemouth bass "Youlu No. 3" (n=80). DETAILED DESCRIPTION

[0028] The present invention provides a molecular marker related to the sex of largemouth bass. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. There is an A / T polymorphism at position 56 of the sequence shown in SEQ ID NO: 1.

[0029] The present invention provides primers for detecting the sex of largemouth bass, comprising a forward primer having a nucleotide sequence as shown in SEQ ID NO: 2 (TTTGTTCATCACTTCATATTAACGCTGA) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 3 (AGAGAAACTTCCGAGATAACGCAGAA). The primers are used to amplify largemouth bass genomic DNA, and the resulting amplified product is the molecular marker.

[0030] The invention provides a kit for detecting the sex of largemouth bass, comprising a restriction endonuclease TaaI enzyme digestion reagent or a qPCR detection reagent.

[0031] In the present invention, the restriction endonuclease TaaI digestion reagent preferably comprises the restriction endonuclease TaaI and a digestion buffer, wherein the digestion site of the restriction endonuclease TaaI is TGACAT / A.

[0032] In the present invention, the qPCR detection reagent preferably includes a Taqman probe and a qPCR amplification primer. The qPCR amplification primer includes a forward primer having a nucleotide sequence as shown in SEQ ID NO:6 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:7; the nucleotide sequence of the Taqman probe is shown in SEQ ID NO:8 and SEQ ID NO:9. The Taqman probe is an oligonucleotide sequence, which is labeled with a fluorescent group and a quencher group at its 5' end and 3' end, respectively. Based on the 5'-3' exonuclease activity of Taq polymerase, the Taq enzyme will enzymatically degrade the probe during PCR amplification, so that the fluorescent group and the quencher group are separated to produce a fluorescent signal. The present invention has no special restrictions on the type of the fluorescent group, and fluorescent groups well known in the art can be used.

[0033] The present invention provides application of the molecular marker or the kit in detecting the sex of largemouth bass.

[0034] In the present invention, the A / T polymorphic site in the molecular marker is tightly linked to the sex of largemouth bass. Therefore, the A / T polymorphism in the molecular marker can be used as a detection target to predict the sex of largemouth bass, where the TT genotype indicates female, and the AA and TA genotypes indicate male. Simultaneously, the primers have the function of specifically amplifying the molecular marker, and the purpose of rapidly predicting the sex of largemouth bass can be achieved by detecting the genotype of the polymorphic site in the amplified product.

[0035] The present invention provides a method for detecting the sex of largemouth bass, comprising the following steps:

[0036] Extracting genomic DNA of the largemouth bass to be tested;

[0037] The genomic DNA is used as a material to perform detection based on the polymorphic sites of the molecular markers, and the sex of the largemouth bass to be tested is determined according to the detection results.

[0038] The invention extracts the genomic DNA of the largemouth bass to be tested.

[0039] The present invention has no particular limitation on the method for extracting genomic DNA from largemouth bass. Aquatic animal genomic DNA extraction methods known in the art can be used, such as the cell / tissue genomic DNA extraction kit from Novazonic Biotech.

[0040] After obtaining the genomic DNA of the largemouth bass to be tested, the present invention uses the genomic DNA as material to perform detection based on the polymorphic sites of the molecular markers, and determines the sex of the largemouth bass to be tested according to the detection results.

[0041] In the present invention, the detection method preferably includes TaaI enzyme digestion detection and / or Taqman probe detection. If Taqman probe detection is used, qPCR amplification is preferably performed first, and the obtained qPCR amplification product is analyzed for fluorescence color development. The reaction conditions for the qPCR amplification are preferably as follows: 25 μL: 1 μL DNA sample, 9.5 μL sterile water, 12.5 μL Premix Ex Taq, 0.5 μL each of forward and reverse primers (10 μmol / L), and 0.5 μL (10 μmol / L) of probe. qPCR reaction amplification conditions: 95°C for 30s; 95°C for 5s, 65°C for 34s, and 40 cycles. Fluorescence signals of the amplification results are collected.

[0042] In the present invention, the method of detecting largemouth bass by restriction endonuclease TaaI digestion is preferably to digest the genomic DNA of the largemouth bass with TaaI, and then subject the digestion products to electrophoresis analysis. If a 988bp band is obtained, the largemouth bass being tested is determined to be female; if a 988bp band is obtained along with a 1268bp and a 1508bp band, the largemouth bass being tested is determined to be male. The TaaI digestion reaction system is 10 μL: 3 μL of PCR product, 5.8 μL of H2O, 1 μL of 10× Buffer, and 0.2 μL of TaaI enzyme. The TaaI digestion conditions are preferably 65°C for 15 minutes.

[0043] In the present invention, the Taqman probe detection method is adopted, and the qPCR product is preferably used to judge the SNP site genotype of the largemouth bass to be tested according to the fluorescent color on the probe: the sex of the largemouth bass is judged according to the specific genotype: the fluorescent color shows the TT genotype, and the largemouth bass to be tested is judged to be female; the fluorescent color shows the AT and AA genotypes, and the largemouth bass to be tested is judged to be male.

[0044] The following is a detailed description of a molecular marker, amplification primer and application related to the sex of largemouth bass provided by the present invention in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present invention.

[0045] Example 1

[0046] Development of a SNP molecular marker associated with sex in largemouth bass

[0047] 1. Selection of male and female largemouth bass samples

[0048] Thirty female and thirty male largemouth bass (S. nigripes) were selected. 0.2 g of caudal fin tissue was removed, fixed with 95% ethanol, and stored at -20°C until use. All fish used in the experiments were dissected to accurately confirm their biological sex.

[0049] 2. Extraction of Genomic DNA

[0050] All the largemouth bass samples were collected and the tail fin genomic DNA was extracted using the cell / tissue genomic DNA extraction kit of Novozymes Biotech. The concentration and purity of the DNA were detected by UV spectrophotometer. The OD value of the DNA was 0. 260 / OD 280 The ratio is between 1.8 and 2.0, and the concentration is between 750 and 1200 ng / L, indicating that the extracted DNA is relatively ideal. It is diluted to 50 ng / μL and stored at -80℃ for future use.

[0051] 3. Screening of Sex-Different SNP Markers

[0052] The genomes of 60 individuals were resequenced. Based on the resequencing results, allele frequencies were calculated for females (30 samples) and males (30 samples). SNPs that met the criteria of average SNP sequencing depth ≥ 2x, minimum gene frequency (MAF) ≥ 0.05, and Fst >= 0.4 were considered sex-associated. Based on these criteria, combined with genotyping results, the two most strongly sex-associated SNPs were identified: SNP2 (35042234) and SNP3 (35142120).

[0053] Table 1 Primer design and genotyping of SNP sites

[0054]

[0055] The PCR reaction system (20 μL) consisted of 1 μL DNA sample, 8 μL sterile water, 10 μL Premix Ex Taq, 1 μL forward primer, and 1 μL reverse primer. The PCR protocol was as follows: 95°C for 5 min; 35 cycles of 95°C for 30 s, 52°C for 30 s, and 72°C for 50 s; and 72°C for 5 min.

[0056] 4. Validation of Sex-Related SNP Molecular Markers by Restriction Enzyme Digestion

[0057] The above screening identified two sex-related loci. If a SNP is present, the length and number of digested fragments will differ. The presence of the SNP, and therefore the sex of the largemouth bass, can be determined based on the electrophoresis results. The corresponding endonucleases for the two loci were queried. Based on the polymorphism of SNP2 (35042234), largemouth bass genomic DNA was digested with the restriction endonuclease DdeI. Based on the polymorphism of SNP3 (35142120), the restriction endonuclease TaaI was used. The digestion system (10 μL) consisted of 3 μL of PCR product, 5.8 μL of H2O, 1 μL of 10× buffer, and 0.2 μL of enzyme. DdeI digested at 37°C for 1.5 h, and the digested product was inactivated at 65°C for 20 min. TaaI digested at 65°C for 15 min. After digestion, the fragments were analyzed by 1% agarose gel electrophoresis.

[0058] First, we verified the SNP2 site. The results showed that among the eight female fish of the northern American subspecies, only one female fish had a specific band of 1502 bp, while the other seven fish had two specific bands of 1244 bp and 1502 bp, respectively. The same was true for the eight male fish of the northern American subspecies. No specific bands with obvious differences in fragments were found between females and males. Figure 1 ). 16 female and 16 male largemouth bass of the northern subspecies were subsequently used to verify the SNP3 site. The results showed that the electrophoresis results of the 16 females had only one specific band of 988 bp, while the electrophoresis results of the 16 male largemouth bass showed not only a specific band of 988 bp, but also two specific bands of 1268 bp and 1508 bp. Figure 2 ). SNP3 initially showed that there were specific bands with obvious differences between female and male largemouth bass.

[0059] Example 2

[0060] Validation of a SNP molecular marker associated with sex in largemouth bass

[0061] To further verify the accuracy of the results, 80 caudal fin samples from the largemouth bass "Youyu No. 3" were randomly selected and dissected to determine their physiological sex. SNP3 was amplified by PCR in the caudal fin samples. The resulting PCR product was digested with the restriction endonuclease Taa I and analyzed by agarose gel electrophoresis. After the electrophoresis results for all 80 largemouth bass were obtained, the physiological sex of the largemouth bass was compared with the electrophoresis results.

[0062] The results showed that the physiological sex of 80 largemouth bass after dissection corresponded to the enzyme digestion results ( Figure 3 ), SNP3 can accurately identify the sex of largemouth bass and is a stable female difference site.

[0063] Example 3

[0064] Taqman probe preparation

[0065] After the restriction endonuclease verification was completed, the site SNP3 was determined to be a stable male-female difference site, and the enzyme cutting results were reliable and accurate. Based on this, a faster and more accurate Taqman real-time fluorescence PCR verification method was developed, which omitted the PCR reaction process during the enzyme cutting process, and can greatly improve the efficiency of screening male and female largemouth black bass.

[0066] A qPCR detection probe was designed for the SNP3 site and its upstream and downstream nucleotide sequences, and the specific nucleotide sequences are shown in SEQ ID NO: 8 and SEQ ID NO: 9. Specifically:

[0067] Forward primer: TGCAGAATTTGTTCATCACTTCA (SEQ ID NO: 6);

[0068] Reverse primer: GCGGCCAAAAACTTTGTTTA (SEQ ID NO: 7);

[0069] Probe Allele 1: 5′-FAM-ACTTGACATCAGTTTGA-MGB-3′ (SEQ ID NO: 8);

[0070] Probe Allele 2: 5′-HEX-ACTTGACAACAGTTTGATA-MGB-3′ (SEQ ID NO: 9).

[0071] DNA from the test sample was extracted according to the method in Example 1. The qPCR reaction system was prepared as follows: 1 μL DNA sample, 9.5 μL sterile water, 12.5 μL Premix ExTaq, 0.5 μL each of forward and reverse primers (10 μmol / L), and 0.5 μL of probe (10 μmol / L). The qPCR amplification conditions were: 95°C for 30 seconds, followed by 95°C for 5 seconds and 65°C for 34 seconds, for 40 cycles. This process took only 50 minutes to complete.

[0072] To verify the accuracy of the Taqman probe, eight female and eight male northern subspecies largemouth bass were used for preliminary validation. SNP3 has three genotypes: homozygous TT, homozygous AA, and heterozygous AT. These genotypes are represented by three fluorescence patterns on the scatter plot. Probes for the TT and AA alleles were labeled with FAM (yellow, circles) and HEX (blue, squares), respectively. When the sample has the AA allele, only HEX fluorescence is detected during PCR amplification; when the sample has the TT allele, only FAM fluorescence is detected during PCR amplification; when the sample is heterozygous AT, both FAM and HEX fluorescence are detected during PCR amplification, resulting in a green fluorescence pattern (triangles). The results showed yellow scatter plots for all eight females, green scatter plots for six of the eight males, and blue scatter plots for two. The Taqman probe results were completely consistent with biological sex.

[0073] Example 4

[0074] 80 DNA samples of "Youyu No. 3" were used for further verification by Taqman real-time fluorescence PCR, and the method was the same as described in Example 3.

[0075] The Taqman real-time fluorescence PCR test results were completely consistent with the enzyme digestion results in Example 3. All female fish were yellow scattered spots, and all male fish were green and blue scattered spots. This method can quickly and accurately identify the sex of largemouth bass, and can accurately identify them across multiple populations.

[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A molecular marker associated with sex of largemouth bass, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

1. There is an A / T polymorphism at position 56 of the sequence shown in SEQ ID NO:

1. Female largemouth bass have a TT genotype, and male largemouth bass have an AT or AA genotype.

2. Use of a primer for detecting the molecular marker according to claim 1 in detecting the sex of largemouth bass, wherein the female largemouth bass has the TT genotype and the male largemouth bass has the AT or AA genotype.

3. The application according to claim 2, characterized in that: The primers include a forward primer whose nucleotide sequence is shown as SEQ ID NO: 2 and a reverse primer whose nucleotide sequence is shown as SEQ ID NO:

3.

4. A method for detecting the sex of largemouth bass, characterized in that: The following steps are involved: Extracting genomic DNA of the largemouth bass to be tested; The polymorphic sites of the molecular markers according to claim 1 in the genomic DNA are detected, and the sex of the largemouth bass to be tested is determined according to the detection results. The female largemouth bass has the TT genotype, and the male largemouth bass has the AT or AA genotype.

5. The method according to claim 4, characterized in that: The detection adopts restriction endonuclease TaaI digestion detection or Taqman probe detection.

6. The method according to claim 5, characterized in that Using the Taqman probe detection method, the qPCR product is used to determine the SNP genotype of the largemouth bass based on the fluorescent color of the probe: The sex of the largemouth bass is determined based on the specific genotype: The fluorescent color shows the TT genotype, and the largemouth bass being tested is judged to be female; The fluorescent colors showed the AT and AA genotypes, indicating that the largemouth bass being tested was male.

Citation Information

Patent Citations

  • Primers, kit and identification method for identifying Pagrosomus major, Acanthopagrus schlegeli and their hybrids

    CN106119377A

  • Micropterus salmoides sex specific SNP molecular marker primer and application thereof

    CN114574594A