Primers, probes, kits for detecting Xanthomonas, and method for rapidly detecting strawberry infected with Xanthomonas

Abstract

The present invention belongs to the technical field of germ detection, and discloses a primer for detecting Xanthomonas fragariae. The forward primer sequence of the primer pair is: The forward primer sequence of the primer pair is: 5′ ‑ GTATGTGAATTTCCGGTCATTCTGCCCACT‑ 3′; the reverse primer sequence is: 5′ ‑CACTTGCCGACAACACCTTTGCCATAGAG‑ 3′. The primer of the present invention has good specificity and does not cross-react with other fungi and bacteria. The kit composed of this primer can complete the on-site detection of Xanthomonas fragariae within 30 minutes, with a short detection time, low detection cost, and can be operated without professional personnel, and can be widely promoted at the grass-roots level.

Description

Technical Field

[0001] The present invention belongs to the technical field of pathogen detection, and relates to a primer, a probe, a kit for detecting Xanthomonas fragariae, and a method for rapidly detecting Xanthomonas fragariae-infected strawberries. Background Art

[0002] Strawberries (Fragaria×ananassa) are an important economic fruit. With the rapid development of strawberry cultivation and the diversification of cultivation modes, the types and incidence rates of strawberry diseases are increasing continuously, seriously affecting strawberry quality and causing economic losses. The common pathogens on strawberries are divided into three categories: fungi, bacteria, and viruses. Among them, Xanthomonas fragariae in bacteria is highly destructive to the strawberry industry.

[0003] Xanthomonas fragariae is a slow-growing Gram-negative bacterium, but it has strong pathogenicity. It can survive at a low density on strawberries, easily causing leaf angular spots and stem rot. However, infected plants do not show any symptoms in the initial stage. Over time, small water-soaked lesions form on the leaf surface of infected plants, expand and turn red or even necrotic. In severe cases, the infected part of the short stem shows cavities, resulting in a decline in plant vigor, lodging, and death of the entire plant, thus causing a significant loss in strawberry yield and huge economic losses. Due to the particularity of this pathogen, if reasonable control measures are not taken in the initial stage of disease occurrence, it will lead to huge losses after the strawberries are diseased. Therefore, it is necessary to detect Xanthomonas fragariae quickly, accurately, and sensitively at an early stage to avoid large-scale disease occurrence after transplanting.

[0004] In recent years, early detection technologies have developed rapidly, evolving from traditional visual inspection and antibody detection to current molecular detection, mainly polymerase chain reaction (PCR). This method has high specificity and sensitivity and is also the most important and widely used technology for detecting major strawberry diseases at present. To further improve the detection efficiency and sensitivity, real-time fluorescence PCR, nested PCR, etc. have been developed based on conventional PCR. However, these technologies all have certain defects. They require expensive equipment and highly professional technical personnel for operation, and the method steps are complex, resulting in a long consumption time, which limits their application in rapid pathogen detection. Therefore, developing a faster, easier-to-operate, and visual on-site detection method is crucial for the prevention of strawberry diseases. Summary of the Invention

[0005] The purpose of the present invention is to provide an RPA primer pair, a probe, and a kit for detecting Xanthomonas fragariae, which can complete the on-site detection of samples within 30 minutes, with a short detection time, low detection cost, and can be operated without professional personnel, and can be widely promoted at the grass-roots level.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] The present invention provides an RPA primer pair for detecting Xanthomonas fragariae, wherein the forward primer sequence of the primer pair is: 5′-GTATGTGAATTTCCGGTCATTCTGCCCACT-3′; and the reverse primer sequence is: 5′-CACTTGCCGACAACACCTTTGCCATAGAG-3′.

[0008] The present invention provides an RPA probe for detecting Xanthomonas fragariae, and the probe sequence is: 5′-GATTCTGAGCAATGCGTTGCTGACAGGCCGTAAAAGATTTGATGGT-3′.

[0009] The present invention provides an RPA kit for detecting Xanthomonas fragariae, and the kit includes the above-mentioned RPA primer pair, the above-mentioned RPA probe, RPA reaction components in the form of lyophilized powder, and an RPA reaction buffer.

[0010] The present invention also provides a method for rapidly detecting Xanthomonas fragariae-infected strawberries by using the above-mentioned kit, which includes the following steps: treating a sample to be tested with a nucleic acid releasing agent for 5 min as an RPA reaction nucleic acid template, preparing an RPA reaction system by using the kit and the template, performing isothermal amplification at 37°C - 39°C for 8 - 10 min, diluting 10 μL of the amplification product to 200 μL with ddH2O, taking 50 μL and dropping it into the sample application hole of a colloidal gold test strip for detection, observing the result of the test strip after 2 min. If two red bands of C line and T line or one red band of T line appear, it indicates that the sample to be tested is positive; if one red band of C line appears, it indicates that the sample to be tested is negative.

[0011] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0012] In the lateral flow dialysis-recombinase polymerase amplification technology (LF-RPA) method of the present invention, the primers have good specificity and do not cross-react with other fungi and bacteria.

[0013] The lateral flow dialysis-recombinase polymerase amplification technology (LF-RPA) method of the present invention can complete the detection of samples within 30 min, with a short detection time and better timeliness. Compared with the "Quarantine and Identification Method for Xanthomonas fragariae" GB / T 29429-2012, the detection cycle is greatly reduced, and the detection can be completed during the process of nursery stock trading, reducing the losses of farmers.

[0014] The method of the present invention, lateral flow chromatography-recombinase polymerase amplification technology (LF-RPA), is amplified at body temperature or natural temperature (35°C - 37°C), and the result detection is also carried out at room temperature. It does not need to be carried out in expensive indoor instruments, and the cost of a single detection is less than 100 yuan. Compared with the "Quarantine and Identification Method for Xanthomonas fragariae" GB / T 29429-2012, the detection cost is greatly saved and reduced.

[0015] The method of the present invention, lateral flow chromatography-recombinase polymerase amplification technology (LF-RPA), has a simple process and fewer operating steps. It does not require professional personnel, and grass-roots technicians can completely independently complete the detection task. Compared with the "Quarantine and Identification Method for Xanthomonas fragariae" GB / T 29429-2012, the technical requirements are greatly reduced.

[0016] The method of the present invention, lateral flow chromatography-recombinase polymerase amplification technology (LF-RPA), completes the detection through on-site sampling and processing, without going through processes such as pathogen purification, cultivation, and re-inoculation, and there is no risk of pathogen transmission and diffusion, which is friendly to biosafety.

[0017] The method of the present invention, lateral flow chromatography-recombinase polymerase amplification technology (LF-RPA), can be popularized on a large scale at the grass-roots level in the form of a kit. There is no problem of insufficient production capacity or detection conditions, and large-scale promotion can be achieved. Description of the Drawings

[0018] Figure 1 Gel electrophoresis results of amplification by 7 pairs of RPA primers designed for the present invention.

[0019] Figure 2 Gel electrophoresis results of full-length PCR amplification of the target gene of the present invention.

[0020] Figure 3 Detection results of RPA amplification test strips for different concentration gradients of the recombinant plasmid of the target gene of Xanthomonas fragariae with the RPA primer pair of the present invention.

[0021] Figure 4 PCR amplification results of different concentration gradients of the recombinant plasmid of the target gene of Xanthomonas fragariae with the PCR primer pair of the present invention.

[0022] Figure 5 Detection results of RPA amplification of total nucleic acids extracted from the rhizosphere and soil of strawberry samples infected with other major strawberry pathogens of the present invention.

[0023] Figure 6 RPA amplification results of 26 kinds of strawberry rhizosphere fungi and bacteria of the present invention. Detailed Embodiments

[0024] The following examples are used to illustrate the present invention, but not to limit the protection scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The test methods in the following examples are all conventional methods unless otherwise specified.

[0025] Example 1

[0026] 1. Source and culture of pathogenic bacteria

[0027] Collect strawberry plants showing symptoms caused by Xanthomonas from the strawberry base of Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences, Guancheng District, Zhengzhou City, Henan Province, and isolate the pathogenic bacteria from the rhizomes. Disinfect with 75% alcohol for 15 s, 2% sodium hypochlorite for 5 min, and rinse several times with sterile water. Then cut the diseased part into small pieces on sterilized filter paper and place them on SPA medium. Incubate in an inverted position in a 37 °C incubator for 3 - 5 days until round, slightly convex, viscous yellow colonies grow as candidates. After identification by 16S rDNA sequencing, continue the culture. All isolated pathogenic bacteria were isolated by the above method. Bacteria were cultured in LB and SPA media, and all fungi were cultured in PDA medium.

[0028] 2. Screening of specific genes and design of RPA primers

[0029] To obtain specific regions, genetic markers of the target pathogen were extracted from the metagenomics analysis software of the MetaPhlAn3 software package (http: / / huttenhower.sph.harvard.edu / metaphlan) on the Linux platform and compared with the NCBI database. Through sequence analysis (https: / / www.ncbinlm.nih.gov), conserved genes within the species and specific genes between species were confirmed. A total of 5 matching results were retrieved, namely A0A1Y6H9N8, A0A1Y6H7U2, A0A1Y6H7M8, A0A1Y6H3T1, and A0A1Y6H4M1.

[0030] The design of pathogenic bacteria-specific RPA primers was based on the 5 target gene sequences screened as templates. According to the instructions provided in the RPA guide (Twist Amp DNA Amplification Kit Combo Instruction Manual; TwistDx Ltd., Cambridge, UK), Primer5 software was used for design. Try to reduce the secondary structure as much as possible to avoid hairpins, homodimers, and heterodimers. The length of the RPA primers is 25 to 35 bp, the length range of the amplification products is 100 - 200 bp, try to avoid having multiple guanines (G) at the 5′ end, and the GC content of the primers is between 40% and 60%.

[0031] Add a Biotin label to the 5′ end of the reverse primer that meets the RPA amplification conditions, and design a probe according to the amplified sequence. Add 6-FAM to the 5′ end of the probe, add C3 Spacer to the 3′ end, and add dSpacer in the middle (Table 1). Both the primer and the probe were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). Another set of PCR primers was designed for comparison. The primer and probe list is shown in Table 1.

[0032] Table 1 Primer and probe sequences

[0033]

[0034] 3. Screening of RPA primers and cloning and sequencing of amplification products: Perform RPA amplification using the genomic DNA of Xanthomonas fragariae as a template. The operation steps are carried out according to the instructions of the RPA isothermal rapid amplification kit (basic type). Add 29.4 μL of A buffer, 2 μL of upstream primer, 2 μL of downstream primer, 12.1 μL of ddH2O, and 2 μL of DNA template to each dry powder reaction tube. Finally, add 2.5 μL of B buffer to the reaction tube and mix well. After mixing, quickly centrifuge the reaction solution to the bottom of the tube, and then immediately place the reaction tube in a constant temperature device and incubate at 39 °C for 30 min. After the reaction is completed, purify it using a purification kit (Nanjing Novozymes Co., Ltd.) and detect the amplification result by agarose gel electrophoresis. Purify the RPA amplification product with a single band and clone it into the pTOPO-TA / Blunt Vector plasmid vector for sequencing to verify the reliability of the amplification result.

[0035] The amplification results of the above 7 pairs of RPA primers are shown in the 2% agarose gel electrophoresis diagram, and the results are shown in Figure 1 , it can be seen that most of the primers amplified non-specific bands and are not suitable as primers for this experiment. For the XF-RPA-1 and XF-RPA-2 primer pairs, they have no specific bands, and the target bands are also very bright, with good amplification effects. However, no suitable probe site was found in the XF-RPA-2 sequence segment. Therefore, XF-RPA-1 was selected as the primer for the subsequent RPA amplification reaction, and A0A1Y6H4M1 was used as the target gene for subsequent experiments.

[0036] 4. Full-length amplification of the target gene and plasmid transformation

[0037] Use the XF-PCR-1 primer pair to amplify the genomic DNA of Xanthomonas fragariae isolated. The amplification product is shown in the 2% agarose gel electrophoresis diagram, and the results are shown in Figure 2。After purification, the target fragment was cloned into the pTOPO-TA / Blunt Vector plasmid vector. After the plasmid was transformed into Escherichia coli DH5α, it was cultured in liquid overnight. The plasmid was extracted using a plasmid extraction kit, and the concentration of the extraction product was calculated based on the size of the plasmid and the inserted fragment. Its concentration was serially diluted with ddH2O, and finally a plasmid concentration gradient of 1×10 0 copies / degree dilution, ×10 9 copies / μL was obtained and numbered 1-10.

[0038] 5. Sensitivity detection of lateral flow chromatography-recombinase polymerase amplification technology (LF-RPA): The sensitivity of conventional PCR was compared with LF-RPA determination. Sterile water was used as a negative control template, and recombinant plasmid serial dilutions of the A0A1Y6H4M1 gene were used as templates for amplification respectively.

[0039] PCR was carried out as follows: 25 μL of PCR amplification: 12.5 μL of MIX (Nanjing Novoprotein Co., Ltd.), 1 μL of primer-F, 1 μL of primer-R, 1 μL of template DNA, and 9.5 μL of sterile water. PCR amplification was denatured at 95°C for 30 s, annealed at 55°C for 30 s, and elongated at 72°C for 30 s for 35 cycles. The amplification products were subjected to agarose gel electrophoresis to determine their sensitivity.

[0040] RPA amplification detection was completed according to the instructions of the RNA isothermal rapid amplification kit (colloidal gold test strip type). 29.4 μL of A buffer, 2 μL of upstream primer, 2 μL of downstream primer, 0.6 μL of probe, 12.5 μL of ddH2O, and 1 μL of nucleic acid template were added to each dry powder reaction tube. Finally, 2.5 μL of B buffer was added to the reaction tube and mixed well. After mixing, the reaction solution was quickly centrifuged to the bottom of the tube, and then the reaction tube was immediately placed in a water bath at 37°C for incubation for 10 min; after the reaction, 10 μL was taken and added to a centrifuge tube containing 190 μL of ddH2O, mixed well, and then 50 μL was taken and dropped into the sample application hole of the colloidal gold test strip, and the results were judged by observing the quality control line and the detection line within 2 mins.

[0041] Result judgment:

[0042] Positive (+)

[0043] One red band appears on the test strip, located at the quality control line (C line); one red band, located at the detection line (T line). A positive result indicates that the sample contains the nucleic acid to be detected, and the quantity is ≥ the minimum detectable amount of the test strip.

[0044] Negative (-):

[0045] There is a red band on the control line (C line) of the test strip, and there is no band on the test line (T line) or the number is lower than the minimum detection amount of the test strip.

[0046] Figure 3 It is the result of RPA amplification of the concentration gradient template of the recombinant plasmid of primer pair XF-RPA-1 A0A1Y6H4M1. One red band (C line) in the figure indicates negative; two red bands (C line and T line) or one red band (T line) indicate positive, and the color depth represents the number of templates.

[0047] Figure 4 It is the result of PCR amplification of the concentration gradient template of the recombinant plasmid of primer pair XF-PCR A0A1Y6H4M1. The darkness and brightness in the figure represent the number of templates.

[0048] Figure 3 At 10 1 When a faint red band (T line) is visible, it indicates that the LF-RPA detection system can detect the pathogenic bacteria at a template concentration of 1×10 1 copies / μL; Figure 4 It is the PCR amplification of the concentration gradient template of the recombinant plasmid of primer pair XF-PCR A0A1Y6H4M1. Gel electrophoresis detection shows that there is only a faint band at 10 4 indicating that the PCR detection system can detect the pathogenic bacteria at a template concentration of 1×10 4 copies / μL. It shows that the LF-RPA detection system is 3 orders of magnitude more sensitive than the PCR detection system.

[0049] 6. Specific identification of lateral flow dialysis-recombinase polymerase amplification technology (LF-RPA)

[0050] Collect the main pathogenic bacteria of strawberries and other rhizosphere microorganisms for LF-RPA detection. Collect a variety of diseased plants from the nursery, isolate and purify the pathogenic bacteria. A total of 26 kinds of fungi and bacteria are obtained, as shown in Table 2. Extract DNA respectively, and use the XF-RPA-1 primer as the amplification template for the RPA reaction. The RPA amplification results are as Figure 5 shown, Figure 5 Among them, 1-14 are bacteria, 15-26 are fungi. One red line represents negative; two red lines represent positive. N is the negative control (sterile water), and P is the positive control (Xanthomonas fragariae).

[0051] The results show that there is only one red band (C line) on all the test strips in the detection group, indicating that the specificity of this primer is good and it does not cross-react with other fungi and bacteria.

[0052] Table 2 26 kinds of fungi and bacteria

[0053]

[0054]

[0055] Example 2

[0056] Angular leaf spot disease occurred in strawberries in a greenhouse in Jiaozuo area. To determine whether it was caused by Xanthomonas fragariae infection, Xanthomonas fragariae detection was carried out.

[0057] According to the distribution of diseased seedlings, 10 sampling points were selected in the greenhouse. For each sampling point, 1 - 2 g of strawberry plant leaves and 1 - 2 g of soil were taken respectively, mixed with an equal weight of sterile water, and the release of the pathogen was promoted by means of violent shaking or extrusion. Lysis was carried out at a usage ratio of sample∶LD - 1∶LD - 2 = 25∶4∶1, such as (100 μL∶16 μL∶4 μL); lysed at 40 °C for 5 min, and the supernatant was taken as the template for subsequent amplification; 29.4 μL of A buffer, 2 μL of upstream primer, 2 μL of downstream primer and 0.6 μL of probe were added to each dry powder reaction tube; 11.5 μL of ddH2O and 5 μL of nucleic acid template were added to the reaction tube in sequence; finally, 2.5 μL of B buffer was added to the reaction tube and mixed well; after mixing, the reaction solution was flicked to the bottom of the tube, and then the reaction tube was immediately placed in a constant temperature device and incubated at 37 - 39 °C for 8 - 12 min; after the reaction was completed, 10 μL was taken and added to a centrifuge tube containing 190 μL of ddH2O, mixed evenly, the sample end of the colloidal gold test strip was inserted into the centrifuge tube for equilibration, and the results of the quality control line and the test line were judged within 5 min.

[0058] The detection results of one of the sampling points are as Figure 6 shown: Two red lines (C line and T line) appeared in the detection of the leaf and soil sampling parts, indicating that both were infected with Xanthomonas fragariae. To reduce the loss of the greenhouse, the strawberry seedlings near the positive sampling points can be thinned, and the soil can be sprayed with pesticides to inhibit the reproduction of Xanthomonas fragariae.

[0059] The above - mentioned embodiments are only the preferred embodiments of the present invention, and are only used to explain the present invention, not to limit the scope of the present invention. For those skilled in the art of this technology, of course, according to the technical content disclosed in this specification, other implementation manners can be easily made by means of replacement or change. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. RPA kit for detecting Xanthomonas fragariae, characterized in that, The kit includes an RPA primer pair, an RPA probe, RPA reaction components in the form of lyophilized powder, and an RPA reaction buffer. The forward primer sequence of the RPA primer pair is: 5′-GTATGTGAATTTCCGGTCATTCTGCCCACT-3′; the reverse primer sequence is: 5′-CACTTGCCGACAACACCTTTGCCATAGAG-3′; the RPA probe sequence is: 5′-GATTCTGAGCAATGCGTTGCTGACAGGCCGTAAAAGATTTGATGGT-3′.

2. A method for rapidly detecting strawberry infected with Xanthomonas using the kit according to claim 1, characterized in that, It includes the following steps: Treat the sample to be tested with a nucleic acid releasing agent for 5 min as the RPA reaction nucleic acid template. Use the kit and the template to prepare an RPA reaction system, and perform isothermal amplification at 37°C - 39°C for 8 - 10 min. Take 10 μL of the amplification product and dilute it to 200 μL with ddH2O. Take 50 μL and drop it into the sample application hole of the colloidal gold test strip for detection. Observe the result of the test strip after 2 min. If two red bands of C line and T line or one red band of T line appear, it indicates that the sample to be tested is positive. If one red band of C line appears, it indicates that the sample to be tested is negative.

Images