CRISPR detection primer set for klebsiella pneumoniae and use thereof

By designing a CRISPR detection primer set for Klebsiella pneumoniae and combining CRISPR technology with RPA amplification, a rapid, highly specific, and highly sensitive detection of Klebsiella pneumoniae was achieved, solving the problems of long detection time, low sensitivity, and poor specificity in existing technologies, and making it suitable for on-site detection.

CN115927687BActive Publication Date: 2025-12-30SHANGHAI PULMONARY HOSPITAL (SHANGHAI OCCUPATIONAL DISEASE PREVENTION & CONTROL INSTITUTE)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211592750.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-13
Publication Date
2025-12-30
Estimated Expiration
2042-12-13

AI Technical Summary

Technical Problem

Existing technologies for detecting Klebsiella pneumoniae suffer from problems such as long detection time, low sensitivity, and poor specificity. In particular, the isolation and culture method requires 4 to 8 weeks, the smear staining and microscopic examination method has low sensitivity and poor specificity, the immunological diagnosis has a high false positive rate, and the molecular biological diagnosis lacks effective means of detecting amplified products.

Method used

A CRISPR detection primer set for Klebsiella pneumoniae was designed, combining CRISPR technology and RPA amplification. The Cas protein recognizes the target sequence and initiates cleavage activity under the guidance of guide RNA. A fluorescent reporter molecule is added to realize the conversion of sequence information. Two-stage amplification is performed by coupling RPA with the Cas protein, eliminating the dependence on precision instruments.

Benefits of technology

It achieves rapid, highly specific, and highly sensitive detection of Klebsiella pneumoniae within 90 minutes, with a detection capacity of 500 copies/mL. It has good specificity, is suitable for on-site testing, and does not rely on complex temperature-changing instruments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003995417310000041
    Figure BDA0003995417310000041
  • Figure HDA0003995417320000011
    Figure HDA0003995417320000011
  • Figure HDA0003995417320000012
    Figure HDA0003995417320000012
Patent Text Reader

Abstract

The application relates to a CRISPR detection primer group for Klebsiella pneumoniae and application thereof, and relates to the technical field of gene detection based on CRISPR technology. The CRISPR detection primer group for Klebsiella pneumoniae comprises an amplification primer pair and crRNA; the amplification primer pair is used for amplifying the conservative sequence of Klebsiella pneumoniae; the crRNA comprises an anchoring sequence and a guide sequence; the anchoring sequence is combined with a cas protein; and the guide sequence is matched with a target DNA fragment in the conservative sequence. By using the primer group, Klebsiella pneumoniae can be rapidly detected on site through the gene detection based on CRISPR technology, and the primer group has the advantages of high specificity, high sensitivity and simple operation.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of gene detection technology based on CRISPR technology, in particular to a CRISPR detection primer set for Klebsiella pneumoniae and application thereof. BACKGROUND

[0002] Klebsiella pneumoniae is a gram-negative bacillus, and the exudate in the lesion is thick and heavy, causing the interlobular space to sink. The bacteria have a capsule, and when they grow and reproduce in the alveoli, they cause tissue necrosis, liquefaction, and the formation of single or multiple abscesses. When the lesion involves the pleura and pericardium, it can cause exudative or purulent effusion. The fibrous tissue of the lesion is active and prone to organization; adhesion can occur early in the fibrous pleural effusion. In nosocomial sepsis, Klebsiella and Pseudomonas aeruginosa and Serratia are important pathogenic bacteria, and the mortality rate is high.

[0003] Currently, the diagnosis of Klebsiella pneumoniae mainly relies on the examination of the pathogen, and the commonly used methods are smear staining microscopy, isolation culture, immunodiagnosis and molecular biology diagnosis, etc. Among them, the isolation culture method is the gold standard, but the culture needs 4-8 weeks of time, which delays the clinical diagnosis and treatment. The smear staining microscopy method is simple and rapid, but the method has low sensitivity and poor specificity. Immunodiagnosis has poor specificity and high false positive rate due to the cross reaction between the existing antigens or antibodies and other microorganisms. Molecular biology diagnosis is rapid and sensitive, and the use of specific DNA fragments can distinguish Klebsiella pneumoniae species in vivo. In recent years, various isothermal amplification technologies such as LAMP, RPA, etc. have appeared, which can be used for on-site detection, but there are problems such as lack of effective amplification product detection means. Therefore, it is urgent to establish a simple, rapid and high-sensitivity detection technology that can be applied on site. SUMMARY

[0004] In view of the above problems, the present application provides a CRISPR detection primer set for Klebsiella pneumoniae, which can rapidly detect Klebsiella pneumoniae on site by gene detection technology based on CRISPR technology, and has the advantages of high specificity, high sensitivity and simple operation.

[0005] The present application provides a CRISPR detection primer set for Klebsiella pneumoniae, which comprises an amplification primer pair and a crRNA; the amplification primer pair is used to amplify the conserved sequence of Klebsiella pneumoniae; the crRNA comprises an anchor sequence and a guide sequence, the anchor sequence is combined with a cas protein, and the guide sequence is matched with a target DNA fragment in the conserved sequence.

[0006] The inventors design a crRNA sequence aiming at the conserved sequence of Klebsiella pneumoniae, and detect by using CRISPR technology. In the CRISPR Cas system, Cas protein initiates the collateral cleavage activity after recognizing the target sequence under the guidance of guide RNA. Meanwhile, a fluorescent reporter molecule is added in the system, which realizes the conversion of the sequence information to be detected to the fluorescent signal by using the collateral cleavage activity of Cas enzyme. Through the coupling of RPA and Cas protein, two-stage amplification of "sequence amplification" (completed by RPA) plus "enzymatic cascade" (completed by Cas enzyme) can be realized, so as to surpass the sensitivity of single-stage amplification of Q-PCR. In addition, because the RPA amplification method does not require complex temperature change, it is free from the dependence on precise instruments such as QPCR instrument, so that the CRISPR-Cas technology has broad application prospects in the field detection of Klebsiella pneumoniae.

[0007] In one of the embodiments, the conserved sequence is shown as SEQ ID NO: 1.

[0008] The inventors find that the conserved sequence shown as SEQ ID NO: 1 can be used for the detection of Klebsiella pneumoniae specifically, and can also realize the efficient detection of CRISPR technology through a large number of screening and comparison tests.

[0009] In one of the embodiments, the crRNA sequence is selected from SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

[0010] In one of the embodiments, the forward amplification primer in the amplification primer pair is selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8.

[0011] The reverse amplification primer in the amplification primer pair is selected from SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12.

[0012] In one of the embodiments, the crRNA sequence is shown as SEQ ID NO: 3.

[0013] The sequence shown as SEQ ID NO: 3 is selected as the crRNA sequence, and the guide sequence (i.e. the target sequence for detection) therein has a good detection effect.

[0014] In one of the embodiments, the forward amplification primer is shown as SEQ ID NO: 7, and the reverse amplification primer is shown as SEQ ID NO: 9.

[0015] The present inventors find that the RPA amplification by the above-mentioned amplification primer pair has better amplification efficiency and sensitivity in cooperation with the above-mentioned crRNA through a large number of experimental researches.

[0016] The present application also provides application of the CRISPR detection primer set for Klebsiella pneumoniae in development and / or preparation of products with the use of pneumonia diagnosis and / or prognosis evaluation.

[0017] The above-mentioned products can be a kit or an integrated detection device.

[0018] The present application also provides a kit for detecting Klebsiella pneumoniae, comprising the CRISPR detection primer set for Klebsiella pneumoniae.

[0019] In one embodiment, the cas12a protein and the signal reporter probe are further included.

[0020] In one embodiment, the cas12a protein is an Lbcas12a protein.

[0021] Compared with the prior art, the present application has the following beneficial effects:

[0022] The CRISPR detection primer set for Klebsiella pneumoniae of the present application is designed for the conserved sequence of Klebsiella pneumoniae, and uses the CRISPR technology for detection. In the CRISPR Cas system, the Cas protein recognizes the target sequence under the guidance of the guide RNA and initiates the "collateral cleavage" activity. At the same time, a fluorescent reporter molecule is added to the system, which realizes the conversion of the sequence information to be detected to the fluorescent signal by using the collateral cleavage activity of the Cas enzyme. Through the coupling of RPA and Cas protein, two-stage amplification of "sequence amplification" (completed by RPA) and "enzymatic cascade" (completed by Cas enzyme) can be realized, so as to surpass the sensitivity of single-stage amplification of Q-PCR. In addition, because the RPA amplification method does not require complex temperature change, it is free from the dependence on precise instruments such as QPCR instrument, so that the CRISPR-Cas technology has broad application prospects in the field diagnosis of Klebsiella pneumoniae.

[0023] Moreover, the present inventors also select the target sequence, design and screen the amplification primer and crRNA, and finally obtain the primer set which can be applied in clinic and has high amplification efficiency, good sensitivity and strong specificity. Compared with the traditional detection method, the CRISPR detection primer set of the present application shortens the detection time of Klebsiella pneumoniae, and can complete the detection within 90 min, and can detect 500 copies / mL of Klebsiella pneumoniae at the minimum, and has no amplification to other non-Klebsiella pneumoniae, has good specificity, and is suitable for the field detection of Klebsiella pneumoniae. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 Results of specificity screening in Example 1;

[0025] Figure 2 Results of orthogonal amplification efficiency screening in Example 1;

[0026] Figure 3 Results of sensitivity detection in Example 2;

[0027] Figure 4 Results of specificity detection in Example 3. DETAILED DESCRIPTION

[0028] In order to facilitate the understanding of the present application, the present application will be described in more detail below with reference to the relevant drawings. The preferred embodiments of the present application are shown in the drawings. However, the present application can be implemented in many different forms, and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application herein are only for the purpose of describing specific embodiments and are not intended to limit the present application.

[0030] The reagents, materials and equipment used in the present embodiment are commercially available unless otherwise specified. The experimental methods are conventional experimental methods in the art unless otherwise specified.

[0031] Example 1

[0032] Design and screening of CRISPR detection primer sequences of Klebsiella pneumoniae.

[0033] I. Selection of target sequence

[0034] Based on the previous research, the present inventors selected the conserved region sequence of Klebsiella pneumoniae as shown in SEQ ID NO: 1 as the target sequence after multiple screening and comparison, which can detect Klebsiella pneumoniae. The sequence of SEQ ID NO: 1 is as follows:

[0035] CGTGGCGTATTACGTTGAAGCCTCAACCCTGACCGAAGCGCAGTGGGCCGCGGTGGCG

[0036] GCGGAGCTGCACGACCGCATGATGGAGAGCGTCTTCGACGAGCTGGAAGCGGGCGAGA

[0037] AGCTGTTCGCTCACCATCAGCCGACGCCGGTCACCAGCGTCGACCTGCTGGGCGAAGG

[0038] GCGTCAGGCGCTGATTGACGCCAACCTCCGTCTGGGTCTGGCGCTGGCCGACGACGAA

[0039] ATTGACTACCTGCAGGACGCGTTTACCCGCCTGGGACGCAACCCGAACGATATCGAGCT

[0040] GTATATGTTCGCCCAGGCGAACTCAGAGCACTGTCGCCACAAGATTTTCAACGCCGACT

[0041] GGATCATCGACGGCGAACAGCAGCCGAAGTCGCTGTTCAAAATGATCAAAAACACCTTT

[0042] GAAAAAACGCCGGACTACGTGCTGTCGGCCTATAAAGATAATGCCGCGGTGATGGAAGG

[0043] GTCTGAAGTCGGGCGCTATTTCGCCGACCATCAGACCGGGCGCTACGACTTCCATCAGG

[0044] AGCCGGCGCACATTCTGATGAAGGTGGAAACCCATAACCACCCGACGGCCATCTCTCCA

[0045] TGGCCGGGCGCGGCAACCGGCTCCGGCGGCGAAATCCGCGATGAAGGCGCCACCGGCC

[0046] GCGGCGCGAAGCCGAAAGCGGGCCTGGTGGGCTTCTCGGTTTCCAACCTGCGTATCCCG

[0047] GGCTTCGAACAGCCGTGGGAAGAAGATTTCGGTAAACCGGATCGCATTGTCACCGCCCT

[0048] GGACATCATGACCGAAGGCCCGCTGGGCGGCGCGGCGTTTAACAACGAATTTGGTCGTCCGGCGCTGAACGGCTACTT.

[0049] II. Design of RPA amplification primers and crRNA sequences.

[0050] For the above-mentioned conserved sequences, a plurality of crRNA and RPA amplification primer pairs were designed, and some exemplary primer sequences are listed in the following table.

[0051] Table 1 crRNA and amplification primer pairs

[0052]

[0053] Note: The above crRNA-1, crRNA-2, crRNA-3 sequences are RNA sequences, in which T is the letter specification in WIPO Sequence list, which is uracil U.

[0054] III. Screening of sequences.

[0055] 1. Specific screening of the above-mentioned three crRNAs.

[0056] Specific operation of specific screening: a plasmid containing the target sequence of SEQ ID NO: 1 was synthesized (the plasmid was synthesized by General Biosystems (Anhui) Co., Ltd.), and the plasmid was diluted to a concentration of 100 pg / ul, 4 ul (1 uM) of crRNA-1, crRNA-2, crRNA-3 and negative control ddH20 were added into the crRNA specific screening reaction system, respectively, and the reaction system solution contained the following reagents: 18 ul peg aqueous solution (8%), 2 ul plasmid (100 pg / ul), 2 ul signal reporter probe (10 uM), 4 ul Lbcas12a protein (2 uM).

[0057] The results of specific screening are shown in Figure 1 crRNA-2 has the best specific recognition ability for the target sequence.

[0058] 2. Orthogonal amplification efficiency screening of the above-mentioned 4 forward amplification primers and 4 reverse amplification primers.

[0059] Specific operation of orthogonal amplification efficiency screening: the plasmid was diluted to a concentration of 10 ag / ul, four forward amplification primers and four reverse amplification primers were diluted to 10 uM, 1 ul of forward amplification primer and 1 ul of reverse amplification primer were paired to form 16 pairs of primer pairs, 2 ul of primer pairs were added into the amplification detection system, and the amplification detection system solution was: 2 ul of plasmid (10 ag / ul), 2 ul of signal report probe (10 uM), 4 ul of crRNA-1 (1 uM), 14.5 ul of RPA enzyme premix, 1.5 ul of mgAc (280 mM), and 4 ul of Lbcas12a protein (2 uM).

[0060] The results of orthogonal amplification efficiency screening are shown in Figure 2 The results show that the amplification efficiency of crRNA-2 combined with the amplification primer pair prime-F3 / R1 is the best.

[0061] That is, in the CRISPR detection primer group for Klebsiella pneumoniae in this embodiment, the selected crRNA sequence is crRNA-2: 5'-UAAUUUCUACUAAGUGUAGAUAUGGCCAGCGCCAGACCCAGACGGAGG UUGGC-3' (SEQ ID NO: 3);

[0062] The selected forward amplification primer is Prime-F3: 5'-GAGCTGGAAGCGGGCGAGAAGCTGTTCGCTCACC-3' (SEQ ID NO: 7);

[0063] The selected reverse amplification primer is Prime-R1: 5'-CCCAGGCGGGTAAACGCGTCCTGCAGGTAGT-3' (SEQ ID NO: 9).

[0064] Example 2

[0065] Sensitivity detection.

[0066] The plasmid in Example 1 was diluted with enzyme-free water to different concentrations, and the crRNA-2 sequence (SEQ ID NO: 3), Prime-F3 (SEQ ID NO: 7), and Prime-R1 (SEQ ID NO: 9) in Example 1 were selected for detection.

[0067] The results are shown in Figure 3 The CRISPR detection primer group of Example 1 can detect 500 copies / mL of Klebsiella pneumoniae at the lowest.

[0068] Example 3

[0069] Specificity detection.

[0070] Using the CRISPR detection primer set (crRNA-2 sequence + Prime-F3 + Prime-R1) in Example 1, the RPA amplification was performed on Klebsiella pneumoniae, Mycobacterium tuberculosis, Staphylococcus aureus, Shigella, Salmonella, Mycoplasma pneumoniae, Staphylococcus epidermidis, Streptococcus pyogenes, Candida albicans, Acinetobacter baumannii, Streptococcus pneumoniae and other common pathogenic bacteria, respectively, and Streptococcus pneumoniae was used as a negative control to detect the specificity of the method.

[0071] The results are shown in Table 1. Figure 4 As shown in Table 1, the method of the present application only amplifies Klebsiella pneumoniae samples, and does not amplify other non-Klebsiella pneumoniae samples, indicating that the CRISPR detection primer set of Example 1 has good specificity.

[0072] Example 4

[0073] A kit for rapid detection of Klebsiella pneumoniae.

[0074] The kit comprises the CRISPR detection primer set (crRNA-2, Prime-F3 and Prime-R1) for Klebsiella pneumoniae of Example 1, RPA enzyme premix, signal reporter probe, Lbcas12a protein, magnesium acetate, Tris-HCl, DTT.

[0075] The technical features of the above-described embodiments can be combined in any manner. In order to make the description concise, all possible combinations of the technical features in the above-described embodiments are not described, however, as long as the combinations of the technical features do not contradict, they should be considered as within the scope of the present disclosure.

[0076] The above-described embodiments only express several embodiments of the present application, which are described in more detail and in more detail, but should not be construed as limiting the scope of the patent. It should be noted that for those skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of protection of the present application should be subject to the appended claims.

Claims

1. A CRISPR detection primer set for Klebsiella pneumoniae, characterized by, comprise an amplification primer pair and a crRNA; the amplification primer pair is used to amplify a conserved sequence of Klebsiella pneumoniae; the conserved sequence is shown as SEQ ID NO: 1; the crRNA comprises an anchor sequence and a guide sequence, the anchor sequence is combined with a cas protein, and the guide sequence is matched with a target DNA fragment in the conserved sequence; the crRNA sequence is shown as SEQ ID NO: 3; the forward amplification primer in the amplification primer pair is shown as SEQ ID NO: 7, and the reverse amplification primer in the amplification primer pair is shown as SEQ ID NO:

9.

2. Use of the CRISPR detection primer set for Klebsiella pneumoniae in claim 1 in the preparation of a product for detecting Klebsiella pneumoniae.

3. A kit for detecting Klebsiella pneumoniae, characterized by, comprise the CRISPR detection primer set for Klebsiella pneumoniae in claim 1.

4. The kit for detecting Klebsiella pneumoniae according to claim 3, characterized by, Also comprise: a cas12a protein and a signal reporter probe.

5. The kit for detecting Klebsiella pneumoniae according to claim 4, characterized by, the cas12a protein is an Lbcas12a protein.

Citation Information

Patent Citations

  • Pathogen specific nucleic acid fragment and application thereof

    WO2022057854A1