Primer set for background screening of tobacco chromosome 19 for resistance to spotted wilt and its application

Abstract

The present invention belongs to the field of tobacco breeding, and relates to a primer set for screening the background of chromosome 19 of spotted wilt-resistant tobacco and its application. A PCR primer combination for screening the breeding background of spotted wilt-resistant tobacco is provided, including a first PCR primer set and / or a second PCR primer set; the first PCR primer set is composed of three primers with nucleotide sequences as shown in SEQ ID NO:1‑3; the second PCR primer set is composed of three primers with nucleotide sequences as shown in SEQ ID NO:4‑6; the spotted wilt-resistant tobacco is a hybrid and backcross offspring of a donor parent Polalta tobacco and a recipient parent K326 tobacco. The primer set of the present invention can be used for early generation screening of spotted wilt-resistant tobacco with a K326 tobacco background, greatly shortening the breeding cycle of K326 spotted wilt-resistant directional improvement, and improving breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the field of tobacco breeding, and relates to a primer set for identifying the genotypes of a donor parent Polalta and a backcross parent K326 in the backcross breeding process of spotted wilt-resistant tobacco, in particular to a primer set for background screening of chromosome 19 of spotted wilt-resistant tobacco and an application thereof in directional improvement of K326 tobacco resistance to spotted wilt or breeding of tobacco varieties resistant to spotted wilt. Background Art

[0002] In crop production, some excellent varieties have outstanding performance in many important traits such as yield and agronomy. However, due to the poor performance of individual traits (such as disease resistance and insect resistance), it is often difficult to fully realize the yield and quality potential, which restricts large-scale planting. Targeted variety improvement is to introduce excellent target traits from the donor to the recurrent parent through backcross breeding for individual defective traits of existing main varieties or special varieties, and maintain other excellent traits of the recurrent parent. It is an effective and important breeding method for breeders to improve a single or a few undesirable traits of a variety. The genetic background and other traits of the varieties after targeted improvement are consistent with the original excellent varieties, and they are upgraded versions of the original excellent varieties.

[0003] In modern breeding, molecular marker-assisted selection has greatly accelerated the process of directional improvement breeding. In particular, molecular marker-assisted backcross background selection can use molecular markers to select single plants with the same genome as the recurrent parent in the backcross offspring, which can reduce the backcross generations and achieve the purpose of directional improvement in a short generation. In theory, molecular marker-assisted backcross breeding is the fastest and best breeding program for directional improvement of single or multiple traits controlled by major effect genes. Compared with conventional backcross breeding directional improvement, molecular marker-assisted backcross background selection allows improved varieties to enter the market earlier.

[0004] Tobacco spotted wilt disease (TSWD) is a serious disease caused by infection by Orthotospoviruses. Tomato spotted wilt virus (TSWV) is a representative species of Orthotospoviruses. N.alata is a wild tobacco in the genus Nicotiana that has good resistance to TSWV and is the only available source of resistance to tobacco spotted wilt so far. Gajos et al. used N.otophora as a bridge parent and successfully transferred the spotted wilt resistance gene locus (RTSW locus, where RTSW is R esistance to TSWV (abbreviation for "V") was transferred from wild tobacco (N.alata) to cultivated tobacco (N.tabacumL.), and the breeding material 'Polalta' of spotted wilt-resistant tobacco was obtained. 'Polalta' is a European strain with dark air-cured tobacco pedigree, and has a large background difference from the flue-cured tobacco strains that dominate the Chinese and international markets. By hybridizing with Polalta as the male parent and the main flue-cured tobacco variety K326 as the female parent, although agronomic traits and spotted wilt-resistant tobacco with no significant differences from the main varieties can be obtained, there are still differences in metabolites and chemical components between the obtained spotted wilt-resistant tobacco and the main varieties, resulting in the risk that the style characteristics cannot fully meet the production needs of the flue-cured tobacco industry. In order to avoid this risk in the main flue-cured tobacco varieties improved for tobacco spotted wilt, it is necessary to use spotted wilt-resistant tobacco for backcross breeding to improve the spotted wilt resistance of the main flue-cured tobacco varieties in a targeted manner. Using molecular markers for backcrossing-assisted background selection can accelerate the process of targeted improvement of flue-cured tobacco resistance to spotted wilt.

[0005] Single nucleotide polymorphism (SNP) is widely distributed in the genome and is the most common form of genetic variation between plant individuals. Common single nucleotide polymorphisms include base substitution, transversion, insertion and deletion. Most of the SNPs widely distributed in the genome do not directly determine the phenotype, but because they are closely linked to the sites that determine the phenotype, they can be developed into important molecular markers. SNP has become one of the most ideal molecular markers for genetic research on complex traits in plants.

[0006] Competitive allele-specific PCR (KASP) is a method of typing SNPs by specifically matching the terminal bases of primers. The basic principle is that two primers with different terminal bases carry fluorescent linker sequences respectively. Based on the different fluorescent signals carried by the amplified products, a large number of samples can be quickly tested and their genotypes can be accurately determined. Since its launch, KASP technology has quickly seized the market with its ultra-high flexibility, accuracy and cost-effectiveness, and plays an important role in crop assisted breeding.

[0007] At present, there are no reports on the use of co-dominant KASP markers for background selection in backcross breeding of tobacco with resistance to spotted wilt. The development of co-dominant specific KASP molecular markers based on the foreground donor parent and the background backcross parent can quickly and accurately detect the background recovery rate of backcross single plants at low cost, high throughput and automation, and accelerate the directional improvement of the resistance of main flue-cured tobacco varieties to spotted wilt. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide a SNP marker, a primer combination and a method for background screening of chromosome 19 of tobacco resistant to spotted wilt, so as to promote the directional improvement of K326 tobacco resistant to spotted wilt.

[0009] In order to solve the above technical problems, the present invention provides a PCR primer combination for screening of tobacco breeding backgrounds for resistance to spotted wilt, which comprises a first PCR primer set and / or a second PCR primer set;

[0010] The first PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs: 1-3; the second PCR primer set consists of three primers whose nucleotide sequences are shown in SEQ ID NOs: 4-6;

[0011] The spotted wilt resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco;

[0012] The first PCR primer set is used to amplify the SNP site at 17952941 bp on chromosome 19 of tobacco, at which the genotype of Polalta tobacco is C and the genotype of K326 tobacco is T;

[0013] The second PCR primer set is used to amplify the SNP site at 18370027 bp on chromosome 19 of tobacco, at which the genotype of Polalta tobacco is C and the genotype of K326 tobacco is T;

[0014] The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.

[0015] The present invention also provides a KASP primer combination for screening of spotted wilt-resistant tobacco breeding backgrounds, which comprises a first KASP primer set and / or a second KASP primer set;

[0016] The first KASP primer set consists of three primers, F1-1, F1-2 and R1, wherein F1-1 is composed of a first tag sequence and a nucleotide sequence shown in SEQ ID NO:1 in series from the 5' end to the 3' end; F1-2 is composed of a second tag sequence and a nucleotide sequence shown in SEQ ID NO:2 in series from the 5' end to the 3' end; the nucleotide sequence of R1 is shown in SEQ ID NO:3;

[0017] The second KASP primer set consists of three primers, F2-1, F2-2 and R2, wherein F2-1 is composed of the first tag sequence and the nucleotide sequence shown in SEQ ID NO:4 in series from the 5' end to the 3' end; F2-2 is composed of the second tag sequence and the nucleotide sequence shown in SEQ ID NO:5 in series from the 5' end to the 3' end; the nucleotide sequence of R2 is shown in SEQ ID NO:6;

[0018] The nucleotide sequences of the first tag sequence and the second tag sequence are different and are not homologous to the tobacco genome sequence;

[0019] The spotted wilt resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco;

[0020] The first KASP primer set is used to amplify the SNP site at 17952941 bp on chromosome 19 of tobacco, at which the genotype of Polalta tobacco is C and the genotype of K326 tobacco is T;

[0021] The second KASP primer set is used to amplify the SNP site at 18370027 bp on chromosome 19 of tobacco, at which the genotype of Polalta tobacco is C and the genotype of K326 tobacco is T;

[0022] The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.

[0023] The present invention provides a kit, which comprises the above-mentioned PCR primer combination or the above-mentioned KASP primer combination.

[0024] In some embodiments of the present invention, the kit comprises the above-mentioned KASP primer combination and a PCR premix; the PCR premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe, and a second quenching probe;

[0025] The nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of the first tag sequence in the KASP primer set, and the 5' end of the first fluorescent probe is connected to the first fluorescent group; the nucleotide sequence of the first quenching probe is reverse complementary to the nucleotide sequence of the first tag sequence, and the 3' end of the first quenching probe is connected to the quenching group;

[0026] The nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of the second tag sequence in the KASP primer set, and its 5' end is connected to the second fluorescent group; the nucleotide sequence of the second quenching probe is reverse complementary to the nucleotide sequence of the second tag sequence, and its 3' end is connected to the quenching group.

[0027] In some embodiments of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM, and the second fluorescent group is HEX.

[0028] The use of the above PCR primer combination or the above KASP primer combination or the above kit in the breeding of tobacco resistant to spotted wilt also falls within the protection scope of the present invention.

[0029] The present invention provides a method for screening a tobacco breeding background resistant to spotted wilt, which comprises the following steps:

[0030] a) extracting DNA of tobacco resistant to spotted wilt;

[0031] b) using the above PCR primer set to perform PCR amplification on the DNA of the tobacco resistant to spotted wilt;

[0032] c) detecting the amplification results, determining the genotype of the SNP site amplified by each PCR primer set in the tobacco resistant to spotted wilt, and screening the tobacco resistant to spotted wilt whose SNP site is a K326 tobacco genotype;

[0033] The spotted wilt resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.

[0034] The present invention also provides a method for screening a tobacco breeding background resistant to spotted wilt, which comprises the following steps:

[0035] a) extracting DNA of tobacco resistant to spotted wilt;

[0036] b) adding the KASP primer set and PCR premix to the DNA of the spotted wilt-resistant tobacco to perform KASP amplification;

[0037] The PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe;

[0038] The nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of the first tag sequence in the KASP primer set, and the 5' end of the first fluorescent probe is connected to the first fluorescent group; the nucleotide sequence of the first quenching probe is reverse complementary to the nucleotide sequence of the first tag sequence, and the 3' end of the first quenching probe is connected to the quenching group;

[0039] The nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of the second tag sequence in the KASP primer set, and the 5' end of the second fluorescent probe is connected to the second fluorescent group; the nucleotide sequence of the second quenching probe is reverse complementary to the nucleotide sequence of the second tag sequence, and the 3' end of the second quenching probe is connected to the quenching group;

[0040] c) detecting the fluorescent signal, determining the genotype of the spotted wilt-resistant tobacco at the SNP site amplified by each KASP primer set, and screening the spotted wilt-resistant tobacco with the SNP site being the K326 tobacco genotype;

[0041] The spotted wilt resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.

[0042] In some embodiments of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM, and the second fluorescent group is HEX.

[0043] In some embodiments of the present invention, in the KASP amplification,

[0044] The PCR system includes: DNA template, KASP primer working solution and KASP-TF V4.0 2X Master Mix;

[0045] The PCR program was as follows: the first step, pre-denaturation at 95°C for 15 min; the second step, denaturation at 95°C for 20 s, 65-57°C (1°C decrease per cycle) for 60 s, for a total of 9 cycles; the third step, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for 32 cycles.

[0046] Experiments have proved that by using the KASP primer set developed by the present invention, PCR amplification is performed with the tobacco genome DNA to be tested as a template, and then genotyping of the PCR amplification product is performed by fluorescence signal detection. The genotyping result can be used to quickly and accurately screen the tobacco resistant to spotted wilt with the chromosome 19 background of the backcross parent K326 tobacco. By screening the SNP markers distributed continuously on a chromosome, it can be ensured that the entire chromosome contains only the backcross parent genotype. Compared with the conventional traditional marker screening, the SNP-KASP primer set developed by the present invention has the advantages of high accuracy, low cost, high detection efficiency, etc., and is suitable for large-scale screening of tobacco breeding resistant to spotted wilt. The identification method using the SNP-KASP primer set of the present invention can perform early generation screening on the breeding background of tobacco resistant to spotted wilt, greatly shorten the breeding cycle of the directional improvement of K326 tobacco resistant to spotted wilt, and improve the breeding efficiency.

[0047] The term "RTSW locus" or "spotted wilt resistance gene locus" used in the present invention refers to a DNA fragment containing the RTSW gene, which confers tobacco plant resistance to tobacco spotted wilt in either heterozygous or homozygous states. "RTSW gene" refers to a gene derived from the genome of Nicotiana alata (N. alata) and confers plant resistance to spotted wilt. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The results of SNP typing using the two SNP-KASP primer sets of the present invention. In the typing results of each primer set, the genotype of parent 1 is the typing after amplification of two Polalta homozygous recurrent parents, the genotype of parent 2 is the typing after amplification of two K326 homozygous donor parents, the heterozygous genotype is the typing after amplification of three Polalta×K326 hybrid F1 generations, and the negative genotype is ultrapure water without DNA.

[0049] Figure 2 The results of using the two SNP-KASP primer sets of the present invention to screen the chromosome 19 background of the offspring segregation population of spotted wilt resistant tobacco. In the typing results of each primer set, the sample in the dotted circle in the upper left corner is the Polalta homozygous genotype, the sample in the dotted circle in the lower right corner is the K326 homozygous genotype, the sample in the dotted circle in the middle diagonal position is the heterozygous type, and the sample in the dotted circle in the lower left corner is the unamplified sample. A total of 384 samples, including 376 DNA samples of spotted wilt resistant tobacco, 2 DNA samples of Polalta, 2 DNA samples of K326, 2 DNA samples of Polalta×K326 F1, and 2 ultrapure water without DNA added (as a negative control). DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments.

[0051] The specific techniques or conditions not specified in the following examples were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased.

[0052] Tobacco materials used in the following examples:

[0053] Polalta is a TSWV-resistant tobacco material containing a spotted wilt resistance gene locus (RTSW locus) and has been described in non-patent literature (Laskowska D, A,2010.TSWV resistance in DH lines of tobacco(Nicotianatabacum L.)obtained from a hybrid between'Polalta'and The public can obtain the tobacco material from tobacco germplasm resource conservation units.

[0054] K326 is a major flue-cured tobacco variety that does not contain a spotted wilt resistance locus (RTSW locus), which has been disclosed in non-patent literature (Edwards et al., 2017, A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. Bmc Genomics 18, 448.). The public can obtain its reference genome sequence from the website (https: / / solgenomics.net / organism / Nicotiana_tabacum / genome), and the tobacco material can be obtained from tobacco germplasm resource conservation units.

[0055] The F1 plants obtained by hybridizing Polalta (♂) and K326 (♀) (K326×Polalta F1), the segregation population obtained by backcrossing K326×Polalta F1 (♂) and K326 (♀) for 7 generations (K326×Polalta BC7F1), the spotted wilt-resistant tobacco with no linkage drag screened from K326×Polalta BC7F1 (single plant No. 12, with a genotype of RTSW / rtsw), and the segregation population (K326×Polalta BC8F1) obtained by backcrossing single plant No. 12 (♂) and K326 (♀) for one generation were all created by our research group and preserved in Yunnan Tobacco Agricultural Science Research Institute. Among them, the screening process of spotted wilt-resistant tobacco (single plant No. 12) can be found in the international patent application with application number PCT / CN2021 / 129382, invention name "Spotted wilt-resistant tobacco plants without linkage drag and breeding methods thereof", and the Chinese patent application with application number 202111311707.0, invention name "Molecular markers for screening spotted wilt-resistant tobacco plants without linkage drag and their applications", and the entire contents of these two patent applications are hereby incorporated into this article by reference. The results of the previous study showed that the agronomic traits of spotted wilt-resistant tobacco that broke the linkage drag were not significantly different from those of K326, and could be used for spotted wilt-resistant tobacco breeding, officially entering the commercial breeding process.

[0056] The main reagents used in the following examples are:

[0057] KASP-TF V4.0 2X Master Mix reagent (Cat. No. LGC-KBS-1050-132) was purchased from LGCBiosearch. Magnetic bead-based universal genomic DNA extraction kit (Cat. No. DP705) was purchased from Tiangen Biochemical Technology Co., Ltd.

[0058] Example 1. Obtaining SNP markers for screening tobacco breeding backgrounds for resistance to spotted wilt

[0059] In order to obtain spotted wilt-resistant tobacco from the hybridization and backcrossing of Polalta (♂) and K326 (♀) with a chromosome background as consistent as possible with K326 except for the RTSW locus, it is necessary to develop SNP markers for the screening of spotted wilt-resistant tobacco breeding background. Therefore, we used the donor parent Polalta, the recipient parent K326, and the spotted wilt-resistant tobacco obtained earlier for marker development.

[0060] We performed whole genome resequencing on Polalta, K326, and spotted wilt-resistant tobacco (single plant No. 12). The sequencing platform of the project was BGISEQ-500, and the sequencing strategy was PE100. By filtering the raw data, comparing the reference genome of cultivated tobacco, and detecting SNP variation information, the SNPs of the two parents (K326 and Polalta) were filtered, and a total of 50,009 high-quality (GQ (quality value) >= 40) SNPs between the two parents were obtained, which were distributed on all 24 chromosomes (Table 1).

[0061] Table 1 SNP distribution of the two parents and single plant No. 12

[0062]

[0063] The results of resequencing SNP analysis of single plant No. 12 showed that most of the SNP sites were heterozygous, and the SNP genotype characteristics were consistent with the characteristics of backcrossing. After 7 generations of backcrossing, more than 97% of the sites in the genome were consistent with the backcross parent K326. In addition to the 106 SNP heterozygous sites containing the RTSW site on chromosome 12 (chr12), there were 1257 SNP homozygous or heterozygous sites that were consistent with the donor parent Polalta, which required the design of markers for screening in the next step of the segregation population.

[0064] The resequencing results showed that the end of chromosome 19 (chr19) contained dense donor parent-derived fragments, and 45 high-confidence SNP sites were continuously distributed at 17396776-26306695 bp on chromosome 19, with a size of approximately 9 Mb (Table 2).

[0065] Table 2 Distribution of SNP sites on chr19

[0066]

[0067]

[0068] In the table, R, M, Y, W, K, and S represent heterozygous genotypes, specifically, R = A / G, M = A / C, Y = C / T, W = A / T, K = G / T, and S = C / G. The location of the SNP site on chromosome 19 was determined based on the whole genome sequence of K326 tobacco. The whole genome sequence of K326 tobacco can be found at https: / / solgenomics.net / organism / Nicotiana_tabacum / genome.

[0069] In order to screen exchange plants from the segregating population and ultimately obtain plants containing only the recurrent parent K326 background in this segment, we selected 9 SNP loci and designed the SNP-KASP primer set.

[0070] The nine groups of SNP-KASP primers were screened using two homozygous parents (K326 and Polalta) and the F1 plants obtained by their hybridization, with ultrapure water without DNA added as a negative control. The steps are as follows:

[0071] Preparation of KASP primer working solution: Take 12 μL (100 μM) of each upstream primer (first upstream primer, second upstream primer) and 30 μL (100 μM) of downstream primer, add sterile ultrapure water to 100 μL, mix well, and use as KASP primer working solution.

[0072] PCR system: 2 μL DNA template (about 30 ng / μL), 0.08 μL KASP primer working solution, 2.5 μL KASP-TF V4.0 2X Master Mix (LGC, catalog number LGC-KBS-1050-132), and add sterile ultrapure water to 5 μL.

[0073] PCR program: the first step, pre-denaturation at 95°C for 15 min; the second step, denaturation at 95°C for 20 s, 65-57°C (1°C decrease per cycle) for 60 s, for a total of 9 cycles; the third step, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for 32 cycles; and storage at 10°C.

[0074] A blank control (NTC) without adding DNA template to the PCR system was set up in the experiment, and one blank control was set up for each primer set.

[0075] The PCR results are as follows: After the reaction is completed, a fluorescent microplate detector (FLUOstar OPTIMA, BMGLabtech, Germany) is used to perform fluorescence amplification on the obtained amplified product, and the SNPviewer software is used to read the fluorescence signal data and determine the genotype. If the fluorescence signal data of the amplified product of the tobacco to be tested is blue near the X-axis after analysis by the SNPviewer software, the genotype of the tobacco to be tested is the K326 parent type; if the fluorescence signal data of the amplified product of the tobacco to be tested is red near the Y-axis after analysis by the SNPviewer software, the genotype of the tobacco to be tested is the Polalta parent type; if the fluorescence signal data of the amplified product of the tobacco to be tested is green near the diagonal after analysis by the SNPviewer software, the genotype of the tobacco to be tested is a heterozygous type; the fluorescence signal data of the amplified product of the negative control is black near the origin after analysis by the SNPviewer software.

[0076] The optimal combination of screening SNP typing results that are consistent with the genotype, good typing effect, and uniformly distributed on the chromosome was selected. Finally, two SNP markers were determined for the background screening of chromosome 19 of tobacco with resistance to spotted wilt. The basic information of the KASP primer sets used to detect these two SNP markers is shown in Table 3. The results of SNP genotyping using the two KASP primer sets are shown in Table 3. Figure 1 shown.

[0077] Table 3 SNP-KASP primer sets for chr19 chromosome background selection

[0078]

[0079] The SNP-KASP primer combination for chr19 chromosome background selection consists of two primer sets, respectively referred to as SNP-KASP primer set 1 and SNP-KASP primer set 2. Each primer set consists of three primers, including a first upstream primer, a second upstream primer and a downstream primer, for amplifying a SNP site. The last base at the 3' end of the first upstream primer is the SNP genotype of K326, and the genotype is represented by capital letters in the brackets of the primer name; the last base at the 3' end of the second upstream primer is the SNP genotype of Polalta, and the genotype is represented by lowercase letters in the brackets of the primer name. In each primer set, the 5' end of the first upstream primer contains a FAM fluorescent label sequence (GAAGGTGACCAAGTTCATGCT) (SEQ ID NO: 11), and the 5' end of the second upstream primer contains a HEX fluorescent label sequence (GAAGGTCGGAGTCAACGGATT) (SEQ ID NO: 12). The fluorescent tag sequences in the primers are highlighted with underlines in Table 3, and the sequences without underlines are genome-specific sequences. The numbers in the primer names indicate the positions of the SNP sites amplified by the primer set on chromosome 19. Among them, SNP-KASP primer set 1 amplifies the SNP site at 17952941bp on chromosome 19, and SNP-KASP primer set 2 amplifies the SNP site at 18370027bp on chromosome 19. The positions of the above SNP sites on chromosomes are determined based on the whole genome sequence of K326 tobacco. The whole genome sequence of K326 tobacco can be found at https: / / solgenomics.net / organism / Nicotiana_tabacum / genome.

[0080] Example 2. Validation of SNP markers for screening tobacco breeding backgrounds for resistance to spotted wilt

[0081] The SNP markers obtained in Example 1 for the background screening of tobacco chromosome 19 for resistance to spotted wilt disease were verified using the segregating population BC1F1 of single plant No. 12 obtained by backcrossing single plant No. 12 with K326 (ie, K326×PolaltaBC8F1).

[0082] First, plants containing RTSW loci were screened from the K326×Polalta BC8F1 segregation population. Using the avirulent gene infiltration identification method we established earlier, 800 individual plants from the K326×Polalta BC8F1 segregation population were identified for spotted wilt resistance. The avirulent gene infiltration identification method is a method for identifying tobacco resistance using the tomato spotted wilt virus NSm gene as described in a Chinese patent (patent number ZL201710414755.X, invention name "A method for identifying tobacco resistance using the tomato spotted wilt virus NSm gene"), and the entire contents of the patent are hereby incorporated herein by reference. The specific steps are:

[0083] (1) Agrobacterium EHA105 containing the non-toxic gene NSm expression vector was cultured in Agrobacterium tumefaciens culture medium LB at 28°C for 24 hours, the cells were collected by centrifugation, and then diluted with infiltration buffer (10 mmol / L MgCl2, 10 mmol / L MES, 200 μmol / L acetosyringone) to a cell suspension with OD600 = 0.5;

[0084] (2) Using a sterile syringe without a needle, inject 9.5-10.5 μl of the bacterial suspension from the back of the tobacco plant into the interveinal space to form a visible infiltration spot; place the inoculated tobacco plant in an environment of 20-28°C and 80% humidity, alternating between 16 hours of continuous light and 8 hours of continuous darkness, and observe for a total of 72 hours.

[0085] (3) Observation: If the tobacco test host produces a hypersensitive reaction (HR) induced by the identified strain containing the non-toxic gene NSm expression vector, it is confirmed that the tobacco test host is a disease-resistant variety relative to the non-toxic gene NSm.

[0086] The results of NSm-mediated disease resistance identification showed that 415 out of 800 plants in the K326×Polalta BC8F1 segregation population produced HR reactions and were TSWV-resistant plants (indicated by RTSW), 380 plants had no HR reactions and were TSWV-susceptible plants (indicated by rtsw), and the other 5 plants were not included in the statistics because they were too small to be suitable for HR detection.

[0087] We selected 376 plants from 415 HR-positive plants and extracted the total DNA of each plant using a universal genomic DNA extraction kit using magnetic beads (Tiangen Biochemical Technology Co., Ltd., DP705). We used the previously developed spotted wilt resistance marker NaChr3_59M (see international patent application number PCT / CN2021 / 129382 and Chinese patent application number 202111311707.0) to verify the results of NSm-mediated disease resistance identification. The results showed that only three of the 376 plants were inconsistent with the NSm-mediated disease resistance identification results, and the accuracy of the NSm-mediated disease resistance identification method was greater than 99.2%.

[0088] The two SNP-KASP primer sets shown in Table 3 of Example 1 were used to perform KASP detection on the DNA of 376 HR-positive plants, with two homozygous parents (K326 and Polalta) and the F1 generation plants obtained by hybridization as controls, and ultrapure water without DNA added as a negative control. The KASP detection method was the same as in Example 1. The detection results are shown in Tables 4 and Figure 2 shown.

[0089] Table 4 SNP genotyping results of tobacco resistant to spotted wilt

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098] In the table, numbers 1-376 are DNA samples of 376 HR-positive plants, numbers 377 and 378 are DNA samples of Polalta, numbers 379 and 380 are DNA samples of K326, numbers 381 and 382 are DNA samples of Polalta×K326 F1, and numbers 383 and 384 are ultrapure water without DNA added (negative control). A represents the homozygous genotype of Polalta; B represents the homozygous genotype of K326; H represents the heterozygous type; N represents negative; "?" represents that the sample was not amplified. Pos represents positive, and Neg represents negative.

[0099] The results showed that 94 strains of K326 homozygous genotype and 274 strains of heterozygous genotype were screened from 376 strains of the segregated population using two SNP-KASP primer sets. The detection results of SNP-KASP primer set 1 and SNP-KASP primer set 2 were basically consistent, and the two markers in the same segment verified each other with high accuracy.

[0100] In order to verify the accuracy of SNP markers, we selected 6 strains (numbered 11, 17, 24, 30, 102, and 109) for resequencing. The sequencing platform of the project was BGISEQ-500, and the sequencing strategy was PE100. By filtering the raw data, aligning the reference genome of cultivated tobacco, and detecting SNP variation information, the obtained resequencing data was aligned to the high-quality SNPs between the parents for filtering, and the number of SNPs on chr19 of the 6 individual strains was obtained (Table 5).

[0101] Table 5 Resequencing results of 6 strains identified by SNP-KASP primer set

[0102] Number of SNPs on chr19 Single Plant No. 12 45 Single plant 12BC1F1-11 2 Individual plant 12BC1F1-17 40 Individual plant 12BC1F1-24 45 Single plant 12BC1F1-30 3 Single plant 12BC1F1-102 3 Individual plant 12BC1F1-109 44

[0103] The results showed that the number of SNPs on chromosome chr19 that were consistent with the donor parent Polalta was greatly reduced in 3 of the 6 strains screened (strains 11, 30, and 102). The remaining individual SNPs may be errors caused by sequencing or background noise in the genomic SNP analysis itself. Therefore, it can be determined that the entire chr19 chromosome of the backcross strain obtained by screening with the SNP-KASP primer set of the present invention is completely consistent with the backcross parent K326. The resequencing results of the other three strains (strains 17, 24, and 109) showed a heterozygous genotype, which was consistent with the detection results of SNP-KASP primer set 1 and SNP-KASP primer set 2, and the number of SNPs in this section on the three strains was not significantly different from that of strain 12, indicating that no exchange and recombination events occurred here.

[0104] It can be seen that the SNP-KASP primer set developed by the present invention can effectively screen out tobacco resistant to spotted wilt with the chromosome 19 background of the backcross parent K326, has the advantages of reliability, simplicity and practicality, has important application prospects in the evaluation of tobacco germplasm resources and the auxiliary selection of breeding markers, and also provides a reference for breeding directed improved tobacco varieties with high resistance to spotted wilt.

[0105] The above embodiments are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A PCR primer combination for screening of tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: comprising a first PCR primer set and a second PCR primer set; The first PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NOs: 1-3; the second PCR primer set consists of three primers with nucleotide sequences as shown in SEQ ID NOs: 4-6; The spotted wilt resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco; The first PCR primer set is used to amplify the SNP site at 17952941 bp on chromosome 19 of tobacco, at which the genotype of Polalta tobacco is C and the genotype of K326 tobacco is T; The second PCR primer set is used to amplify the SNP site at 18370027 bp on chromosome 19 of tobacco, at which the genotype of Polalta tobacco is C and the genotype of K326 tobacco is T; The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.

2. A KASP primer combination for screening of tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: comprising a first KASP primer set and a second KASP primer set; The first KASP primer set consists of three primers: F1-1, F1-2 and R1, wherein the nucleotide sequence of F1-1 is shown in SEQ ID NO:7; the nucleotide sequence of F1-2 is shown in SEQ ID NO:8; the nucleotide sequence of R1 is shown in SEQ ID NO:3; The second KASP primer set consists of three primers: F2-1, F2-2 and R2, wherein the nucleotide sequence of F2-1 is shown in SEQ ID NO:9; the nucleotide sequence of F2-2 is shown in SEQ ID NO:10; and the nucleotide sequence of R2 is shown in SEQ ID NO:6; The spotted wilt resistant tobacco is a hybrid and backcross offspring of the donor parent Polalta tobacco and the recipient parent K326 tobacco; The first KASP primer set is used to amplify the SNP site at 17952941 bp on chromosome 19 of tobacco, at which the genotype of Polalta tobacco is C and the genotype of K326 tobacco is T; The second KASP primer set is used to amplify the SNP site at 18370027 bp on chromosome 19 of tobacco, at which the genotype of Polalta tobacco is C and the genotype of K326 tobacco is T; The location of the SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco.

3. A kit, characterized in that: Comprising the PCR primer combination according to claim 1.

4. A kit, characterized in that: The kit comprises the KASP primer combination and a PCR premix according to claim 2; the PCR premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe; The nucleotide sequence of the first fluorescent probe is as shown in SEQ ID NO: 11, and the 5' end thereof is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first fluorescent probe, and the 3' end thereof is connected to the quencher group; The nucleotide sequence of the second fluorescent probe is shown in SEQ ID NO: 12, and its 5' end is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, and its 3' end is connected to the quencher group.

5. The kit according to claim 4, characterized in that The first fluorescent group is FAM, and the second fluorescent group is HEX.

6. Use of the PCR primer combination according to claim 1, the KASP primer combination according to claim 2, or the kit according to any one of claims 3 to 5 in breeding tobacco resistant to spotted wilt.

7. A method for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: The following steps are involved: a) extracting DNA of tobacco resistant to spotted wilt; b) using the PCR primer set described in claim 1 to perform PCR amplification on the DNA of the tobacco resistant to spotted wilt; c) detecting the amplification results, determining the genotype of the SNP site amplified by each PCR primer set in the tobacco resistant to spotted wilt, and screening the tobacco resistant to spotted wilt whose SNP site is a K326 tobacco genotype; The spotted wilt resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.

8. A method for screening tobacco breeding backgrounds for resistance to spotted wilt, characterized in that: The following steps are involved: a) extracting DNA of tobacco resistant to spotted wilt; b) adding the KASP primer set and PCR premix as claimed in claim 2 to the DNA of the spotted wilt-resistant tobacco to perform KASP amplification; The PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe; The nucleotide sequence of the first fluorescent probe is as shown in SEQ ID NO: 11, and the 5' end thereof is connected to the first fluorescent group; the nucleotide sequence of the first quencher probe is reverse complementary to the nucleotide sequence of the first fluorescent probe, and the 3' end thereof is connected to the quencher group; The nucleotide sequence of the second fluorescent probe is as shown in SEQ ID NO: 12, and the 5' end thereof is connected to the second fluorescent group; the nucleotide sequence of the second quencher probe is reverse complementary to the nucleotide sequence of the second fluorescent probe, and the 3' end thereof is connected to the quencher group; c) detecting the fluorescent signal, determining the genotype of the spotted wilt-resistant tobacco at the SNP site amplified by each KASP primer set, and screening the spotted wilt-resistant tobacco with the SNP site being the K326 tobacco genotype; The spotted wilt resistant tobacco is a hybrid and backcross offspring of a donor parent, Polalta tobacco, and a recipient parent, K326 tobacco.

9. The method according to claim 8, characterized in that The first fluorescent group is FAM, and the second fluorescent group is HEX.

10. The method according to claim 8, characterized in that In the KASP amplification, The PCR system includes: DNA template, KASP primer working solution and KASP-TF V4.0 2X Master Mix; The PCR program was as follows: the first step, pre-denaturation at 95°C for 15 min; the second step, denaturation at 95°C for 20 s, 65-57°C for 60 s, for a total of 9 cycles, with a decrease of 1°C in each cycle; the third step, denaturation at 95°C for 20 s, annealing at 57°C for 1 min, for 32 cycles.

Images