Lactuca oleracea resistance SG01

Abstract

The present invention relates to novel lettuce plants that exhibit resistance to Acidis rapae. The present invention also relates to seeds and parts of said plants, such as leaves and heads. The present invention further relates to methods of making and using such seeds and plants. The present invention also relates to novel gene sequences associated with said resistance to Acidis rapae, and to molecular markers associated with said novel gene sequences.

Description

Technical Field

[0001] The present invention relates to novel lettuce plants that exhibit resistance to Bremia lactucae. The present invention also relates to seeds and parts of said plants, such as leaves and heads. The present invention further relates to methods of making and using such seeds and plants. The present invention also relates to novel gene sequences associated with said resistance to Bremia lactucae, and to molecular markers associated with said novel gene sequences. Background Art

[0002] Plant pathogens are known to cause considerable damage to important crops, resulting in significant agricultural losses with wide-ranging consequences for both the food supply and other industries that rely on plant materials. Thus, there has long been a need to reduce the incidence of agricultural pests and / or their impact on crop production.

[0003] The example of such pathogen is the fungus B. lactucae, which causes downy mildew. B. lactucae occurs worldwide and is a big problem for both the yield and quality of cultivated lettuce (Lactuca sativa). The fungus can infect lettuce plants at any stage of growth, after which the initial symptoms of downy mildew appear as chlorotic yellow spots on the leaf surface. Within 24 to 48 hours, white velvety fungal growth appears on the lower leaf surface as an indication of sporulation. During infection, the lesion spots become larger and more chlorotic until the leaves become completely brown.

[0004] L. lettuce belongs to the oomycete group, which is a relatively primitive class of fungi. Other members of this group are, for example, Pythium and Phytophthora. L. lettuce contains different physiological species ("physios"), is a very variable pathogen, and is host-specific. During the sporulation process before L. lettuce reproduction, new physiological species appear relatively frequently through mutations of avirulence genes.

[0005] Within the genus Lactucae, to which cultivated lettuce (L. sativa) belongs, there are a number of known resistances to D. sativa. These resistances are usually race-specific and based on a mass gene known as the Dm (downy mildew) resistance gene. The resistance mechanism is known as a gene-for-gene mechanism, which is based on a specific interaction (HR reaction) between the product of the Dm resistance gene and a pathogen-specific avirulence gene, which results in resistance in lettuce plants.

[0006] Due to the high variability of A. putida and the frequent emergence of new physiological species, the race-specific resistance mediated by various Dm resistance genes can be rapidly broken by newly emerging physiological species of the A. putida pathogen.

[0007] There remains a need for new resistances against the fungal pathogen Ulmus putida, and in particular, broad-spectrum resistance against this fungal pathogen. Summary of the invention

[0008] The present invention addresses the need for additional and improved resistance to Bremia of lettuce by providing novel lettuce plants, and parts and seeds thereof, comprising a Bremia resistance trait designated as "SG01." Also provided are nucleic acid markers for identifying and producing lettuce plants (e.g., lettuce plants) and parts and seeds thereof comprising a Bremia resistance trait. In a particular embodiment, the present invention discloses a novel source of resistance to Bremia: CGN23091, a wild Lactuca serriola accession number. Qualitative Bremia resistance is conferred to cultivated lettuce plants (e.g., lettuce) by introgressing sequences conferring Bremia resistance from a wild source into cultivated lettuce plants (e.g., lettuce). The introgressed sequence conferring Bremia resistance located on chromosome 2 is dominant in nature; therefore, one copy of the sequence provides a Bremia resistance phenotype.

[0009] In summary, the characteristics of the scutellaria resistant lettuce plants disclosed within the present invention provide lettuce growers with novel solutions to enhance economic and commercial efficiency when deploying lettuce varieties in fields where scutellaria pressure is present. In addition, as is well known to those skilled in the art, the new scutellaria resistance can be stacked with other scutellaria resistance in a single plant and can provide an improved resistance spectrum against multiple species / isolates, prevent the emergence of new species / isolates, and can delay the breakdown of existing scutellaria resistance.

[0010] In a first embodiment, the invention provides a lettuce plant (e.g., a cultivated lettuce plant, such as a lettuce plant) resistant to L. lettuce, the plant comprising an introgression sequence from Lactuca oleracea, the introgression sequence conferring qualitative and dominant resistance to L. lettuce, wherein the introgression sequence is contained in Lactuca oleracea Accession No. CGN23091 or in Lactuca oleracea line 18LEN002364, and wherein the introgression sequence is located on chromosome 2 and comprises one or more of the following SNP markers:

[0011] a) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0012] b) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0013] c) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0014] d) C genotype of SNP marker SL1883 in SEQ ID NO:16 in heterozygous or homozygous state.

[0015] In another embodiment, the invention provides a lettuce plant (e.g., a cultivated lettuce plant, such as a lettuce plant) with enhanced resistance to L. lettuce, the plant comprising an introgression sequence from Lactuca sativa that confers qualitative and dominant resistance to L. lettuce, wherein the introgression sequence is contained in Lactuca sativa Accession No. CGN23091 or in Lactuca sativa line 18LEN002364, and wherein the introgression sequence is located on chromosome 2 and comprises one or more of the following SNP markers:

[0016] a) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0017] b) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0018] c) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0019] d) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state;

[0020] Wherein the lettuce plant has increased resistance to Pseudomonas aeruginosa compared to a control lettuce plant (eg, a lettuce plant) not comprising the introgressed sequence.

[0021] In a representative embodiment:

[0022] a) The G genotype of marker SL1831 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 2 and reverse primer SEQ ID NO: 5, and probe SEQ ID NO: 3;

[0023] b) the A genotype of the SNP marker SL1847 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 7 and reverse primer SEQ ID NO: 10, and probe SEQ ID NO: 8;

[0024] c) the G genotype of SNP marker SL1887 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 12 and reverse primer SEQ ID NO: 15, and probe SEQ ID NO: 13; and

[0025] d) The C genotype of SNP marker SL1883 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO:17 and reverse primer SEQ ID NO:20, and probe SEQ ID NO:18.

[0026] In an embodiment, the plant according to the invention is a cultivated plant.

[0027] In an embodiment, the gene introgression sequence of the present invention comprises one or more of the following: SEQ ID NO:1, which has a resistance marker allele represented by nucleotide G at position 112; SEQ ID NO:6, which has a resistance marker allele represented by nucleotide A at position 112; SEQ ID NO:11, which has a resistance marker allele represented by nucleotide G at position 99; and / or SEQ ID NO:16, which has a resistance marker allele represented by nucleotide C at position 41; or a sequence, which has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity with one or more of the aforementioned sequences and comprises a resistance marker allele.

[0028] In embodiments, plants according to the present invention are heterozygous for said one or more SNP markers (eg, heterozygous for the introgression sequence and SGO1 Sphaerotheca resistance).

[0029] In an embodiment, a plant according to the invention is homozygous for said one or more SNP markers (eg, homozygous for the introgression sequence and SGO1 resistance to Sphaerotheca).

[0030] In an embodiment, a plant according to the present invention comprises two or more, three or more, or all four of the SNP markers SL1831, SL1847, SL1887 and / or SL1883 (each in heterozygous or homozygous form).

[0031] In representative embodiments, plants according to the present invention comprise at least the following SNP markers (either one marker or both markers in heterozygous or homozygous form):

[0032] SL1831 and SL1847;

[0033] SL1831 and SL1883;

[0034] SL1831 and SL1887;

[0035] SL1847 and SL1883;

[0036] SL1847 and SL1887; or

[0037] SL1883 and SL1887.

[0038] For example, markers SL1883 and SL1887 can be used together, optionally with the addition of other markers. As another exemplary illustration, markers SL1847 and SL1887 can be used in combination, optionally with the addition of other markers.

[0039] In an embodiment, the introgression sequence of the invention confers resistance to at least Ulcerative Colletotrichum race Bl 16-36EU.

[0040] In an embodiment, a plant according to the invention is obtained by crossing Lactuca sativa Accession No. CGN23091 or Lactuca sativa 18LEN002364 with a second lettuce plant that does not comprise said introgression sequence conferring resistance to Scolopendra suber (eg, does not comprise SGO1 Scolopendra suber resistance).

[0041] In embodiments, the plant according to the invention is an inbred, doubled haploid or hybrid plant. Typically, the plant of the invention is diploid.

[0042] As another aspect, the present invention provides plants of lettuce line 18LEN002364.

[0043] It is another embodiment to provide a plant part, organ or tissue obtained from a lettuce plant according to any one of the embodiments described herein, including but not limited to heads, leaves, cores, stems, roots, flowers or flower parts, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, fertilized eggs, embryos, meristems, callus, seeds, cuttings, cells or tissue cultures, or any other part or product of a plant, each of which comprises an introgression sequence. In embodiments, the plant part, organ or tissue exhibits resistance to Sphaerotheca oleracea according to the invention, particularly when grown into a lettuce plant producing lettuce leaves and / or heads.

[0044] There is further provided a seed producing a plant according to the invention.

[0045] There is further provided a seed produced by a plant according to the invention.

[0046] In another embodiment, use of the lettuce plant, plant part or seed according to any one of the embodiments of the invention for producing and harvesting lettuce heads and / or leaves is contemplated.

[0047] In another embodiment, the invention relates to the use of a lettuce plant, plant part (eg, head or leaf), or seed according to any embodiment described herein to produce another lettuce plant, plant part, or seed of the invention having resistance to Folium spp.

[0048] In another embodiment, the invention relates to the use of a lettuce plant, plant part or seed according to any embodiment of the invention, wherein the lettuce plant, plant part or seed is Lactuca sativa 18LEN002364 or a progeny or ancestor thereof.

[0049] In yet another embodiment, the invention relates to the use of a lettuce plant, plant part or seed according to any embodiment of the invention, wherein the lettuce plant, plant part or seed is Lactuca sativa Accession No. CGN23091 or a progeny or ancestor thereof.

[0050] As another embodiment, the present invention provides a method for producing a lettuce plant having enhanced resistance to Acidis rapae (e.g., compared to a control plant), the method comprising:

[0051] a) crossing a lettuce plant according to the present invention with a second lettuce plant lacking said introgression sequence conferring resistance to Lactobacillus putida to produce progeny plants;

[0052] b) selecting progeny plants comprising the introgressed sequence that confers resistance to L. lactuca, said selecting step comprising detecting (e.g., by genotyping) one or more of the following SNP markers:

[0053] i) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0054] ii) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0055] iii) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0056] iv) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state;

[0057] This results in plants having enhanced resistance to L. putida.

[0058] Optionally, the method further comprises:

[0059] c) selfing the selected progeny or crossing the selected progeny plant with another lettuce plant to produce additional progeny. In an embodiment, additional progeny are selected and selfed / crossed again for 2 to 10 generations.

[0060] In an embodiment, the selection step of b) comprises detecting (e.g., by genotyping) two or more, three or more, or all four of the SNP markers SL1831, SL1847, SL1887, and / or SL1883. Optionally, the selection step comprises detecting at least the following SNP markers (any one or two markers in heterozygous or homozygous form):

[0061] SL1831 and SL1847;

[0062] SL1831 and SL1883;

[0063] SL1831 and SL1887;

[0064] SL1847 and SL1883;

[0065] SL1847 and SL1887; or

[0066] SL1883 and SL1887.

[0067] In an embodiment, markers SL1883 and SL1887 can be used together, optionally with the addition of other markers. As another exemplary illustration, markers SL1847 and SL1887 can be used in combination, optionally with the addition of other markers.

[0068] In embodiments, the first lettuce plant and / or the second lettuce plant is a lettuce plant.

[0069] Another embodiment provides a method for producing a lettuce plant having enhanced resistance to Leptospermum solani (e.g., compared to a control plant), the method comprising:

[0070] a) crossing a plant of Lactuca oleracea Accession No. CGN23091 with a second lettuce plant (e.g., a lettuce plant) lacking an introgression sequence from Lactuca oleracea Accession No. CGN23091 that confers resistance to L. putida to produce progeny plants;

[0071] b) selecting progeny plants comprising an introgression on chromosome 2 from Lactuca sativa Accession No. CGN23091 that confers resistance to L. putida, said selecting step comprising detecting (e.g., by genotyping) one or more of the following SNP markers:

[0072] i) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0073] ii) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0074] iii) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0075] iv) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state;

[0076] This results in lettuce plants that are resistant to L. putida.

[0077] Optionally, the method further comprises:

[0078] c) selfing the selected progeny plant or crossing the selected progeny with another lettuce plant (e.g., lettuce plant) to produce additional progeny. In an embodiment, additional progeny are selected and selfed / crossed again for 2 to 10 generations.

[0079] In an embodiment, the selection step of b) comprises detecting (e.g., by genotyping) two or more, three or more, or all four of the SNP markers SL1831, SL1847, SL1887, and / or SL1883. Optionally, the selection step comprises detecting at least the following SNP markers (any one or two markers in heterozygous or homozygous form):

[0080] SL1831 and SL1847;

[0081] SL1831 and SL1883;

[0082] SL1831 and SL1887;

[0083] SL1847 and SL1883;

[0084] SL1847 and SL1887; or

[0085] SL1883 and SL1887.

[0086] In an embodiment, markers SL1883 and SL1887 can be used together, optionally with the addition of other markers. As another exemplary illustration, markers SL1847 and SL1887 can be used in combination, optionally with the addition of other markers.

[0087] In other embodiments, the present invention provides a method for producing an F1 hybrid lettuce plant having enhanced resistance to Pseudomonas aeruginosa (e.g., compared to a control plant), the method comprising crossing a plant according to the present invention (which is an inbred lettuce (e.g., lettuce) plant) with a different inbred lettuce (e.g., lettuce) plant to produce an F1 hybrid lettuce progeny. According to the method, the second inbred lettuce plant may or may not contain an introgression sequence according to the present invention that confers resistance to Pseudomonas aeruginosa.

[0088] In an embodiment, the invention provides a method for identifying a lettuce plant (e.g., a lettuce plant) having enhanced resistance to Acidis rapae (e.g., compared to a control plant), the method comprising the steps of detecting (e.g., by genotyping) one or more of the following SNP markers:

[0089] a) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0090] b) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0091] c) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0092] d) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state;

[0093] Lettuce plants with enhanced resistance to P. lettuces were thereby identified.

[0094] In an embodiment, the aforementioned method further comprises selecting a lettuce plant comprising the one or more SNP markers, and hybridizing the selected lettuce plant with a second lettuce plant (e.g., a lettuce plant), which may be the same or different lettuce plant, to produce a progeny lettuce plant comprising the one or more molecular markers and having enhanced resistance to Lactobacillus solani. In an embodiment, the detection step comprises detecting two or more, three or more, or all four of the SNP markers SL1831, SL1847, SL1887, and / or SL1883 by genotyping. Optionally, the detection step comprises detecting at least the following SNP markers (any one marker or two markers in heterozygous or homozygous form):

[0095] SL1831 and SL1847;

[0096] SL1831 and SL1883;

[0097] SL1831 and SL1887;

[0098] SL1847 and SL1883;

[0099] SL1847 and SL1887; or

[0100] SL1883 and SL1887.

[0101] In an embodiment, markers SL1883 and SL1887 can be used together, optionally with the addition of other markers. As another exemplary illustration, markers SL1847 and SL1887 can be used in combination, optionally with the addition of other markers.

[0102] As yet another embodiment, the present invention provides a method of producing lettuce seeds (e.g., lettuce seeds), the method comprising growing a lettuce plant from a seed according to the present invention, allowing the plant to produce additional lettuce seeds, and optionally collecting the additional lettuce seeds.

[0103] In another embodiment, the present invention relates to a method of providing a lettuce plant, plant part (e.g., leaves and / or heads), or seed having enhanced resistance to Pseudomonas aeruginosa, wherein the method comprises the steps of:

[0104] a) crossing a first lettuce plant (e.g., a lettuce plant) lacking the introgression sequence conferring resistance to Folium spp. of the present invention with a second lettuce plant (e.g., a lettuce plant) according to any embodiment of the present invention,

[0105] b) obtaining progeny lettuce plants, and,

[0106] c) optionally selecting said progeny plants, characterised in that said progeny plants exhibit enhanced resistance to Pseudomonas aeruginosa.

[0107] According to the foregoing embodiment, optionally, the second lettuce plant is a plant of Lactuca oleracea Accession No. CGN23091 or Lactuca oleracea 18LEN002364, or a descendant or ancestor thereof.

[0108] In another embodiment, the present invention relates to a method of identifying a lettuce plant (e.g., a lettuce plant) comprising an introgression sequence of the present invention that confers resistance to Pseudomonas aeruginosa, wherein the method comprises the following steps:

[0109] a) providing a population of lettuce (e.g., lettuce) segregating for a resistance trait to scutellaria spp.;

[0110] b) screening the segregating population for plants exhibiting resistance to Pseudomonas aeruginosa, wherein the resistance trait can be identified by the presence of an introgression sequence of the invention that confers resistance to Pseudomonas aeruginosa; and

[0111] c) selecting a plant from the segregating population, wherein the plant comprises the Folium spp. resistance trait.

[0112] These and other aspects of the invention are described in more detail in the description of the invention which follows. DETAILED DESCRIPTION

[0113] This description is not intended to be an exhaustive list of all the different ways in which the invention may be implemented or all the features that may be added to the invention. For example, features described with respect to one embodiment may be incorporated into other embodiments, and features described with respect to a particular embodiment may be deleted from that embodiment. Therefore, the present invention contemplates that, in some embodiments of the invention, any feature or combination of features set forth herein may be excluded or omitted. In addition, in view of this disclosure, numerous variations of the various embodiments suggested herein and additions will be apparent to those skilled in the art without departing from the present invention. Therefore, the following description is intended to set forth some specific embodiments of the invention, and does not exhaustively describe all permutations, combinations, and variations thereof.

[0114] All publications, patent applications, patents, and other references cited herein are incorporated by reference in their entirety for the teachings of the pertinent sentence and / or paragraph to which the reference is addressed.

[0115] The nucleotide sequences provided herein are presented from left to right in the 5' to 3' direction and are represented using the standard code representing nucleotide bases as described in 37 CFR §§1.821-1.825 and World Intellectual Property Organization (WIPO) Standard ST.25, e.g., adenine (A), cytosine (C), thymine (T), and guanine (G).

[0116] Amino acids are also indicated using WIPO Standard ST.25, for example: alanine (Ala; A), arginine (Arg; R), asparagine (Asn; N), aspartic acid (Asp; D), cysteine ​​(Cys; C), glutamine (Gln; Q), glutamic acid (Glu; E), glycine (Gly; G), histidine (His; H), isoleucine (Ile; 1), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y), and valine (Val; V).

[0117] Unless the context indicates otherwise, it is expressly contemplated that the various features of the invention described herein may be used in any combination. Moreover, the invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein may be excluded or omitted. By way of example, if the specification states that a composition comprises components A, B, and C, it is expressly contemplated that any one or combination of A, B, or C may be omitted and abandoned, singly or in any combination. Definitions.

[0118] If not otherwise specified below, the technical terms and expressions used within the scope of the present application are generally given the meanings commonly applied thereto in the fields related to plant breeding and cultivation.

[0119] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes one or more plants and reference to "a cell" includes mixtures of multiple cells, tissues, etc.

[0120] As used herein, the term "about," when referring to a value or to an amount of mass, weight, time, volume, concentration, or percentage, is meant to encompass variations of ±20% from the specified amount in some embodiments, ±10% from the specified amount in some embodiments, ±5% from the specified amount in some embodiments, ±1% from the specified amount in some embodiments, ±0.5% from the specified amount in some embodiments, and ±0.1% from the specified amount in some embodiments, as such variations are suitable for performing the disclosed methods.

[0121] As used herein, a "lettuce" plant refers to any plant in the genus Lactuca, including but not limited to lettuce, mountain lettuce (L. saligna), wild lettuce (L. virosa) and poisonous lettuce. In an embodiment, the lettuce plant is lettuce. In an embodiment, the lettuce plant is cultivated.

[0122] "Cultivated lettuce" plants are understood within the scope of the present invention to mean plants that are no longer in the natural state, but have been developed and domesticated by human care and are for agricultural use and / or human consumption and do not include wild lettuce germplasm (such as poisonous lettuce accession number CGN23091). For example, in an embodiment, the stems and / or leaves of the cultivated lettuce plant do not have thorns and have closed flowers. Alternatively or additionally, the cultivated lettuce plant is a hybrid plant. Alternatively or additionally, the cultivated lettuce plant is a lettuce plant. In the context of interspecific hybridization between lettuce plants and wild lettuce, when the progeny plant has been backcrossed with the lettuce plant at least three times, the progeny plant of the interspecific hybridization is considered to be a "cultivated lettuce" plant.

[0123] "Allele" is understood within the scope of the present invention to refer to an alternative or variant form of a gene or other genetic element. Such alternative or variant forms can be the result of a single nucleotide polymorphism, insertion, inversion, translocation or deletion, or the result of gene regulation (caused by, for example, chemical or structural modifications), transcriptional regulation or post-translational modification / regulation. In a diploid cell or organism, two alleles of a given gene or genetic element typically occupy corresponding loci on a homologous chromosome pair.

[0124] “Lactuca oleracea.” An oomycete that causes downy mildew in lettuce, especially in cooler growing areas.

[0125] As used herein, the term "resistance" (and similar terms) refers to the ability of a plant to limit the growth and development of a given pathogen and / or the damage caused by a pathogen under similar environmental conditions and pathogen pressure when compared to a susceptible plant. Resistance can be qualitative or quantitative. In an embodiment, a "resistant" plant exhibits reduced symptoms, substantially no symptoms, or even no symptoms to a specific pathogen. In certain embodiments, a "resistant" plant shows some symptoms, but is still able to produce a marketable product with an acceptable yield, for example, compared to yield and / or growth when there is no pathogen, the yield may be reduced and / or the plant may be stunted. In an embodiment, a lettuce plant according to the present invention is resistant to at least the Brassica rapa species Bl 16-36EU characterized and classified by IBEB (International Brassica rapa Evaluation Board) according to the SEXTET code. In embodiments, the scutellaria resistant lettuce plants of the present invention exhibit no or little necrosis and no or very sparse spore formation under standard test conditions (e.g., the test conditions defined in Example 1 below, e.g., when inoculated with any of the scutellaria races Bl 16-36EU). In embodiments, the scutellaria resistance of the present invention is dominant. In embodiments, the scutellaria resistance is qualitative. In embodiments, the scutellaria resistance of the present invention exhibits single gene inheritance.

[0126] The term "enhanced resistance to scutellaria" (and similar terms) is understood herein to mean that the plant has a stronger resistance to at least one scutellaria species or isolate compared to a control lettuce plant that does not contain the introgression sequence of the invention (e.g., a statistically significant improvement in resistance to scutellaria compared to a control lettuce plant that does not contain the introgression sequence of the invention, using a Student's test at p<0.1, p<0.05, or p<0.01) and / or has a broader spectrum of resistance to scutellaria (e.g., having resistance to one or more additional scutellaria species / isolates). In embodiments, "enhanced resistance to scutellaria" refers to providing additional resistance to one or more scutellaria species or isolates that a plant may already have (i.e., stacking of resistance), thereby reducing the risk of scutellaria resistance being compromised compared to a plant lacking the introgression sequence (i.e., as a form of resistance management).

[0127] "Control lettuce plant" is understood within the scope of the present invention to mean a lettuce plant (e.g., lettuce) of the same species as the lettuce plant of the present invention, and does not have the introgression sequence of the present invention linked to resistance to scutellaria (e.g., a parent lettuce plant in a parent lettuce plant that does not have the introgression sequence of the present invention). In an embodiment, the control lettuce plant has the same genetic background as the lettuce plant of the present invention, and is optionally a plant of the same plant variety that does not contain the introgression sequence of the present invention. Plant varieties are understood herein according to the definition of UPOV. Therefore, the control lettuce plant can be a near-isogenic strain, an inbred strain or a hybrid, provided that they have the same genetic background as the lettuce plant of the present invention, except that the control plant does not have the introgression sequence of the present invention linked to resistance to scutellaria. The control lettuce plant is grown for the same length of time under the same conditions as the lettuce plant of the present invention.

[0128] The term "trait" refers to a characteristic or phenotype (e.g., disease resistance, such as resistance to scutellaria). Traits can be inherited in a dominant or recessive manner or in a partially or incompletely dominant manner. In the context of the present invention, resistance to scutellaria of the present invention is a dominant trait. Therefore, the traits of the lettuce plants of the present invention can be homozygous or heterozygous. In addition, traits can be monogenic or polygenic, or can be produced by the interaction of one or more genes with the environment. In the context of the present invention, the gene introgression sequence that confers resistance to scutellaria located on chromosome 2 exhibits monogenic inheritance and is sufficient to confer the trait of resistance to scutellaria.

[0129] The terms "hybrid," "hybrid plant," and "hybrid progeny" refer to individuals produced from genetically different parents (eg, individuals that are genetically heterozygous or predominantly heterozygous).

[0130] The term "inbred line" refers to a population that is homozygous or nearly homozygous genetically. For example, an inbred line can be obtained by several cycles of brother / sister breeding or selfing or by doubled haploid production.

[0131] The term "doubled haploid line" refers to a stable inbred line derived from anther culture. Some pollen grains (haploid) cultured in a specific medium and environment can develop into plantlets containing n chromosomes. These plantlets are then "doubled" and contain 2n chromosomes. The offspring of these plantlets are called "doubled haploids" and are essentially no longer segregating (stable).

[0132] The term "cultivar" or "variety" refers to a horticulturally produced variety that is different from the naturally occurring variety. In some embodiments of the invention, the cultivar or variety is commercially valuable.

[0133] The term "genetically fixed" refers to a genetic element that has been stably incorporated into a plant genome that does not normally contain the genetic element. When genetically fixed, the genetic element can be spread to other plants in an easy and predictable manner through sexual hybridization.

[0134] The term "plant" or "plant part" refers herein to a plant part, organ or tissue obtainable from a plant according to the invention, including but not limited to leaves, stems, roots, flowers or flower parts, fruits, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, fertilized eggs, embryos, meristems, callus, seeds, cuttings, heads, cores, cell or tissue cultures (including callus cultures), or any other part or product of a plant. In embodiments, the plant part comprises a gene introgression sequence of the invention. In embodiments, the plant part exhibits the Discoideum resistance trait according to the invention, particularly when grown into a plant producing lettuce leaves and / or heads.

[0135] A "plant" is any plant at any stage of development.

[0136] A plant "seed" is a seed that grows into a plant according to any one of the embodiments.

[0137] A "plant cell" is a structural and physiological unit of a plant, comprising a protoplast and a cell wall. A plant cell may be in the form of an isolated single cell or a cultured cell, or as part of a higher organized unit such as, for example, a plant tissue, a plant organ, or a whole plant.

[0138] "Plant cell culture" means a culture of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissue, pollen, pollen tubes, ovules, embryo sacs, zygotes, and embryos at various stages of development.

[0139] A "plant organ" is a distinct and distinct structured and differentiated part of a plant, such as a root, stem, leaf, flower bud or embryo.

[0140] As used herein, "plant tissue" means a group of plant cells organized into structural and functional units. Any plant tissue in a plant or in culture is included. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into structural and / or functional units. The use of this term in conjunction with or alone any specific type of plant tissue as listed above or otherwise covered by this definition is not intended to exclude any other type of plant tissue.

[0141] "Processed food" is understood within the scope of the present invention to mean food that has been changed from its natural state. Methods for processing food include, but are not limited to, cutting, slicing, dicing, grinding, canning, freezing, refrigerating, dehydrating, heating and aseptic processing.

[0142] "Fresh-cut market" is understood within the scope of the present invention to mean vegetables on the market which have undergone minimal processing.

[0143] As used herein, the term "marker allele" or "allele of a marker locus" (and similar terms) refers to an allele at a polymorphic locus (as defined herein) that serves as a marker for locating and / or indicating the presence of one or more genetically linked loci (e.g., a Folium resistance locus) that contributes to the variability of one or more phenotypic traits.

[0144] As used herein, "marker locus" refers to a region on a chromosome comprising a nucleotide or polynucleotide sequence that is present in an individual's genome and is genetically linked to one or more loci of interest, and the region may comprise a gene or any other genetic determinant or factor that contributes to a trait." marker locus" also refers to a region on a chromosome comprising a polynucleotide sequence complementary to a genomic sequence (such as a sequence of a nucleic acid used as a probe). The marker locus can be used to track the presence of a second linked locus (such as a linked locus that encodes or contributes to phenotypic trait expression). For example, the marker locus can be used to monitor the separation of the allele at a locus (such as a QTL or a single gene), and these alleles are genetically or physically linked to the marker locus.

[0145] As used herein, the term "breeding" and its grammatical variants refer to any process of generating progeny individuals. Breeding can be sexual or asexual, or any combination thereof. Exemplary non-limiting breeding types include hybridization, selfing, generation of doubled haploid derivatives, and combinations thereof.

[0146] As used herein, the phrase "established breeding population" refers to a collection of potential breeding mates produced by and / or used as parents in a breeding program; the breeding program is, for example, a commercial breeding program. The members of the established breeding population are typically fully characterized in terms of genes and / or phenotype. For example, several phenotypic traits of interest may have been assessed, for example, under different environmental conditions, at multiple locations and / or at different times. Alternatively or in addition, one or more genetic loci associated with the expression of phenotypic traits may have been identified, and one or more members of the breeding population may have been genotyped with respect to the one or more genetic loci and with respect to one or more genetic markers associated with the one or more genetic loci.

[0147] As used herein, the term "diploid" plant refers to a plant having two sets of chromosomes, typically one set from each of its two parents. However, it should be understood that in some embodiments, a diploid plant can receive its "maternal" and "paternal" sets of chromosomes from the same single organism, such as when a plant is self-pollinated to produce successive generations of plants.

[0148] "Homozygous" is understood within the scope of the present invention to mean identical alleles at one or more corresponding loci on homologous chromosomes.

[0149] "Heterozygous" is understood within the scope of the present invention to mean different alleles at one or more corresponding loci on homologous chromosomes.

[0150] A "dominant" allele is understood within the scope of the present invention to mean an allele which determines the phenotype when present in the heterozygous or homozygous state.

[0151] A "recessive" allele is one that determines the phenotype when present only in the homozygous state.

[0152] "Backcrossing" is understood within the scope of the present invention to mean a process in which hybrid progeny are repeatedly crossed back to one of the parents (the "recurrent" parent). A different recurrent parent can be used in subsequent backcrosses.

[0153] "Genetic locus" is understood within the scope of the present invention to mean a region on a chromosome that contains a gene or any other genetic element or factor that contributes to a trait.

[0154] "Genetic linkage" is understood within the scope of the present invention to mean the association of genetic characteristics due to the proximity of genes on the same chromosome, measured by the percentage of recombination between gene loci (centimorgans, cM).

[0155] For the purposes of the present invention, the term "co-segregation" refers to the fact that an allele for a trait and one or more alleles for one or more markers tend to be transmitted together because they are physically close together on the same chromosome (i.e., recombination between them is reduced due to their physical proximity), resulting in their alleles being non-randomly associated due to their proximity on the same chromosome. The term "associated with..." can be used with the same meaning.

[0156] As used herein, the term "gene architecture at a quantitative / qualitative trait locus" refers to a region of the genome that is statistically associated with a phenotypic trait of interest and represents the potential genetic basis for the phenotypic trait of interest.

[0157] As used herein, phrases "genetic markers" or "molecular markers" refer to the characteristics (for example, nucleotides or polynucleotide sequences present in the genome of an individual) associated with one or more loci of interest. In certain embodiments, gene markers are polymorphic in a population of interest, or loci are occupied by polymorphisms, depending on context. Genetic markers include, for example, single nucleotide polymorphisms (SNPs), insertions and deletions (indels) (i.e., insertions / deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), randomly amplified polymorphic DNA (RAPDs), cutting amplified polymorphic sequences (CAPS) markers, diversity array technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs) and many other examples. Genetic markers can be, for example, used to locate the genetic loci containing alleles that contribute to the variability of one or more phenotypic traits on a chromosome. The phrase "genetic markers" can also refer to polynucleotide sequences complementary to a genomic sequence, such as sequences of nucleic acids used as probes. In embodiments, a "genetic marker" may be physically located at a position on a chromosome that is internal or external (ie, intragenic or extragenic, respectively) to the genetic locus with which it is associated.

[0158] As used herein, the term "genotype" refers to the genetic makeup of a cell or organism. "A set of genetically marked genotypes" of an individual include the specific alleles of one or more genetic marker loci present in the haplotype of the individual. As known in the art, genotypes can relate to a single locus or multiple loci, whether these loci are related or unrelated, and / or are linked or non-linked. In certain embodiments, the genotype of an individual relates to one or more related genes, because the one or more genes participate in the expression of a phenotype of interest (e.g., a quantitative trait as defined herein). Thus, in certain embodiments, a genotype includes one or more alleles present at one or more genetic loci in an individual. In certain embodiments, a genotype is represented by a haplotype (also defined herein).

[0159] As used herein, the term "germplasm" refers to the totality of the genotype of a population or other individual group (e.g., species). The term "germplasm" may also refer to plant material; for example, a group of plants that serve as a repository for various alleles. The phrase "adapted germplasm" refers to plant material that has been confirmed to have genetic advantages; for example, for a given environment or geographic region, the phrases "unadapted germplasm," "original germplasm," and "exotic germplasm" refer to plant material with unknown or unconfirmed genetic value, for example, for a given environment or geographic region. In this way, the phrase "unadapted germplasm" refers in some embodiments to plant material that does not belong to an established breeding population and has no known relationship with a member of an established breeding population.

[0160] A "haplotype" is the genotype, ie, the combination of alleles, of an individual at multiple genetic loci. Typically, the genetic loci that define a haplotype are physically and genetically linked, ie, multiple loci along the same chromosome segment.

[0161] As used herein, the terms "introgression," "introgressing," and "introgressed" (and grammatical variants thereof) refer to the natural and artificial transmission of a desired allele or combination of desired alleles of one or more genetic loci from one genetic background to another. For example, a desired allele at a given locus can be transferred to at least one progeny via a sexual hybridization between two parents, wherein at least one of the parents has the desired allele in its genome (the "donor" parent). Alternatively, for example, transmission of the allele can occur by recombination between two donor genomes, such as in fused protoplasts, wherein at least one donor protoplast has the desired allele in its genome. Offspring containing the desired allele can be repeatedly backcrossed with the recurrent parent to produce a strain having a desired genetic background, and selection is performed for the desired allele, wherein the result is that the desired allele becomes fixed in the desired genetic background. For example, a marker associated with enhanced resistance to scutellaria scutellariae can be introgressed from a donor parent into a recurrent parent that does not contain the introgressed sequence. The resulting progeny can be optionally repeatedly backcrossed to the recurrent parent and selected until the progeny have the introgressed sequence that confers resistance to scutellaria scutellariae in the recurrent parent background.

[0162] As used herein, the term "linked" and grammatical variations thereof refer to the tendency of alleles at different loci on the same chromosome to segregate together more often than expected by chance if their transmission were separate, in some embodiments as a result of their physical proximity.

[0163] As used herein, the phrase "nucleic acid" refers to any physical monomer unit string that can correspond to a string of nucleotides, including polymers of nucleotides (e.g., typical DNA, cDNA, or RNA polymers), modified oligonucleotides (e.g., oligonucleotides containing bases that are not typical for biological RNA or DNA, such as 2'-O-methylated oligonucleotides), etc. In some embodiments, nucleic acids can be single-stranded, double-stranded, multi-stranded, or a combination thereof. Unless otherwise indicated, the specific nucleic acid sequence of the subject matter disclosed herein optionally contains and / or encodes a complementary sequence in addition to any sequence explicitly indicated.

[0164] As used herein, the term "majority" refers to more than one. Thus, a "majority of individuals" refers to at least two individuals. In some embodiments, the term majority refers to more than half of a whole. For example, in some embodiments, a "majority of a population" refers to more than half of the members of that population. Depending on the context, these uses of the term "plurality" will be apparent to those skilled in the art.

[0165] As used herein, the term "progeny" refers to one or more offspring of a particular cross. Typically, progeny are produced by breeding of two individuals, but some species (particularly some plants and hermaphroditic animals) can be self-fertilized (i.e., the same plant serves as a donor for both male and female gametes). The one or more offspring can be any generation, such as F1, F2, or any subsequent generation.

[0166] As used herein, the phrase "quality trait" refers to a phenotypic trait that is controlled by one or a few genes that exhibit most of the phenotypic effects. Thus, quality traits are usually simply inherited. Examples in plants include, but are not limited to, flower color and several known disease resistances, such as, for example, resistance to scutellariae of the present invention.

[0167] As used herein, the phrase "quantitative trait" refers to a phenotypic trait that can be described in numbers (i.e., quantitative (quantitated / quantified)). Quantitative traits typically exhibit continuous changes between individuals in a population; that is, the numerical differences in phenotypic traits are small and can be graded from one another. Typically, the frequency distribution in a population of quantitative phenotypic traits presents a bell-shaped curve (i.e., presenting a normal distribution between two extremes). "Quantitative traits" are typically the result of a genetic locus interacting with the environment, or a plurality of genetic loci interacting with one another and / or with the environment. Examples of quantitative traits include plant height and yield.

[0168] As used herein, the terms "quantitative trait locus" (QTL) and "marker-trait association" refer to the association between a genetic marker and a chromosomal region and / or a gene that affects the phenotype of a trait of interest. Typically, this is determined statistically; for example, based on one or more methods disclosed in the literature. A QTL can be a chromosomal region and / or a genetic locus with at least two alleles that differentially affect a phenotypic trait (quantitative trait or qualitative trait).

[0169] The term "recipient plant" is used herein to refer to a plant that will receive DNA obtained from a donor plant that contains an introgression sequence for a trait of interest (e.g., resistance to scutellaria). The "recipient plant" may or may not already contain one or more native sequences or introgression sequences for resistance to scutellaria, in which case the term refers to a plant that will receive additional introgression sequences at a different locus.

[0170] The term "natural genetic background" is used herein to indicate the original genetic background of the gene sequence of interest. For example, such a genetic background can be the genome of wild germplasm. For example, the gene sequence of the present invention was found at a specific position on chromosome 2 of a poisonous lettuce plant. On the contrary, via, for example, breeding, a method involving transferring the DNA comprising the gene sequence from chromosome 2 of, for example, a poisonous lettuce plant to the same position on chromosome 2 of another lettuce species (e.g., lettuce) will result in the gene sequence not being in its natural genetic background. When the gene sequence of the present invention is transferred from a poisonous lettuce background to another lettuce species (e.g., lettuce), they are referred to as "introgression sequences" or "introgression gene sequences" (or similar terms).

[0171] "Donor plant" is understood within the scope of the present invention to mean a plant which provides at least one sequence for enhanced resistance to Brassica rapa (ie is to be introgressed into a recipient plant).

[0172] "Marker-based selection" is understood within the scope of the present invention to mean the detection of one or more nucleic acids from a plant, where the nucleic acid is associated with a desired trait, for example using genetic markers, to identify plants carrying alleles that confer the desired (or undesirable) trait, so that those plants can be used (or avoided) in a selective breeding program.

[0173] Single nucleotide polymorphism (SNP) is a variation of a single site in DNA and is the most common type of variation in the genome. SNP is a DNA sequence variation that occurs when a single nucleotide in a genome (or other consensus sequence)—A, T, C, or G—is different between paired chromosomes of members or individuals of a biological species. For example, two sequenced DNA fragments from different individuals, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide. In this case, there are two alleles: C and T. The basic principle of SNP arrays is the same as that of DNA microarrays. These are a fusion of DNA hybridization, fluorescence microscopy, and DNA capture. The three components of SNP arrays are: an array comprising a nucleic acid sequence (e.g., an amplified sequence or target), one or more labeled allele-specific oligonucleotide probes, and a detection system that records and interprets hybridization signals. The presence or absence of the desired allele can be determined, for example, by real-time PCR or a fluorescent reporter probe method using a double-stranded DNA dye.

[0174] "PCR (polymerase chain reaction)" is understood within the scope of the present invention to mean a method for generating relatively large amounts of specific regions of genomic DNA or one or more subsets, thereby making possible different analyses based on those regions.

[0175] "PCR primer" is understood within the scope of the present invention to mean a relatively short single-stranded DNA fragment used in PCR amplification of a specific region of DNA.

[0176] "Phenotype" is understood within the scope of the present invention to mean one or more distinguishable characteristics of a genetically controlled trait.

[0177] As used herein, the phrase "phenotypic trait" refers to an outward or other detectable characteristic in an individual that results from the interaction of the individual's genome, proteome, and / or metabolome with the environment.

[0178] "Polymorphism" is understood within the scope of the present invention to mean the presence in a population of two or more different forms of a gene, a genetic marker or a genetic trait or a gene product obtainable, for example, by alternative splicing, DNA methylation, etc.

[0179] As used herein, "probe" refers to a group of atoms or molecules that can recognize and bind to a specific target molecule or cell structure and thus allow the detection of a target molecule or structure. In an embodiment, "probe" refers to a labeled DNA or RNA sequence that can be used to detect the presence of a complementary sequence and quantify it by molecular hybridization.

[0180] As used herein, the phrases "sexual crossing" and "sexual reproduction" in the context of the presently disclosed subject matter refer to the fusion of gametes to produce offspring (e.g., by fertilization, such as in plants by pollination to produce seeds). "Sexual crossing" or "cross-fertilization" in some embodiments is the fertilization of one individual by another individual (e.g., cross-pollination in plants).

[0181] "Selective breeding" is understood within the scope of the present invention to mean a breeding program which uses plants having or showing desirable traits as parents.

[0182] The term "selfing" in some embodiments refers to the production of seeds by self-fertilization or self-pollination; that is, the pollen and ovules are from the same plant.

[0183] "Tester" plants are understood within the scope of the present invention to mean plants of the genus Solanum used to genetically characterize traits in the plants to be tested. Typically, the plants to be tested are crossed with "tester" plants, and the segregation ratio of the traits in the hybrid progeny is scored.

[0184] The term "hybridization" as used herein refers to conventional hybridization conditions, preferably to the following hybridization conditions, i.e., using 5x SSPE, 1% SDS, 1x Denhardts solution as solution and / or a hybridization temperature between 35°C and 70°C, preferably 65°C. After hybridization, preferably washing is first performed with 2x SSC, 1% SDS and then with 0.2x SSC at a temperature between 35°C and 75°C, in particular between 45°C and 65°C, but especially at 59°C (for the definition of SSPE, SSC and Denhardt's solution, see Sambrook et al. in the above citation). High stringency hybridization conditions as described by Sambrook et al. above are particularly preferred. If hybridization and washing occur at 65°C as described above, for example, there are particularly preferred stringent hybridization conditions. Non-stringent hybridization conditions, for example, in which hybridization and washing are performed at 45°C, are less preferred and are even less preferred at 35°C.

[0185] According to the present invention, the term "said position corresponding to position X" (X is any number that can be found in the corresponding context of the present application) includes not only the corresponding position in the SEQ ID NO mentioned later, but also any sequence encoding the gene sequence of the present invention, wherein, after alignment with the reference SEQ ID NO, the corresponding position may have a different number, but corresponds to the number indicated by the reference SEQ ID NO. The alignment of the gene sequence can be achieved by applying various alignment tools known to those skilled in the art.

[0186] In the context of nucleic acid hybridization experiments (such as DNA hybridization and RNA hybridization), "stringent hybridization conditions" and "stringent hybridization wash conditions" are sequence-dependent and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to nucleic acid hybridization is found in the following literature: Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes [Biochemistry and Molecular Biology Laboratory Technology-Hybridization with Nucleic Acid Probes] Chapter 2 Part I "Overview of principles of hybridization and the strategy of nucleic acid probe assays [Hybridization principles and nucleic acid probe assay strategy overview]" Elsevier [Elsevier Group], New York. Usually, for a specific sequence under a defined ionic strength and pH value, highly stringent hybridization and washing conditions are selected to be about 5°C lower than the thermal melting point. Typically, under "stringent conditions", the probe will hybridize to its target subsequence, but not to other sequences.

[0187] The thermal melting point is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are chosen to be equal to the melting temperature (T m). An example of stringent hybridization conditions for hybridization of complementary nucleic acids (which have more than 100 complementary residues on filter paper in a Southern or Northern blot) is 50% formamide with 1 mg of heparin at 42° C., where the hybridization is carried out overnight. An example of high stringency wash conditions is 0.15 M NaCl at 72° C. for about 15 minutes. An example of stringent wash conditions is 0.2x SSC wash at 65° C. for 15 minutes (for a description of SSC buffer, see Sambrook, below). Typically, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example of a moderate stringency wash for a duplex of, for example, more than 100 nucleotides is 1x SSC at 45° C. for 15 minutes. An example of a low stringency wash for a duplex of, for example, more than 100 nucleotides is 4-6x SSC at 40° C. for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve a salt concentration of less than about 1.0 M Na ions, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30° C. Stringent conditions can also be achieved by adding destabilizing agents such as formamide. Typically, in a specific hybridization assay, a signal-to-noise ratio that is 2 times (or higher) that observed for non-related probes indicates that specific hybridization has been detected. If the proteins encoded by nucleic acids that do not hybridize to each other under stringent conditions are substantially identical, they are still substantially identical. For example, this occurs when a nucleic acid copy is generated using the maximum codon degeneracy allowed by the genetic code.

[0188] Plants, seeds, products.

[0189] In a first embodiment, the invention provides a lettuce plant (e.g., a lettuce plant) having enhanced resistance to F. lettuces (e.g., compared to a control plant), the plant comprising an introgression sequence from Lactuca sativa, the introgression sequence conferring resistance to F. lettuces, wherein the introgression sequence is contained in Lactuca sativa germplasm (e.g., Accession No. CGN23091) or deposited Lactuca sativa line 18LEN002364, and wherein the introgression sequence is located on chromosome 2. In embodiments, the resistance is qualitative resistance. In embodiments, the resistance is qualitative resistance. In embodiments, the resistance exhibits single gene inheritance.

[0190] In an embodiment, the plant of the invention is a cultivated plant, optionally a cultivated lettuce plant.

[0191] In embodiments, the introgression sequence confers resistance to at least Ulcerative Colletotrichum race Bl 16-36EU.

[0192] In embodiments, the introgression sequence comprises one or more of the SNP markers shown in Table 3 herein. In embodiments, the introgression comprises one or more, two or more, three or more, or all four of the following SNP markers:

[0193] a) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0194] b) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0195] c) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0196] d) C genotype of SNP marker SL1883 in SEQ ID NO:16 in heterozygous or homozygous state.

[0197] In another embodiment:

[0198] a) The G genotype of marker SL1831 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 2 and reverse primer SEQ ID NO: 5, and probe SEQ ID NO: 3;

[0199] b) the A genotype of the SNP marker SL1847 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 7 and reverse primer SEQ ID NO: 10, and probe SEQ ID NO: 8;

[0200] c) the G genotype of SNP marker SL1887 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 12 and reverse primer SEQ ID NO: 15, and probe SEQ ID NO: 13; and

[0201] d) The C genotype of SNP marker SL1883 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO:17 and reverse primer SEQ ID NO:20, and probe SEQ ID NO:18.

[0202] In representative embodiments, the plants of the present invention comprise at least the following SNP markers (each individual marker being present in heterozygous or homozygous form):

[0203] SL1831 and SL1847;

[0204] SL1831 and SL1883;

[0205] SL1831 and SL1887;

[0206] SL1847 and SL1883;

[0207] SL1847 and SL1887;

[0208] SL1883 and SL1887;

[0209] SL1831, SL1847 and SL1883;

[0210] SL1831, SL1847 and SL1887;

[0211] SL1847, SL1883 and SL1887; or

[0212] SL1831, SL1847, SL1883 and SL1887.

[0213] For example, markers SL1883 and SL1887 can be used together, optionally with the addition of other markers. As another exemplary illustration, markers SL1847 and SL1887 can be used in combination, optionally with the addition of other markers.

[0214] In representative embodiments, the gene introgression sequence comprises one or more, two or more, three or more, or all four of the following: SEQ ID NO:1, which has a resistance marker allele represented by nucleotide G at position 112; SEQ ID NO:6, which has a resistance marker allele represented by nucleotide A at position 112; SEQ ID NO:11, which has a resistance marker allele represented by nucleotide G at position 99; and / or SEQ ID NO:16, which has a resistance marker allele represented by nucleotide C at position 41; or a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with one or more of the foregoing sequences and comprises a resistance marker allele.

[0215] In another embodiment, the invention provides a plant according to any one of the embodiments described herein, wherein the plant comprises at least one copy (eg, is heterozygous) of the introgression sequence that confers resistance to Pseudomonas aeruginosa.

[0216] In another embodiment, the invention provides a plant according to any one of the preceding embodiments, wherein the plant comprises two copies (eg, the plant is homozygous) of the introgression sequence conferring resistance to Pseudomonas aeruginosa.

[0217] In another embodiment, the plant according to the present invention is an inbred, doubled haploid or hybrid plant.

[0218] In an embodiment, the invention provides plants of the deposited lettuce line 18LEN002364.

[0219] In another embodiment, the present invention provides seeds producing the plants according to the present invention.

[0220] In another embodiment, the present invention provides seeds produced by the plants according to the present invention.

[0221] In another embodiment, the lettuce plant of the present invention is the lettuce plant according to any embodiment described herein, wherein lettuce line 18LEN002364, or a progeny or ancestor thereof, is the source of the introgression sequence conferring resistance to Pseudomonas aeruginosa.

[0222] In another embodiment, the lettuce plant of the present invention is the lettuce plant according to any of the preceding embodiments, wherein Lactuca indica Accession No. CGN23091 or a progeny or ancestor thereof is the source of the introgression sequence conferring resistance to Cynomolgus.

[0223] In another embodiment, the lettuce plant of the present invention is a lettuce plant according to any of the preceding embodiments, wherein the plant is obtained by crossing Lactuca oleracea Accession No. CGN23091 or Lactuca 18LEN002364, or a progeny or ancestor thereof, with a lettuce plant that does not contain the gene introgression sequence that confers resistance to L.

[0224] Another embodiment provides plant parts, organs or tissues obtainable from the lettuce plant according to any one of the preceding embodiments, including but not limited to leaves, cores, heads, stems, roots, flowers or flower parts, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, fertilized eggs, embryos, meristems, calli, seeds, cuttings, cell or tissue culture, or any other part or product of a plant. In an embodiment, the plant part, organ or tissue comprises an introgression sequence that confers resistance to scutellaria. In an embodiment, the plant part, organ or tissue exhibits resistance to scutellaria according to the present invention, particularly when grown into a plant that produces lettuce heads and / or leaves.

[0225] In another embodiment, use of the lettuce plant, plant part or seed according to any of the preceding embodiments for producing and optionally harvesting lettuce heads and / or leaves is contemplated.

[0226] In another embodiment, the invention relates to the use of a lettuce plant, plant part or seed according to any embodiment of the invention, wherein the lettuce plant, plant part or seed is Lactuca sativa 18LEN002364 or a progeny or ancestor thereof.

[0227] In another embodiment, the invention relates to the use of the lettuce plant, plant part or seed according to any one of the embodiments of the invention for sowing a field, a greenhouse or a polytunnel.

[0228] In another embodiment, the plants according to the present invention are male sterile.

[0229] In another embodiment, plants according to the present invention are grown mature lettuce heads and / or leaves.

[0230] In one embodiment, the present invention provides lettuce leaves and heads produced from the lettuce plant according to any one of the embodiments of the present invention.

[0231] The present invention further relates to lettuce plant seeds, in particular cultivated lettuce plant seeds (eg, lettuce seeds), which grow into lettuce plants according to any one of the embodiments of the present invention.

[0232] The present invention further relates to use of the lettuce plant according to any one of the embodiments to introduce (eg, introgress) the Folium resistance trait of the present invention into a lettuce plant (eg, a lettuce plant) lacking the Folium resistance trait.

[0233] Gene sequence, markers.

[0234] The present invention further relates to a gene sequence that directs or controls the expression of a resistant trait to scutellaria in a lettuce plant. In another embodiment, the gene sequence of the present invention is located on chromosome 2. In another embodiment of the present invention, the gene sequence can be obtained from a donor plant having the genetic background of lettuce 18LEN002364 or its progeny or ancestor and comprising the gene sequence.

[0235] In another embodiment, the gene sequence of the present invention is genetically or physically linked to one or more marker loci that co-segregate with the Discoideum resistance trait.

[0236] In another embodiment, the gene sequence of the present invention is characterized by one or more SNP markers as described in Table 3, for example, comprising one or more, two or more, three or more, or all four of the following SNP markers SL1831, SL1847, SL1883, and SL1887:

[0237] a) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0238] b) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0239] c) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0240] d) C genotype of SNP marker SL1883 in SEQ ID NO:16 in heterozygous or homozygous state.

[0241] In a representative embodiment:

[0242] a) The G genotype of marker SL1831 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 2 and reverse primer SEQ ID NO: 5, and probe SEQ ID NO: 3;

[0243] b) the A genotype of the SNP marker SL1847 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 7 and reverse primer SEQ ID NO: 10, and probe SEQ ID NO: 8;

[0244] c) the G genotype of SNP marker SL1887 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 12 and reverse primer SEQ ID NO: 15, and probe SEQ ID NO: 13; and

[0245] d) The C genotype of SNP marker SL1883 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO:17 and reverse primer SEQ ID NO:20, and probe SEQ ID NO:18.

[0246] In another embodiment, the present invention discloses a kit for detecting (e.g., by genotyping) the scutellaria resistance trait locus of the present invention in a lettuce plant (optionally, a cultivated L. sativa lettuce plant), wherein the kit comprises at least one PCR oligonucleotide primer pair and probe selected from the group consisting of:

[0247] i. A primer pair consisting of a forward primer SEQ ID NO: 2 and a reverse primer SEQ ID NO: 5, and a probe SEQ ID NO: 3;

[0248] ii. a primer pair consisting of a forward primer SEQ ID NO: 7 and a reverse primer SEQ ID NO: 10, and a probe SEQ ID NO: 8;

[0249] iii. a primer pair represented by a forward primer SEQ ID NO: 12 and a reverse primer SEQ ID NO: 15, and a probe SEQ ID NO: 13; and / or

[0250] iv. a primer pair represented by a forward primer of SEQ ID NO:17 and a reverse primer of SEQ ID NO:20, and a probe of SEQ ID NO:18.

[0251] The present invention also discloses the use of the SNP markers according to the present invention for diagnostic selection and / or genotyping of the locus for resistance to the trait of the scutellaria spp. in lettuce plants, in particular cultivated lettuce plants (e.g., lettuce).

[0252] The present invention further discloses the use of some or all of these DNA markers for identifying the presence of a resistance trait locus for the scutellaria resistant strain in lettuce plants, in particular cultivated lettuce plants, more in particular L. sativa lettuce plants according to the present invention and / or for monitoring the introgression of a resistance trait locus for the scutellaria resistant strain into lettuce plants, in particular cultivated lettuce plants, in particular L. sativa lettuce plants according to the present invention and as described herein.

[0253] The present invention further discloses a polynucleotide (amplification product) obtainable in a PCR reaction involving at least one of the following oligonucleotide primers disclosed herein: SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 17 or SEQ ID NO: 20, and reacted with probes SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 13 and / or SEQ ID NO: SEQ ID NO: 18, respectively. The present invention also provides a polynucleotide (amplification product) obtainable in a PCR reaction involving a PCR oligonucleotide primer pair selected from the group consisting of: SEQ ID NO: 2 and SEQ ID NO: 5; SEQ ID NO: 7 and SEQ ID NO: 10; SEQ ID NO: 12 and SEQ ID NO: 15; or SEQ ID NO: 17 and SEQ ID NO: 20, and reacted with probes SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 13 or SEQ ID NO: SEQ ID NO: 18, respectively.

[0254] Also contemplated herein are polynucleotides having at least 90%, in particular at least 95%, in particular at least 96%, in particular at least 97%, in particular at least 98%, in particular at least 99% sequence identity with the sequence of the amplification product and / or polynucleotides exhibiting a nucleotide sequence that hybridizes with the nucleotide sequence of the amplification product obtainable in the above-mentioned PCR reaction.

[0255] In embodiments, the amplification product corresponds to, or has at least 90%, 95%, 96%, 97%, 98% or 99% identity to, the amplification product using the same primers / primer pairs obtainable from Lactuca sativa 18LEN002364, or a progeny or ancestor thereof, comprising a gene introgression sequence conferring resistance to Psoralea corylifolia of the present invention.

[0256] Amplification products according to the present invention and described herein can be used to generate or develop new primers and / or probes that can be used to identify the Dischloa resistant trait loci of the present invention.

[0257] Therefore, in one embodiment, the present invention further relates to derived markers, in particular derived primers or probes, which are developed from the amplification products according to the present invention and as described herein and by methods known in the art, and these derived markers are genetically linked to the resistance trait locus of the Mycorrhiza uralensis.

[0258] Breeding methods.

[0259] The present invention also provides a method for producing a lettuce plant having enhanced resistance to L. lettuce (e.g., compared to a control). In an embodiment, the method comprises:

[0260] a) crossing a first lettuce plant (e.g., a lettuce plant, particularly a cultivated lettuce plant) according to the present invention with a second lettuce plant lacking the introgression sequence of the present invention that confers resistance to Lactobacillus putida to produce progeny plants; and

[0261] b) selecting progeny plants comprising said introgression sequence conferring resistance to Pseudomonas aeruginosa;

[0262] This results in plants having enhanced resistance to L. putida.

[0263] In embodiments, the selecting step comprises detecting (e.g., by genotyping) one or more, two or more, three or more, or all four of the following SNP markers:

[0264] i) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0265] ii) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0266] iii) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0267] iv) C genotype of SNP marker SL1883 in SEQ ID NO:16 in heterozygous or homozygous state.

[0268] In embodiments, the first lettuce plant is a cultivated lettuce plant.In embodiments, the first lettuce plant is a lettuce plant.In embodiments, the second lettuce plant is a lettuce plant.

[0269] In an embodiment of the method according to the invention, the method comprises detecting (e.g. by genotyping) the resistance-associated genotype (as described herein) at the following SNP markers (each individual marker being present in heterozygous or homozygous form):

[0270] SL1831 and SL1847;

[0271] SL1831 and SL1883;

[0272] SL1831 and SL1887;

[0273] SL1847 and SL1883;

[0274] SL1847 and SL1887;

[0275] SL1883 and SL1887;

[0276] SL1831, SL1847 and SL1883;

[0277] SL1831, SL1847 and SL1887;

[0278] SL1847, SL1883 and SL1887; or

[0279] SL1831, SL1847, SL1883 and SL1887.

[0280] For example, markers SL1883 and SL1887 can be used together, optionally with the addition of other markers. As another exemplary illustration, markers SL1847 and SL1887 can be used in combination, optionally with the addition of other markers.

[0281] In another embodiment, the invention relates to the method of any one of the embodiments described herein, wherein the first lettuce plant of step a) is Lactuca sativa Accession No. CGN23091 or a progeny or ancestor thereof comprising the introgression sequence of the invention, and the second lettuce plant lacks the introgression sequence of the invention that confers resistance to Lactobacillus solani.

[0282] In another embodiment, the present invention relates to the method of any one of the embodiments described herein, wherein the first lettuce plant of step a) is Lactuca sativa 18LEN002364 or a progeny or ancestor thereof comprising the introgression sequence of the present invention, and the second lettuce plant lacks the introgression sequence of the present invention that confers resistance to Lactobacillus sp.

[0283] In an embodiment, according to any one of the embodiments of the present invention, the method further comprises:

[0284] c) selfing or crossing the selected progeny plant with another lettuce plant to produce additional progeny. In an embodiment, additional progeny are selected and selfed / crossed again for 2 to 10 generations.

[0285] As another embodiment, the present invention provides a method for producing an F1 hybrid lettuce plant with enhanced resistance to Pseudomonas aeruginosa (e.g., compared to a control plant), the method comprising crossing an inbred (including doubled haploid) lettuce plant of the present invention with a different inbred lettuce plant to produce an F1 hybrid progeny. According to the method, the second lettuce plant may or may not contain the introgression sequence of the present invention that confers resistance to Pseudomonas aeruginosa.

[0286] In embodiments, the first lettuce plant is a cultivated lettuce plant.In embodiments, the first lettuce plant is a lettuce plant.In embodiments, the second lettuce plant is a lettuce plant.

[0287] Select a method.

[0288] In another embodiment, the present invention provides a method for identifying lettuce plants that are resistant to Pseudomonas aeruginosa and comprise at least one copy of the introgression sequence of the present invention (i.e., the plant is heterozygous or homozygous), the method comprising the steps of detecting (e.g., by genotyping) one or more, two or more, three or more, or all four of the following SNP markers:

[0289] a) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0290] b) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0291] c) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0292] d) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state;

[0293] Lettuce plants resistant to P. lettuces were thereby identified.

[0294] In embodiments, the plant is a cultivated plant (eg, cultivated lettuce).

[0295] In an embodiment, further comprising selecting a lettuce plant comprising the one or more SNP markers, and hybridizing the selected lettuce plant with a second lettuce plant to produce a progeny lettuce plant comprising one or more molecular markers and resistant to Folium lettuces (e.g., comprising a gene introgression sequence of the invention that confers Folium lettuces resistance). In an embodiment, the second lettuce plant is different from the selected lettuce plant. In an embodiment, the second lettuce plant is lettuce. In an embodiment, the second lettuce plant does not comprise a gene introgression sequence of the invention that confers Folium lettuces resistance. In an embodiment, the second lettuce plant does comprise the gene introgression sequence.

[0296] In another embodiment, the present invention relates to a method for identifying a lettuce plant comprising an introgression sequence of the present invention that confers resistance to Pseudomonas aeruginosa, wherein the method comprises the following steps:

[0297] a) providing a population segregating for a resistance trait to Pseudomonas aeruginosa;

[0298] b) screening the segregating population for members that exhibit resistance to Pseudomonas aeruginosa, wherein the trait can be identified by the presence of an introgression sequence of the invention that confers resistance to Pseudomonas aeruginosa; and

[0299] c) selecting a member of the segregating population, wherein the member comprises the Folium Brassicae resistance trait.

[0300] In another embodiment, the present invention relates to a method for identifying a lettuce plant comprising an introgression sequence of the present invention that confers resistance to Pseudomonas aeruginosa, wherein the method comprises the following steps:

[0301] a) providing a population segregating for a resistance trait to Pseudomonas aeruginosa,

[0302] b) screening the segregating population for members that exhibit resistance to S. punctata, wherein the trait can be identified by the presence of an introgression sequence of the invention that confers S. punctata resistance, wherein the introgression sequence of the invention can be identified by detecting (e.g., by genotyping) one or more, two or more, three or more, or all four S. punctata resistance-associated alleles at markers SL1831, SL1847, SL1883, and / or SL1883 (as described herein); and

[0303] c) selecting a member of the segregating population, wherein the member comprises the Folium Brassicae resistance trait.

[0304] In another embodiment, the present invention provides a method for identifying a lettuce plant (e.g., lettuce, particularly cultivated lettuce) comprising an introgression sequence on chromosome 2, wherein the introgression sequence confers resistance to Pseudomonas aeruginosa, the method comprising:

[0305] a) providing a population segregating for resistance to Pseudomonas aeruginosa;

[0306] b) screening said population using a kit for detecting (e.g., by genotyping):

[0307] i) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0308] ii) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0309] iii) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0310] iv) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state;

[0311] c) identifying plants comprising one or more of the genotypes of (b).

[0312] In another embodiment, the present invention provides a method for identifying a wild lettuce source that is resistant to Folium sphaeroides on chromosome 2, comprising:

[0313] a) providing a wild lettuce germplasm or multiple wild lettuce germplasms;

[0314] b) screening the lettuce germplasm or multiple wild lettuce germplasms using a kit that detects (e.g., by genotyping) the following:

[0315] i) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state;

[0316] ii) A genotype of SNP marker SL1847 in SEQ ID NO:6 in heterozygous or homozygous state;

[0317] iii) the G genotype of the SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or

[0318] iv) a C genotype of the SNP marker SL1883 in SEQ ID NO: 16 in a heterozygous or homozygous state; and

[0319] c) identifying wild lettuce germplasm comprising one or more of the genotypes of (b).

[0320] In yet another embodiment, the present invention relates to the use of a DNA marker amplified from the genome of the lettuce plant according to any one of the preceding embodiments (preferably from the genome of Lactuca sativa 18LEN002364 or its progeny or ancestor) by PCR amplification with the following oligonucleotide primer pairs: forward primer SEQ ID NO:2 and reverse primer SEQ ID NO:5, and probe SEQ ID NO:3; forward primer SEQ ID NO:7 and reverse primer SEQ ID NO:10, and probe SEQ ID NO:8; forward primer SEQ ID NO:12 and reverse primer SEQ ID NO:15, and probe SEQ ID NO:13; or forward primer SEQ ID NO:17 and reverse primer SEQ ID NO:20, and probe SEQ ID NO:18, wherein the DNA fragment indicates the presence of the Fungicide resistance trait in the lettuce plant, to identify lettuce plants comprising and exhibiting the Fungicide resistance trait.

[0321] In an embodiment of the method according to the invention, the method comprises detecting (e.g. by genotyping) the resistance-associated genotype (as described herein) at the following SNP markers (each individual marker being present in heterozygous or homozygous form):

[0322] SL1831 and SL1847;

[0323] SL1831 and SL1883;

[0324] SL1831 and SL1887;

[0325] SL1847 and SL1883;

[0326] SL1847 and SL1887;

[0327] SL1883 and SL1887;

[0328] SL1831, SL1847 and SL1883;

[0329] SL1831, SL1847 and SL1887;

[0330] SL1847, SL1883 and SL1887; or

[0331] SL1831, SL1847, SL1883 and SL1887.

[0332] For example, markers SL1883 and SL1887 can be used together, optionally with the addition of other markers. As another exemplary illustration, markers SL1847 and SL1887 can be used in combination, optionally with the addition of other markers.

[0333] use

[0334] The present invention also relates to the use of the Folium resistant-propagation material obtainable from the lettuce plant according to any one of the embodiments of the invention for growing lettuce plants to produce Folium resistant lettuce plants, seeds, heads and / or leaves, wherein the Folium resistance can be assessed in standard assays, in particular an assay as described in Example 1 below.

[0335] In an embodiment, the invention provides a method of producing lettuce seeds, the method comprising growing a lettuce plant from the seed of claim 13, and allowing the plant to produce further lettuce seeds, and optionally collecting the seeds.

[0336] The present invention also relates to the use of a Sphaerotheca resistant-propagation material obtainable from a lettuce plant according to any one of the embodiments of the present invention for producing lettuce heads and / or leaves.

[0337] The present invention also contemplates the use of the Inoscilloides resistance gene sequences of the present invention associated with other gene sequences (eg, those disclosed in WO 2011 / 003783) that are associated with Inoscilloides resistance.

[0338] Based on the description of the present invention, a technician who possesses lettuce 18LEN002364 as described herein or its progeny or ancestors (comprising the gene introgression gene sequence) can easily transfer the gene introgression gene sequence of the present invention to other various types of lettuce plants using breeding techniques well known in the art (e.g., using the SNP marker loci disclosed herein).

[0339] Seed deposit information

[0340] The applicant has deposited at least 2,500 seeds of lettuce line 18LEN002364 with NCIMB (NCIMB Limited, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, Scotland) on June 12, 2020 under NCIMB accession number NCIMB 43625.

[0341] The applicant opts for expert resolution and requires the release of the deposited material only to an expert pursuant to Article 32(1) EPC or corresponding laws and regulations of other countries or treaties (expert witness provisions) until the publication of the reference to the grant of a patent or, if the application is refused, withdrawn or deemed withdrawn, 20 years from the filing date.

[0342] This deposit of lettuce line 18LEN002364 will be kept in the NCIMB depository (which is a public depository) for a period of 30 years, or 5 years after the most recent request, or the effective period of the patent, whichever is longer, and if any deposited seed becomes non-viable during this period, it will be replaced. In addition, the applicant has met all requirements of 37 C.FR §§ 1.801-1.809, including providing an indication of sample vitality. During the pendency of this application, the commissioner may obtain the deposit upon request. After the publication of the patent on the variety, the variety will be irrevocably and unrestrictedly released to the public by providing access to at least 2,500 seeds of the variety deposited by the NCIMB. The applicant has no restrictions on obtaining deposited materials from the NCIMB; however, the applicants are not entitled to be exempted from any restrictions imposed by law on the transfer of biological materials or their commercial transportation. Applicant does not waive any infringement of its rights granted under this patent or any plant variety protection rights (eg, the United States Plant Variety Protection Act, 7 USC §2321 et seq.).

[0343] The present invention will now be described with reference to the following examples. It will be appreciated by those skilled in the art that these examples are not intended to limit the scope of the claims to the present invention, but are intended to be examples of certain embodiments. Other embodiments of the present invention may be practiced without departing from the spirit and scope of the present invention, and its scope is limited by this disclosure and the appended claims.

[0344] Examples

[0345] Example 1. Disease test for Lactobacillus solani

[0346] The lettuce scutellaria disease test was conducted in a climate chamber with high humidity. The day length was 16 hours, and during the day, the temperature was 18°C, and the relative humidity (RH) was about 85%. At night, the temperature was 15°C, and the RH was about 100%. Prior to the inoculation of the test, spores of the scutellaria pathogen were propagated on varieties that were sensitive to the specific isolates. Disease testing for scutellaria resistance was performed using various scutellaria isolates and races.

[0347] Isolates of D. punctatus were characterized and classified according to the Group C Sextet code by IBEB (International D. punctatus Evaluation Board; see Table 1).

[0348] Table 1. Differential responses of Discoideum race Bl:16-36EU to IBEB C groups

[0349] Small Sextet Code Small Sextet Code Small Sextet Code Bl:16EU 19-00-00 Bl:24EU 50-02-00 Bl:32EU 27-00-04 Bl:17EU 45-17-00 Bl:25EU 50-01-00 Bl:33EU 62-07-06 Bl:18EU 50-00-00 Bl:26EU 51-03-00 Bl:34EU 54-15-01 Bl:20EU 51-00-00 Bl:27EU 47-38-00 Bl:35EU 62-15-06 Bl:21EU 27-01-00 Bl:29EU 62-07-00 Bl:36EU 55-15-01 Bl:22EU 46-32-00 Bl:30EU 46-06-02 Bl:23EU 19-02-00 Bl:31EU 39-12-02

[0350] Before inoculating the test material, harvest the leaves with spores and rinse the spores from the leaves with water. The concentration of the spore suspension is adjusted to 100,000 spores per ml. The spore suspension is sprayed on the plants of 1 week old (on the cotyledons). Observation / selection can be carried out seven to 10 days after inoculation. Usually, the cotyledons of susceptible plants are completely covered with spores. Depending on the used Dictyophora isolate, the cotyledons of resistant plants will not show necrosis or show low-level necrosis, with or without sparse sporulation.

[0351] Example 2. Breeding history of lettuce containing resistance to scutellaria from wild lettuce

[0352] The inventors determined that wild lettuce accession number CGN23091 has broad-spectrum resistance to lettuce stalk mold, designated as "SG01" resistance. The first backcrossing cycle was performed to introduce SG01 stalk mold resistance from wild lettuce germplasm into susceptible lettuce. It was then backcrossed to the lettuce Dm0 cultivar, selfed, and four more rounds of backcrossing were performed, and finally three selfings were performed. The resulting line was designated 18LEN002364 and was deposited by NCIMB under the deposit number NCIMB 43625 on June 12, 2020. The complete breeding history of the deposited B6F4 breeding line is shown in Table 2 below. The line is fixed for stalk mold resistance from a wild lettuce source, that is, line 18LEN002364 contains a gene introgression sequence from wild lettuce germplasm that confers SG01 stalk mold resistance in a homozygous state.

[0353] Table 2. Breeding history of B6F4 lettuce with introgression of genes from lettuce that confer resistance to A. oleracea (downy mildew).

[0354]

[0355]

[0356] Example 3. Phenotyping for resistance to scutellaria transferred from wild lettuce to lettuce

[0357] The lettuce B6F4 line described in Example 2 contains an introgression from wild lettuce accession number CGN23091 comprising the SG01 S. oleracea resistance locus and has demonstrated resistance to all tested races and isolates of S. oleracea.

[0358] Over a period of at least six years, SG01 resistance has been tested against approximately 400 field isolates and has provided protection against all isolates evaluated. In addition, SG01 resistance also protects against all current official Eurotium isolates (Bl: 16-36EU).

[0359] The resistance to the aforementioned isolates and races of P. lactucae conferred by SG01 was rapid, high-level resistance with no observable necrosis in the plants. In addition, the resistance was characterized as dominant (high resistance was observed in both heterozygotes and homozygotes), segregating to be monogenic, and qualitative in nature.

[0360] Example 4. SG01 resistance to scutellaria is fixed and protected in other genetic backgrounds

[0361] SG01 scutellaria resistance from scutellaria rapa accession number CGN23091 has been fixed from BC6 and progeny as shown in Table 1 above. SG01 resistance has been successfully transferred to other lettuce genetic backgrounds. The preserved strains were further backcrossed into commercial cream lettuce varieties and then selfed twice in the end. The high-generation backcross strains were used as sources to introduce scutellaria resistance into multiple lettuce segments (including young leaves, multi-leaf, romaine lettuce, iceberg lettuce, and indoor and outdoor cream lettuce). At each step of the breeding process, the plants selected for the next generation (by genotyping and phenotype) were tested and the presence of resistance to a group of scutellaria isolates was confirmed. For the subset of the isolates tested and under all genetic backgrounds and all environmental conditions assessed, rapid and high-level qualitative scutellaria resistance was maintained. These results confirm the heritable genetic basis of SG01 resistance.

[0362] Example 5. Mapping and genotyping of the SG01 scutellaria resistance locus from lettuce

[0363] The SG01 scutellaria resistance introgression from lettuce has been backcrossed into lettuce Dm0 cultivars up to the B6 generation (Table 1 above). The B6 line has been shown to be resistant to scutellaria under field conditions (Example 2) with no linkage drag.

[0364] Materials and Methods

[0365] A: Assay development

[0366] Step 1: Microarray Development

[0367] An array consisting of 2500 SNPs scattered across the lettuce genome was developed. Variants were identified by comparing sequences obtained from abbreviated sequencing of a panel of 17 lettuce varieties / accessions across different segments, including Batavia, Butter lettuce, Endive, Iceberg and Leafy.

[0368] The array was used to fingerprint backcross (BC) lines and recurrent parents derived from the Peyer's disease program.

[0369] Step 2: Fingerprinting: Identification of introgression

[0370] Fingerprinting screening indicated that the BC lines (CGN23091:B7F2) were 96% to 98% identical to the recurrent parent.SG01 resistance to Sphaerotheca spp. was associated with an introgression region found in BC lines derived from CGN23091.

[0371] Using the reference lettuce v5 physical map (Reyes-Chin-Wo et al., (2017) Nat. Commun. 8, 14953), the first estimate of the introgression size was 33 MB from position 4119137 bp to position 37019114 bp on linkage group 2. This region co-localizes with the major resistance gene cluster carrying Dm3, but SG01 is a different locus from Dm3 and has a different resistance spectrum.

[0372] Step 3: Development of a specific marker for resistance to S. cerevisiae on chromosome 2 SG01

[0373] Whole genome DNA sequencing (WGS) or reduced genome sequencing (RGS) was performed on the recurrent Dm0 parent and a panel of commercial varieties as well as wild lettuce accessions carrying the introgression of the Agrocybe resistant gene on chromosome 2 using next generation sequencing (Mardis, (2008) Annual Review of Genomics and Human Genetics) 9:387.

[0374] Alignment with the reference lettuce v5 sequence and the recurrent susceptible Dm0 parent identified 147,465 variants between 4119137 nt and 10787672 nt on linkage group 2 (LG2). In addition, 94,376 variants reflected different allelic states between the susceptible Dm0 recurrent parent and the resistant backcross lines within the introgression region of interest.

[0375] Step 4: Mapping and fine mapping

[0376] Variants from step 3 that had different allelic states between the resistant backcross line and the susceptible DMO recurrent parent in the SG01 introgression were selected and converted to Taqman TM PCR assay to detect SNPs. Complementing the phenotype for D. punctatus resistance, markers were used to test a large CGN23091 B7F4 population (295 individuals) from the recurrent Dm0 parent. From 37 putative SNP candidates, as determined by Calculated, two SNPs, SL1847 and SL1831, showed 100% co-segregation with resistance to Pseudomonas aeruginosa (Table 3). SNP markers SL1883 and SL1887 were also closely linked to resistance. The specificity of the markers can be further increased by using a haplotype consisting of 2 or more markers from Table 3, for example, within about 1 cM distance from the resistance locus (e.g., any two or any three of the SL1887, SL1883, SL1847, and SL1831 markers, or all four of these markers).

[0377] These markers can be used alone or in any combination to identify lettuce plants containing SG01 resistance to sphaerocephala, to track resistance, to introgress into new lines, etc. For example, markers SL1883 and SL1887 can be used together, optionally with the addition of other markers. As another exemplary illustration, markers SL1847 and SL1887 can be used in combination, optionally with the addition of other markers.

[0378] Table 3. Genetic map

[0379]

[0380]

[0381] The physical locations of SNP markers SL1831, SL1847, SL1883, and SL1887, and the PCR primers / probes used to detect these SNPs are shown below:

[0382] SNP SL1831 at 9490680 bp on LG2 (based on reference lettuce v5 sequence)

[0383] Target sequence (SEQ ID NO: 1):

[0384]

[0385] >Resistance allele: G

[0386] >Primer forward (underlined)

[0387] AGATACAGGGCAGGGAGGAATG(SEQ ID NO:2)

[0388] >Probe (double underline)

[0389] Detection of resistance alleles: ACCCTTCC C GGAGGA (SEQ ID NO: 3)

[0390] Detection of susceptible allele: CAACCCTTCC T GGAGG (SEQ ID NO:4)

[0391] > Primer reverse (underlined)

[0392] TGATGTGGATGGCTTCATGGAAT(SEQ ID NO:5)

[0393] SNP SL1847 at 8893684 bp on LG2 (based on reference lettuce v5 sequence)

[0394] Target sequence (SEQ ID NO:6):

[0395]

[0396] >Resistance allele: A

[0397] >Primer forward (underlined)

[0398] CGCAGTGAAAGCCTTGGAGAT(SEQ ID NO:7)

[0399] >Probe (double underline)

[0400] Detection of resistance allele: TGCCTTGTGGAA T CATTT (SEQ ID NO:8)

[0401] Detection of susceptible allele: CCTTTGTGGAA C CATTTC (SEQ ID NO:9)

[0402] > Primer reverse (underlined)

[0403] CACTTGATGGTGTAGAGGTGGA(SEQ ID NO:10)

[0404] SL1887 at 9514233 bp on LG2 (based on reference lettuce v5 sequence)

[0405] Target sequence (SEQ ID NO: 11)

[0406]

[0407] >Resistance allele: G

[0408] >Primer forward (underlined)

[0409] GCATGAGACAGCTCGAAGAGT(SEQ ID NO:12)

[0410] >Probe (double underline)

[0411] Detection of resistance allele: CCTTCGATGA C GATGATG (SEQ ID NO: 13)

[0412] Detection of susceptible allele: TCCTTCGATGA T GATGATG (SEQ ID NO: 14)

[0413] > Primer reverse (underlined)

[0414] TGAGGCAAGACCACAACC(SEQ ID NO:15)

[0415] SL1883 at 8857531 bp on LG2 (based on reference lettuce v5 sequence)

[0416] Target sequence (SEQ ID NO: 16)

[0417]

[0418] >Resistance allele: C

[0419] >Primer forward (underlined)

[0420] ACGACCTGGCCCAACATTCC(SEQ ID NO:17)

[0421] >Probe (double underline)

[0422] Detection of resistance alleles): TGAACCACC C GACTG (SEQ ID NO: 18)

[0423] Detection of susceptible allele: TGAACCACC A GACTGG (SEQ ID NO: 19)

[0424] > Primer reverse (underlined)

[0425] GTACCCGACTAAATTGCCCAAA(SEQ ID NO:20)

[0426] The above information is summarized in Table 4 below:

[0427] Table 4.

[0428]

[0429]

[0430] 1 Resistance is present in both heterozygotes and homozygotes

[0431] While the present invention has been described with reference to specific details of certain embodiments, it is not intended that such details be construed as limitations on the scope of the invention as claimed, except and to the extent that they are included in the appended claims. Sequence Listing <110> Syngenta Crop Protection AG de Lange, Michel Norbert Alexander Lokossou, Anoma Akuvi <120> Lactuca oleracea resistance SG01 <130> 82134-EP-REG-ORG-X-1 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 155 <212> DNA <213> Lettuce (Lactuca sativa) <220> <221> Features not yet classified <222> (2)..(2) <223> n is A, T, C, or G <220> <221> Features not yet classified <222> (51)..(51) <223> n is A, T, C, or G <220> <221> Features not yet classified <222> (90)..(90) <223> n is A, T, C, or G <220> <221> Features not yet classified <222> (101)..(101) <223> n is A, T, C, or G <220> <221> Features not yet classified <222> (112)..(112) <223> r is A or G <400> 1 tntaaagatt agatacaggg cagggaggaa tgcctttgag ataaatgagg ngatcgacag 60 tgtcatgaga cgatacaaag agatcaaccn ggcagatcat ncaattcctc crggaagggt 120 tgattccatg aagccatcca catcaacacc atcag 155 <210> 2 <211> twenty two <212> DNA <213> synthesis <400> 2 agatacaggg cagggaggaa tg 22 <210> 3 <211> 15 <212> DNA <213> synthesis <400> 3 acccttcccg gagga 15 <210> 4 <211> 16 <212> DNA <213> synthesis <400> 4 caacccttcc tggagg 16 <210> 5 <211> twenty three <212> DNA <213> synthesis <400> 5 tgatgtggat ggcttcatgg aat 23 <210> 6 <211> 157 <212> DNA <213> Lettuce (Lactuca sativa) <220> <221> Features not yet classified <222> (101)..(101) <223> n is A, T, C, or G <220> <221> Features not yet classified <222> (104)..(104) <223> n is A, T, C, or G <220> <221> Features not yet classified <222> (112)..(112) <223> r is A or G <400> 6 ggtacacgct cgcagtgaaa gccttggaga taactcagga gatcgatcat gccatgaaac 60 aactctctca gatagaatgg actgatgatt cagttccttt nggnagaaat grttccacaa 120 aggcatccac ctctacacca tcaagtgatt acaatga 157 <210> 7 <211> twenty one <212> DNA <213> synthesis <400> 7 cgcagtgaaa gccttggaga t 21 <210> 8 <211> 19 <212> DNA <213> synthesis <400> 8 tgcctttgtg gaatcattt 19 <210> 9 <211> 18 <212> DNA <213> synthesis <400> 9 cctttgtgga accatttc 18 <210> 10 <211> twenty two <212> DNA <213> synthesis <400> 10 cacttgatgg tgtagaggtg ga 22 <210> 11 <211> 138 <212> DNA <213> Lettuce (Lactuca sativa) <220> <221> Features not yet classified <222> (41)..(41) <223> n is A, T, C, or G <220> <221> Features not yet classified <222> (62)..(62) <223> n is A, T, C, or G <220> <221> Features not yet classified <222> (99)..(99) <223> r is A or G <400> 11 gcacttgcaa gcatgagaca gctcgaagag ttaactataa natattgcaa ggccttgaaa 60 gngattgtga agaaggaaga agacaatgca tcatcatcnt catcgaagga ggttgtggtc 120 ttgcctcatc taaagtcc 138 <210> 12 <211> twenty one <212> DNA <213> synthesis <400> 12 gcatgagaca gctcgaagag t 21 <210> 13 <211> 18 <212> DNA <213> synthesis <400> 13 ccttcgatga cgatgatg 18 <210> 14 <211> 19 <212> DNA <213> synthesis <400> 14 tccttcgatg atgatgatg 19 <210> 15 <211> 18 <212> DNA <213> synthesis <400> 15 tgaggcaaga ccacaacc 18 <210> 16 <211> 80 <212> DNA <213> Lettuce (Lactuca sativa) <220> <221> Features not yet classified <222> (6) <223> n is A, T, C, or G <220> <221> Features not yet classified <222> (6) <223> m is A or C <220> <221> Features not yet classified <222> (41)..(41) <223> n is a, c, g, or t <400> 16 agacgnttta acgacctggc ccaacattcc atgaaccacc ngactggttt tgggcaattt 60 agtcgggtac ctgcctttgc 80 <210> 17 <211> 20 <212> DNA <213> Synthetic <400> 17 acgacctggc ccaacattcc 20 <210> 18 <211> 15 <212> DNA <213> Synthetic <400> 18 tgaaccaccc gactg 15 <210> 19 <211> 16 <212> DNA <213> Synthetic <400> 19 tgaaccacca gactgg 16 <210> 20 <211> 22 <212> DNA <213> Synthetic <400> 20 gtacccgact aaattgccca aa 22

Claims

1. A method for producing a lettuce plant having enhanced resistance to Acidis rapae, the method comprising: a) crossing a first lettuce plant having enhanced resistance to L. lettuce comprising an introgression sequence from Lactuca sativa that confers qualitative and dominant resistance to L. lettuce with a second lettuce plant lacking said introgression sequence that confers resistance to L. lettuce to produce progeny plants, wherein said first lettuce plant has enhanced resistance to L. lettuce compared to a control lettuce plant not comprising said introgression sequence, wherein said introgression sequence is contained in Lactuca sativa Accession No. CGN23091 or in lettuce line 18LEN002364, representative seeds of which have been deposited by NCIMB under Accession No. NCIMB 43625, and wherein said introgression sequence is located on chromosome 2 and comprises one or more of the following SNP markers: i) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state; ii) A genotype of SNP marker SL1847 in SEQ ID NO: 6 in heterozygous or homozygous state; iii) the G genotype of SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or iv) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state; and b) selecting progeny plants comprising said introgression sequence conferring resistance to Pseudomonas aeruginosa, said selecting step comprising detecting one or more of the following SNP markers: i) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state; ii) A genotype of SNP marker SL1847 in SEQ ID NO: 6 in heterozygous or homozygous state; iii) the G genotype of SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or iv) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state; Thereby producing plants having enhanced resistance to Pseudomonas aeruginosa compared to control lettuce plants not comprising the introgressed sequence.

2. The method of claim 1, wherein the first lettuce plant is lettuce line 18LEN002364.

3. A method for producing a lettuce plant having enhanced resistance to Acidis solani, the method comprising: a) crossing a plant of Lactuca sativa Accession No. CGN23091 with a second lettuce plant lacking the introgression sequence from Lactuca sativa Accession No. CGN23091 that confers resistance to L. lactuca to produce progeny plants; b) selecting progeny lettuce plants comprising an introgression on chromosome 2 from Lactuca sativa Accession No. CGN23091, said introgression conferring resistance to L. lettuces, wherein the selected progeny lettuce plants have increased resistance to L. lettuces compared to a control lettuce plant not comprising said introgression sequence, said selecting step comprising detecting one or more of the following SNP markers: i) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state; ii) A genotype of SNP marker SL1847 in SEQ ID NO: 6 in heterozygous or homozygous state; iii) the G genotype of SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or iv) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state; This results in lettuce plants having enhanced resistance to L. putida.

4. The method according to any one of claims 1 to 3, wherein the method further comprises: c) selfing the selected progeny or crossing the selected progeny with another lettuce plant to produce additional progeny.

5. The method of claim 4, wherein additional progeny are selected and selfed and / or crossed again for 2 to 10 generations.

6. The method according to any one of claims 1 to 3 and 5, wherein the selection step of b) comprises detecting two or more of the SNP markers SL1831, SL1847, SL1887 and / or SL1883.

7. The method according to claim 6, wherein the selecting step comprises detecting at least the following SNP markers: •SL1831 and SL1847; •SL1831 and SL1883; •SL1831 and SL1887; •SL1847 and SL1883; • SL1847 and SL1887; or •SL1883 and SL1887.

8. A method for producing an F1 hybrid lettuce plant with enhanced resistance to L. lettuce, the method comprising crossing a first inbred lettuce plant with enhanced resistance to L. lettuce comprising an introgression sequence from Lactuca sativa that confers qualitative and dominant resistance to L. lettuce with a different inbred lettuce plant to produce an F1 hybrid progeny, wherein the first inbred lettuce plant and the F1 hybrid progeny have enhanced resistance to L. lettuce compared to a control lettuce plant not comprising the introgression sequence, and wherein the introgression sequence is contained in Lactuca sativa Accession No. CGN23091 or in lettuce line 18LEN002364, representative seeds of which have been deposited by NCIMB under Accession No. NCIMB 43625, and wherein the introgression sequence is located on chromosome 2 and comprises one or more of the following SNP markers: a) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state; b) A genotype of SNP marker SL1847 in SEQ ID NO: 6 in heterozygous or homozygous state; c) the G genotype of SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or d) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state.

9. The method of claim 8, wherein the first inbred lettuce plant is a plant of lettuce line 18LEN002364.

10. A method for identifying lettuce plants having enhanced resistance to Pseudomonas aeruginosa, the method comprising the step of detecting one or more of the following SNP markers: a) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state; b) A genotype of SNP marker SL1847 in SEQ ID NO: 6 in heterozygous or homozygous state; c) the G genotype of SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or d) C genotype of SNP marker SL1883 in SEQ ID NO: 16 in heterozygous or homozygous state; thereby identifying lettuce plants with enhanced resistance to Pseudomonas aeruginosa, wherein the lettuce plant comprises an introgression sequence from Lactuca sativa that confers qualitative and dominant resistance to L. lettuces, and wherein the introgression sequence is contained in Lactuca sativa accession number CGN23091 or in Lactuca sativa line 18LEN002364, representative seeds of Lactuca sativa 18LEN002364 have been deposited with NCIMB under accession number NCIMB 43625; and wherein the lettuce plant has enhanced resistance to Pseudomonas aeruginosa compared to a control lettuce plant not comprising the introgression sequence.

11. The method of claim 10, wherein the method further comprises selecting a lettuce plant comprising the one or more SNP markers, and crossing the selected lettuce plant with a second lettuce plant to produce a progeny lettuce plant comprising the one or more molecular markers and having enhanced resistance to Folium lettuces, wherein the progeny lettuce plant has enhanced resistance to Folium lettuces compared to a control lettuce plant that does not comprise the introgressed sequence.

12. The method according to claim 10 or claim 11, wherein the detecting step comprises detecting two or more of the SNP markers SL1831, SL1847, SL1887 and / or SL1883.

13. The method according to claim 12, wherein the detecting step comprises detecting at least the following SNP markers: •SL1831 and SL1847; •SL1831 and SL1883; •SL1831 and SL1887; •SL1847 and SL1883; • SL1847 and SL1887; or •SL1883 and SL1887.

14. The method according to any one of claims 1 to 3, 5, 8 to 11 and 13, wherein: a) The G genotype of marker SL1831 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 2 and reverse primer SEQ ID NO: 5, and probe SEQ ID NO: 3; b) the A genotype of SNP marker SL1847 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 7 and reverse primer SEQ ID NO: 10, and probe SEQ ID NO: 8; c) the G genotype of SNP marker SL1887 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 12 and reverse primer SEQ ID NO: 15, and probe SEQ ID NO: 13; and d) The C genotype of SNP marker SL1883 can be identified in PCR by amplifying a nucleic acid fragment with the following oligonucleotide primer pair: forward primer SEQ ID NO: 17 and reverse primer SEQ ID NO: 20, and probe SEQ ID NO:

18.

15. Method according to any one of claims 1 to 3, 5, 8 to 11 and 13, wherein the introgression sequence confers resistance to at least Ulmus parvum race Bl 16-36EU.

16. A method for producing lettuce seeds, the method comprising: Growing lettuce plants from seeds, the seeds producing lettuce plants with enhanced resistance to L. lettuce comprising an introgression sequence from Lactuca sativa that confers qualitative and dominant resistance to L. lettuce, wherein the resistance of the lettuce plant to L. lettuce is enhanced compared to a control lettuce plant not comprising the introgression sequence, and wherein the introgression sequence is contained in Lactuca sativa Accession No. CGN23091 or in lettuce line 18LEN002364, representative seeds of which have been deposited by NCIMB under Accession No. NCIMB 43625, and wherein the introgression sequence is located on chromosome 2 and comprises one or more of the following SNP markers: a) the G genotype of the SNP marker SL1831 in SEQ ID NO: 1 in the heterozygous or homozygous state; b) A genotype of SNP marker SL1847 in SEQ ID NO: 6 in heterozygous or homozygous state; c) the G genotype of SNP marker SL1887 in SEQ ID NO: 11 in the heterozygous or homozygous state; and / or d) the C genotype of the SNP marker SL1883 in SEQ ID NO: 16 in the heterozygous or homozygous state; and The plants were allowed to produce additional lettuce seeds.

17. The method of claim 16, wherein the lettuce plant is a plant of the lettuce line 18LEN002364.

Images