Drug-loaded nanoparticles targeting nasopharyngeal tumor cells and preparation method and application thereof

Abstract

The present invention provides a drug-loaded nanoparticle targeting nasopharyngeal tumor cells and a preparation method and application thereof. The drug-loaded nanoparticle comprises a DNA tetrahedron, a nucleic acid aptamer S3 and an anti-tumor drug. The DNA tetrahedron is composed of four single-stranded DNAs that are complementary and paired. The DNA tetrahedron encapsulates the anti-tumor drug. The nucleic acid aptamer S3 is connected to the DNA tetrahedron through base complementary pairing. The nucleotide sequence of the nucleic acid aptamer S3 is shown in SEQ ID NO.1. The drug-loaded nanoparticle uses the nucleic acid aptamer S3 to specifically target heterogeneous nasopharyngeal cancer cells and nasopharyngeal cancer stem cells at the same time. By loading doxorubicin onto the DNA tetrahedron modified with S3, the obtained nano drug-loaded particles can simultaneously target and kill heterogeneous nasopharyngeal cancer cells and nasopharyngeal cancer stem cells. While improving the therapeutic effect, it can also reduce the toxic side effects of chemotherapy, chemotherapy resistance, and recurrence and metastasis after treatment, and has important clinical significance and application value.

Description

Technical Field

[0001] The present invention relates to the fields of nanomaterials and nanobiomedicine, and in particular to drug-loaded nanoparticles targeting nasopharyngeal tumor cells and a preparation method and application thereof. Background Art

[0002] Nasopharyngeal carcinoma is highly sensitive to radiotherapy and chemotherapy, but its efficacy is related to the degree of disease progression. Unfortunately, most nasopharyngeal carcinoma patients are already in stage III or IV when they are diagnosed. At this time, the 5-year survival rate of radiotherapy alone is only 35-52%. Combination chemotherapy can effectively improve the treatment effect, but the toxic side effects are significantly enhanced. Therefore, screening nasopharyngeal carcinoma-specific molecular probes and using these specific probes to prepare targeted drugs are our important efforts to improve the sensitivity and specificity of drugs against nasopharyngeal carcinoma.

[0003] Nucleic acid aptamers, also known as "chemical antibodies", refer to single-stranded oligonucleotides that are screened from artificial DNA / RNA libraries and can bind to biological targets such as proteins with high affinity and specificity. The targets can be small organic molecules, metal ions, proteins, cells, and even tissues. Nucleic acid aptamers form special three-dimensional structures such as pseudoknots, hairpins, and G-tetramers through intermolecular forces such as hydrogen bonds, van der Waals forces, and hydrophobic interactions, thereby specifically identifying target substances and affecting their biological activity. Compared with antibodies, nucleic acid aptamers have many unique properties, such as: rapid and reproducible synthesis; easy modification to meet the needs of diagnosis and treatment; good stability and easy storage; low toxicity and immunogenicity; rapid tissue penetration, etc. These advantages make nucleic acid aptamers a new molecular probe for clinical early diagnosis and targeted therapy.

[0004] In therapy, some aptamers can play a therapeutic role by directly binding to the target protein and inhibiting its function, or inhibiting protein-protein interactions. However, a considerable number of aptamers cannot play a direct role. For aptamers that cannot directly play a therapeutic role, another treatment option is to connect drugs or drug-loaded nanoparticles, which can efficiently and safely deliver drug molecules to cells for targeted therapy. DNA tetrahedron (DT) is widely used in molecular diagnosis, bioimaging, molecular delivery and targeted drug delivery due to its stable nanomaterial structure, superior mechanical properties, and rich molecular modification sites. Many researchers have used the functionalization of specific groups of DNA tetrahedrons to construct targeted drug delivery systems. In addition, some sensor elements can also be integrated into the tetrahedron structure for comprehensive treatment. This functionalized nanocarrier can selectively guide therapeutic drugs to targeted cancer cells, effectively increasing the accumulation level of chemotherapeutic drugs in lesions rather than normal tissues. Summary of the invention

[0005] In order to solve the above technical problems, the present invention proposes a drug-loaded nanoparticle targeting nasopharyngeal tumor cells and a preparation method and application thereof. The anti-tumor drugs are effectively encapsulated by DNA tetrahedron, which significantly reduces the toxicity of the anti-tumor drug delivery process to normal tissues. At the same time, the nucleic acid aptamer S3 is connected to the DNA tetrahedron to target and recognize the CD109 molecule, so that the drug-loaded nanoparticles can be specifically targeted to nasopharyngeal tumor cells, providing a safer and more effective treatment idea for nasopharyngeal tumor cells.

[0006] To achieve the above object, the present invention first provides a drug-loaded nanoparticle targeting nasopharyngeal tumor cells, comprising a DNA tetrahedron, a nucleic acid aptamer S3 and an anti-tumor drug, wherein the DNA tetrahedron is composed of four complementary single-stranded DNAs, the DNA tetrahedron encapsulates the anti-tumor drug, the nucleic acid aptamer S3 is connected to the DNA tetrahedron through base complementary pairing, and the nucleotide sequence of the nucleic acid aptamer S3 is shown in SEQ ID NO.1: ATCCAGAGTGACGCAGCATCTGAGAATAGTGGTTTGCTGTATGGTGGGCGTTGAAA.

[0007] Preferably, the anti-tumor drug is doxorubicin.

[0008] Preferably, the nucleic acid aptamer S3 specifically targets the nasopharyngeal tumor cell surface molecule CD109.

[0009] Preferably, the four single-stranded DNA sequences are shown as SEQ ID NO.2 to SEQ ID NO.5, respectively, wherein the sequence of the a strand is:

[0010] ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA, SEQ ID NO. 2;

[0011] The sequence of the b chain is:

[0012] TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC, SEQ ID NO. 3;

[0013] The c-chain sequence is:

[0014] TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC, SEQ ID NO. 4;

[0015] The d-chain sequence is:

[0016] TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT, SEQ ID NO. 5.

[0017] Based on a general inventive concept, the present invention also provides a method for preparing drug-loaded nanoparticles targeting nasopharyngeal tumor cells, comprising the following steps:

[0018] S1. Synthesis of S3-DT: anneal four single-stranded DNA fragments and nucleic acid aptamer S3 fragment in TAE buffer and cool naturally to obtain S3-DT;

[0019] S2. Synthesis of S3-DT-Dox: Add doxorubicin Dox to the S3-DT prepared in step S1, and incubate at room temperature to obtain S3-DT-Dox.

[0020] Based on a general inventive concept, the present invention also provides an application of drug-loaded nanoparticles targeting nasopharyngeal tumor cells in the preparation of targeted therapeutic drugs for CD109-positive tumors.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] 1. The drug-loaded nanoparticles targeted to nasopharyngeal tumor cells provided by the present invention can effectively load anti-tumor drugs, such as doxorubicin (Dox), when multiple oligonucleotides form a DNA tetrahedron (DT) through base pairing; at the same time, the nucleic acid aptamer S3 is connected to the DNA tetrahedron (DT) through base complementary pairing, and the nucleic acid aptamer S3 specifically targets and recognizes the surface molecule CD109 of the nasopharyngeal tumor cells, thereby achieving efficient targeted delivery of anti-tumor drugs, and targeting the DT loaded with Dox to the nasopharyngeal cancer cells, thereby exerting a targeted killing effect on the nasopharyngeal cancer cells;

[0023] 2. Doxorubicin is a chemotherapy drug widely used in anti-tumor treatment, but because it has no targeting, it can also produce indiscriminate killing effects on normal cells and tissues, thus causing more serious chemotherapy side effects. The present invention achieves efficient targeting of doxorubicin by loading doxorubicin onto the nucleic acid aptamer S3 modified DT that can target and recognize nasopharyngeal cancer cells; at the same time, loading doxorubicin through DNA tetrahedron can prevent the toxicity of doxorubicin to normal cells during human body delivery to the greatest extent, while ensuring its therapeutic effect, reducing its chemotherapy toxic side effects, which has important clinical significance and application value;

[0024] 3. The drug-loaded nanoparticles targeted to nasopharyngeal tumor cells provided by the present invention are formed by stable and efficient connection through base complementary pairing. The preparation method is simple, green, economical and efficient. The loading efficiency of doxorubicin is high and the loading is stable, providing a simple and efficient way for the idiosyncratic targeted delivery of anti-tumor drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 The formation process of drug-loaded nanoparticles (S3-DT-Dox) in nasopharyngeal tumor cells in Example 1 of the present invention is characterized, wherein Figure 1 a is the schematic diagram of the structure of DNA tetrahedron DT, Figure 1 b is the molecular size of a chain, a+b chain, a+b+c chain, DT and S3-DT detected by gel electrophoresis;

[0027] Figure 2 This is a diagram showing the targeting recognition of nasopharyngeal carcinoma cells by synthesized S3-DT through laser confocal microscopy in Experimental Example 1 of the present invention, wherein Figure 2 a is the result of DT-Cy5 recognition into 5-8F or NP69 cells. Figure 2 b is the result of S3-Cy5 recognition into 5-8F or NP69 cells. Figure 2 c is the result of S3-DT-Cy5 recognition into 5-8F or NP69 cells;

[0028] Figure 3 The fluorescence microscope imaging of Experimental Example 2 of the present invention shows the targeted recognition diagram of S3 for tumor spheres (rich in tumor stem cells) derived from nasopharyngeal cancer cells. The gray cell spheres in Figure ① are red fluorescence emitted by S3 when recognizing tumor spheres, and Figure ② does not show the red fluorescence. The gray cell spheres in ③ and ④ are the cell nuclei in the tumor spheres dyed blue. Figure ⑤ shows the result of merging Figure ① and Figure ②, indicating that S3 has recognized tumor spheres derived from nasopharyngeal cancer cells. Figure ⑥ shows that the random nucleic acids generated by changing several sequences in S3 failed to recognize tumor spheres derived from nasopharyngeal cancer cells.

[0029] Figure 4 The toxicity and IC50 value of the nanoparticles on nasopharyngeal cancer cells after loading Dox drugs on S3-DT in Experimental Example 3 of the present invention are as follows: Figure 4 a is the cytotoxicity results of Dox, DT-Dox and S3-DT-Dox on 5-8F and NP69 cells, Figure 4 b is the IC50 value of Dox, DT-Dox and S3-DT-Dox for 5-8F cells, Figure 4 c is the IC50 values ​​of Dox, DT-Dox and S3-DT-Dox for NP69 cells;

[0030] Figure 5 This is the in vivo imaging detection of the distribution of S3-DT in nude mice with transplanted tumors in Experimental Example 4 of the present invention (1: heart, 2: liver, 3: spleen, 4: lung, 5: kidney, 6: transplanted tumor in the figure);

[0031] Figure 6 This is the situation in which S3-DT-Dox inhibits the growth of nude mouse transplanted tumors in Experimental Example 5 of the present invention, wherein Figure 6 a is the weight change of mice during treatment in different preparation groups. Figure 6 b is the actual size change of nasopharyngeal tumors under treatment with different preparations. Figure 6 c is the curve of nasopharyngeal tumor volume changes under treatment with different preparations. Figure 6 d is a comparison of tumor weights after treatment with different preparations. DETAILED DESCRIPTION

[0032] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0033] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0034] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.

[0035] Example 1

[0036] Preparation of drug-loaded nanoparticles (S3-DT-Dox) targeting nasopharyngeal tumor cells

[0037] (1) Synthesis of DT: 1 μM single-stranded DNA fragments a, b, c, d were annealed in 1×TAE (40 mM Tris, 20 mM Acetate, 1 mM EDTA, 12.5 mM MgCl2) at 95°C for 10 min, cooled naturally, and stored at room temperature. The final concentration of DT was 1 μM. The schematic diagram of the DNA tetrahedron structure is shown in the figure. Figure 1 As shown in a, A, B, C, D, E, and F represent four single-stranded DNA complementary pairing binding sites respectively.

[0038] (2) Synthesis of S3-DT: 1 μM a, b, c, d single-stranded DNA fragments and 1 μM S3 fragment were annealed in 1×TAE at 95°C for 10 min, cooled naturally, and stored at room temperature to obtain a final concentration of 1 μM S3-DT.

[0039] (3) Synthesis of S3-DT-Dox or DT-Dox: Add 1 μL of 10 mM DOX to 500 μL of 1 μM S3-DT or DT and incubate at room temperature for 2 h to obtain a final concentration of 1 μM S3-DT-Dox or DT-Dox, which is then stored at -20°C for long term storage.

[0040] The S3 sequence is:

[0041] ATCCAGAGTGACGCAGCATCTGAGAATAGTGGTTTGCTGTATGGTGGGCGTTGAAAGAGGGGTGGACACGGTGGCTTAGT, SEQ ID NO.1;

[0042] The sequence of chain a is:

[0043] ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA, SEQ ID NO. 2;

[0044] The sequence of the b chain is:

[0045] TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC, SEQ ID NO. 3;

[0046] The c-chain sequence is:

[0047] TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC, SEQ ID NO. 4;

[0048] The d-chain sequence is:

[0049] TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT, SEQ ID NO. 5.

[0050] Electrophoresis was performed to detect the molecular sizes of chain a, chain a+b, chain a+b+c, DT, and S3-DT. The results are as follows: Figure 1 As shown in b. Figure 1b As can be seen from the results, the corresponding molecular sizes of chain a, chain a+b, chain a+b+c, DT and S3-DT gradually increased, confirming the successful synthesis of S3-DT.

[0051] Experimental Example 1

[0052] Laser confocal microscopy analysis of the targeting ability of S3-DT on nasopharyngeal carcinoma cells

[0053] DNA tetrahedron DT, nucleic acid aptamer S3 and synthesized S3-DT were labeled with Cy5 to obtain DT-Cy5, S3-Cy5 and S3-DT-Cy5, respectively, and then incubated with nasopharyngeal carcinoma cell 5-8F or nasopharyngeal epithelial cell NP69 cells, respectively. Laser confocal microscopy was used to observe whether S3-DT could recognize and enter 5-8F or NP69 cells. The results are as follows: Figure 2 As shown. Among them, Figure 2 a is the result of DT-Cy5 recognition into 5-8F or NP69 cells. Figure 2 b is the result of S3-Cy5 recognition into 5-8F or NP69 cells. Figure 2 c is the result of S3-DT-Cy5 recognition into 5-8F or NP69 cells. Figure 2 The results show that, since DT has no specific recognition ability for 5-8F or NP69 cells, it can enter both cells, and DT-Cy5 red fluorescence can be observed in both 5-8F and NP69 cells; since nucleic acid aptamer S3 has specific recognition for 5-8F nasopharyngeal carcinoma cells, S3-Cy5 red fluorescence can only be observed in 5-8F cells, but not in NP69 cells; at the same time, S3-DT-Cy5 red fluorescence is only observed in 5-8F cells, but not in NP69 cells. The above results show that DT has no specific recognition ability for 5-8F and NP69 cells, nucleic acid aptamer S3 can only recognize 5-8F cells, and the connection between DT and S3 does not affect the specific recognition ability of S3 for 5-8F cells. S3 can effectively mediate the efficient and specific targeting of DNA tetrahedron to nasopharyngeal tumor cells.

[0054] Experimental Example 2

[0055] Fluorescence microscopy imaging demonstrates the targeting and recognition ability of S3 on tumor spheres derived from nasopharyngeal carcinoma cells

[0056] Tumor spheres of 5-8F cells were collected, and biotin-labeled S3 was diluted with binding buffer containing 10% fetal bovine serum to a final concentration of 250 nM. The control was an unscreened library ssDNA with the same label and concentration. They were incubated on ice and then stained with Hoechst33342. The staining was observed under a fluorescence microscope and photographed.

[0057] The results are as follows Figure 3 As shown, the gray cell spheres in Figure ① are red fluorescence emitted by S3 when identifying tumor spheres, Figure ② does not show the red fluorescence, ③ and ④ are gray cell spheres with cell nuclei stained blue, and Figure ⑤ shows the result of merging Figures ① and ②, indicating that S3 has identified tumor spheres derived from nasopharyngeal cancer cells, and Figure ⑥ shows that the random nucleic acids generated by changing several sequences in S3 failed to identify tumor spheres derived from nasopharyngeal cancer cells, thus reflecting the specificity of S3 in identifying tumor spheres derived from nasopharyngeal cancer cells. Figure 3 It can be seen that S3 can bind to the tumor spheres of 5-8F cells, and bright red fluorescence can be observed under a fluorescence microscope. Hoechst staining is used to locate the cell nucleus, and S3 is mainly distributed in the cell membrane and cytoplasm. In the control group, the unscreened library ssDNA could not bind to the cells in the tumor spheres, and no red fluorescence signal was observed under a fluorescence microscope. The above results show that the nucleic acid aptamer S3 can bind to the tumor stem cells in 5-8F cells, indicating that the biological target of the nucleic acid aptamer S3 is not only expressed in the tumor cell 5-8F, but also in its tumor stem cells.

[0058] Experimental Example 3

[0059] Toxicity of drug-loaded nanoparticles S3-DT-Dox to 5-8F cells

[0060] Dox, DT-Dox and S3-DT-Dox were co-incubated with 5-8F and NP69 cells, respectively. Then, MTS was used to detect the cytotoxic effects of Dox, DT-Dox and S3-DT-Dox on 5-8F and NP69 cells. The results are shown in Figure 4 As shown. Among them, Figure 4 a is the cytotoxicity results of Dox, DT-Dox and S3-DT-Dox on 5-8F and NP69 cells, Figure 4 b is the IC50 value of Dox, DT-Dox and S3-DT-Dox for 5-8F cells, Figure 4 c is the IC50 values ​​of Dox, DT-Dox and S3-DT-Dox for NP69 cells.

[0061] Depend on Figure 4The results showed that there was no difference in the toxicity of free Dox and DT-Dox to 5-8F and NP69 cells, but the toxicity of S3-DT-Dox to 5-8F cells was significantly higher than that to NP69 cells. In addition, compared with the free Dox and DT-Dox groups, there was no difference in the toxicity of S3-DT-Dox to 5-8F cells. The IC50 values ​​of free Dox, DT-Dox and S3-DT-Dox to 5-8F cells were 16.55±0.79, 17.16±0.75 and 13.32±0.95, respectively, and there was no significant difference, indicating that S3-DT did not reduce the toxic effect of Dox on 5-8F cells. At the same time, since S3 could not recognize NP69 cells, the toxicity of S3-DT-Dox to NP69 cells was significantly lower than that of freeDox and DT-Dox (S3-DT-Dox vs free Dox, P=0.0002; S3-DT-Dox vs DT-Dox, P=0.0015). The IC50 values ​​of freeDox, DT-Dox and S3-DT-Dox for NP69 cells were 31.49±0.96, 28.3±0.88 and 134.1±1.26, respectively, and the IC50 value of S3-DT-Dox for NP69 cells was significantly higher than that of free Dox and DT-Dox (S3-DT-Dox vs freeDox, P<0.001; S3-DT-Dox vs DT-Dox, P<0.01). This further verifies that the S3-DT-Dox provided by the present invention has specific targeting ability for nasopharyngeal tumor cells (5-8F) and can significantly reduce the cytotoxicity to normal cells.

[0062] Experimental Example 4

[0063] In vivo imaging to detect the distribution of S3-DT in nude mice with transplanted tumors

[0064] 1×10 per mouse 7The cells were transplanted into the forelimbs of nude mice (4 weeks old, female), and the subsequent experiments were carried out after the tumors were formed 2 weeks later. The mice were divided into 4 groups (DPBS group, S3 group, S3-DT group and DT group, 6 mice in each group). The nude mice were fasted for 24 h before the experiment. The 4 groups of mice were injected with 100 μl DPBS (DPBS group), 100 μl 50 μM S3-Cy5 (S3 group), 100 μl 50 μM S3-DT-Cy5 (S3-DT group), and 100 μl 50 μM DT-Cy5 (DT group) through the tail vein. The above DNA was then allowed to circulate in the mice for 2 h to target the aptamer to the cancer tissue. The above mice were then placed in a box containing isoflurane air for anesthesia, and then placed in a small animal imager for imaging using the Cy5 fluorescence channel (selecting the Cy5 channel will match the excitation and emission of the response), with an exposure time of 10 s. After imaging, the mice were dissected, the organs were removed, washed with DPBS, and placed in a culture dish in order for imaging using a small animal imager. The Cy5 fluorescence channel was used, and the exposure time was 10 s.

[0065] The results are as follows Figure 5 As shown, Cy5 fluorescence was not observed in any tissue of the DPBS group, and Cy5 fluorescence was not observed in the transplanted tumor site of the DT group, while Cy5 fluorescence was observed in the transplanted tumor of the S3 group and S3-DT group, indicating that the nucleic acid aptamer S3 and S3-DT can target the transplanted tumor tissue. In addition, the fluorescence of the S3-DT group is more likely to accumulate in the tumor site of nude mice, and significantly reduces the accumulation in other tissues and organs (1: heart, 2: liver, 3: spleen, 4: lung, 5: kidney, 6: transplanted tumor).

[0066] Experimental Example 5

[0067] S3-DT-Dox inhibits the growth of xenograft tumors in nude mice

[0068] A nasopharyngeal tumor mouse model was constructed and randomly divided into four groups. Dox, DT-Dox and S3-DT-Dox were injected into the tumor-bearing mice through the tail vein. At the same time, the mice injected with Dulbecco's phosphate buffered saline (DPBS) were used as the control group. The injected mice were observed for half a month to observe the effects of different preparations on the nude mouse transplanted tumors. The results are as follows Figure 6 shown.

[0069] First, the weight changes of the corresponding mice during the treatment of different preparation groups were measured. The results are as follows Figure 6 As shown in a, there was no significant change in the weight of mice during the treatment, and there was no significant difference in the weight of mice in each group (P>0.05). The preparations in each group were generally safe for use in mice, and S3-DT-Dox had good biosafety.

[0070] Next, the effects of different preparations on nude mouse transplanted tumors were tested. Figure 6 b~ Figure 6 As shown in d, Figure 6 b is the actual size change of nasopharyngeal tumors under treatment with different preparations. Figure 6 c is the curve of nasopharyngeal tumor volume changes under treatment with different preparations. Figure 6 d is a comparison of tumor weights after treatment with different preparations. Figure 6 b~ Figure 6 dThe results showed that compared with DPBS, freeDox showed a significant inhibitory effect on tumor growth (DPBS vs free Dox, P<0.001), and the inhibitory effect of DT-Dox on tumors was comparable to that of free Dox (DPBS vs DT Dox, P<0.001; free Dox vs DT Dox, P>0.05). Due to its tumor targeting property, S3-DT-Dox had a better inhibitory effect on tumors than free Dox (S3-DT Dox vs free Dox, P<0.001) and DT-Dox (S3-DT Dox vs DT Dox, P<0.001).

[0071] It can be seen that the present invention achieves efficient targeting of doxorubicin by loading doxorubicin onto DT modified with nucleic acid aptamer S3 that can target and recognize nasopharyngeal cancer cells; at the same time, loading doxorubicin through DNA tetrahedron can prevent the toxicity of doxorubicin to normal cells during human body delivery to the greatest extent, while ensuring its therapeutic effect, reducing its toxic side effects of chemotherapy, which has important clinical significance and application value.

[0072] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A drug-loaded nanoparticle targeting nasopharyngeal tumor cells, characterized in that: It comprises a DNA tetrahedron, a nucleic acid aptamer S3 and an anti-tumor drug, wherein the DNA tetrahedron is composed of four single-stranded DNAs that are complementary and paired, the DNA tetrahedron encapsulates the anti-tumor drug, the nucleic acid aptamer S3 is connected to the DNA tetrahedron through base complementary pairing, the nucleotide sequence of the nucleic acid aptamer S3 is shown in SEQ ID NO.1, and the sequences of the four single-stranded DNAs are shown in SEQ ID NO.2 to SEQ ID NO.5 respectively; The method for preparing the drug-loaded nanoparticles targeting nasopharyngeal tumor cells comprises the following steps: S1. Synthesis of S3-DT: anneal four single-stranded DNA fragments and nucleic acid aptamer S3 fragment in TAE buffer and cool naturally to obtain S3-DT; S2. Synthesis of S3-DT-Dox: adding doxorubicin Dox to the S3-DT prepared in step S1, and incubating at room temperature to obtain S3-DT-Dox; The anti-tumor drug is doxorubicin.

2. The drug-loaded nanoparticles targeting nasopharyngeal tumor cells according to claim 1, characterized in that: The nucleic acid aptamer S3 specifically targets the surface molecule CD109 of nasopharyngeal tumor cells.

3. Use of the drug-loaded nanoparticles targeting nasopharyngeal tumor cells as claimed in claim 1 in the preparation of targeted therapeutic drugs for CD109-positive nasopharyngeal tumors.

Images