Bifunctional nano-enzyme SERS (Surface Enhanced Raman Scattering) detection platform for ultrasensitively detecting miRNA (Micro Ribonucleic Acid) related to cerebral infarction and preparation method

Abstract

The invention provides a bifunctional nano-enzyme SERS (Surface Enhanced Raman Scattering) detection platform for ultrasensitively detecting mi RNA (Ribonucleic Acid) related to cerebral infarction and a preparation method, and relates to the technical field of biomedical engineering. The preparation method comprises the following steps: synthesizing gold nanorods (AuNRs) by using a seed growth method, and growing Pt on the surface of a product to prepare gold platinum nanorods (Au (at) Pt NRs); the preparation method comprises the following steps: synthesizing gold nano hexagonal plates (AuNHs) by using a seed growth method, and preparing an AuNHs array through oil-water interface self-assembly; and modifying an aptamer complementary chain (H1) on the Au (at) Pt NRs obtained in the step (1) through an Au-S bond. And combining the assembled AuNHs array with a nucleic acid aptamer (cDNA) corresponding to mi R-106a-5p to functionalize the assembled AuNHs array in the step (2), so as to construct an SERS (Surface Enhanced Raman Scattering) detection platform. The target mi R-106a-5p can be specifically combined with cDNA, so that Au (at) Pt NRs carrying H1 are separated from the surface of an AuNHs array, TMB oxidation is reduced, and SERS signals are remarkably reduced. And according to SERS signal intensity, substituting the SERS signal intensity into a linear regression equation to realize quantitative detection of mi RNA.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedical engineering, and particularly to a dual-functional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA and a preparation method thereof. Background Art

[0002] Cerebral infarction (CI), commonly known as ischemic stroke, is irreversible damage to local neurons caused by cerebral ischemia and hypoxia. Globally, stroke remains the second most common cause of disability and death, with CI accounting for 62.4% of all stroke events. The occurrence of CI is closely related to a series of risk factors, including gender, age, obesity, hypertension, and diabetes. Early and accurate diagnosis is of great clinical significance for improving patient prognosis, optimizing treatment plans, and increasing survival rates. Magnetic resonance imaging (MRI) and computed tomography (CT) are currently considered the gold standards for clinical diagnosis of CI. However, even when used in combination, CT and MRI still have limitations such as low sensitivity and specificity, stronger invasiveness, and complex operations, which hinder large-scale screening in the population. Therefore, developing a convenient and ultrasensitive miRNA detection method is crucial for efficiently and accurately detecting diseases and meeting the needs of early diagnosis of CI in a large population.

[0003] Surface-enhanced Raman scattering (SERS), due to its high sensitivity, strong specificity, rapid analysis ability, and non-invasive detection characteristics, has been widely used to detect the unique spectral "fingerprints" of various molecules. SERS has demonstrated its outstanding advantages and has become a key detection method in the fields of life science, chemistry, and materials science. Local surface plasmon resonance (LSPR) generates multiple "hot spots" near the surface of noble metal nanomaterials, which is the main mechanism of the SERS enhancement effect. Research has shown that an excellent SERS-active substrate is the key to achieving the SERS enhancement effect. With the progress of research, highly ordered gold nanohexagonal plates (AuNHs), with their regular shape, high aspect ratio, high stability, sharp corners, and neatly arranged nanoscale gaps between adjacent substrates, have become one of the most effective substrates for SERS-based biosensors, significantly improving the accuracy and reliability of detection. Gold nanorods (AuNRs) have been widely used in optical sensing, cancer treatment, and imaging due to their superior LSPR properties. Single AuNRs exhibit relatively weak SERS signals, while bimetallic nanomaterials show stronger SERS amplification effects. In addition, nanomaterials composed of noble metals such as platinum, gold, and palladium have attracted extensive attention due to their excellent catalytic activity, stability, selectivity, and simple preparation process far exceeding natural enzymes. Therefore, gold-platinum nanorods (Au@Pt NRs) with a bimetallic structure have been widely studied due to their efficient LSPR, generation of dense "hot spots", and peroxidase (POD)-like activity. This structure not only enhances the binding ability with biomolecules but also significantly improves the POD activity using the LSPR effect, overcoming the limitations of low sensitivity and interference in traditional colorimetric methods, electrochemical methods, etc. Therefore, combining SERS technology with the enzyme-like properties of nanomaterials and introducing an identification-competition strategy to design a convenient and ultrasensitive dual-functional nanozyme SERS detection platform not only solves the complexity and strict conditions of traditional SERS-based sandwich biosensors, catalytic hairpin assembly (CHA) amplification strategies, qRT-PCR, etc., but also provides an innovative and promising solution for biomarker detection. The integration of nanozyme-SERS technology has opened up new research directions and application potentials for biomarker detection. Summary of the Invention

[0004] (1) Technical problems to be solved

[0005] Aiming at the deficiencies of the prior art, the present invention provides a dual-functional nanozyme SERS detection platform and a preparation method for ultrasensitive detection of brain infarction-related miRNAs, solving the problems raised in the above background technology.

[0006] (2) Technical solutions

[0007] To achieve the above object, the present invention is realized through the following technical solutions: A preparation method of a dual-functional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNAs. The preparation method of the dual-functional nanozyme SERS detection platform for ultrasensitive detection of miR-106a-5p related to brain infarction includes the following steps:

[0008] 1) Synthesize AuNRs by the seed-mediated method and grow Pt on the surface of the product to prepare gold-platinum nanorods Au@Pt NRs;

[0009] 2) Synthesize gold nanohexagonal plates AuNHs by the seed growth method and prepare an AuNHs array through the oil-water interface self-assembly method;

[0010] 3) Modify the complementary strand H1 of the nucleic acid aptamer on the Au@Pt NRs obtained in step 1) through Au-S bonds, and bind it to the assembled AuNHs array functionalized with the cDNA of the nucleic acid aptamer corresponding to miR-106a-5p to construct a dual-functional nanozyme SERS detection platform.

[0011] Preferably, the specific implementation manner of step 1) is:

[0012] 1.1) Synthesize AuNRs by the seed growth method. Add 200 μL of chloroauric acid to 20 mL of cetyltrimethylammonium bromide solution, then add 1.2 mL of sodium borohydride solution and stir for 120 seconds. Subsequently, let the gold seed solution stand at room temperature for 120 minutes;

[0013] 1.2) Prepare the growth solution by mixing 4 mL of chloroauric acid, 4.4 mL of silver nitrate, 200 mL of cetyltrimethylammonium bromide, and 1.4 mL of ascorbic acid solution;

[0014] 1.3) Mix the growth solution prepared in step 1.2) with 2 mL of the gold seed solution and reflux for 24 hours. Finally, obtain AuNRs by centrifuging at 10000 rpm for 12 minutes;

[0015] 1.4) Mix the AuNRs suspension with the H2PtCl6 solution, then add 0.6 mL of ascorbic acid solution to the mixture and reflux at room temperature for 180 minutes. Finally, obtain gold-platinum nanorods Au@Pt NRs by centrifuging at 10000 rpm for 12 minutes.

[0016] Preferably, the volume ratio of AuNRs to H2PtCl6 in step 1.4) is 200:1.

[0017] Preferably, the specific implementation manner of step 2) is:

[0018] 2.1) Dissolve 0.208 g of polyvinyl pyrrolidone in 6 mL of ultrapure water at 35°C and stir until the solution becomes transparent. Then, quickly add 3 mL of the polyvinyl pyrrolidone solution to 60 μg of chloroauric acid solution and stir rapidly for 3 minutes to ensure that the two are fully mixed. Next, add 96 μL of freshly prepared AA solution to the mixed solution and continue stirring for 30 minutes until the solution turns dark purple.

[0019] 2.2) To ensure the complete reaction, the mixture was allowed to stand at room temperature for 10 hours, then centrifuged at 10,000 rpm for 18 minutes, and washed three times with anhydrous ethanol and deionized water to remove excess reactants from the surface. Finally, the product was dissolved in deionized water to obtain a gold nanohexagonal plate AuNHs solution;

[0020] 2.3) Add the gold nanohexagonal plate AuNHs solution obtained in step 2.1) and n-hexane into a beaker, then add ethanol solution and let stand for 180 seconds. At the oil-water interface, AuNHs self-assemble to form a densely packed nanofilm with metallic luster;

[0021] 2.4) Use piranha solution to completely remove organic matter on the silicon wafer;

[0022] 2.5) The AuNHs monolayer film formed at the oil-water interface in step 2.3) was transferred to the silicon wafer treated in step 2.4) and dried in a thermostat.

[0023] Preferably, in step 2.3), the volume ratio of AuNHs, n-hexane and ethanol is 1:2:1.

[0024] Preferably, the specific implementation of step 3) is:

[0025] 3.1) To connect cDNA, 400 μL of cDNA was mixed with 40 μL of TCEP solution and incubated at room temperature for 30 minutes to activate the aptamer;

[0026] 3.2) The activated cDNA in step 3.1) was coupled to the surface of the AuNHs array and incubated at 37°C for 120 minutes to allow the cDNA to completely bind to the AuNHs surface. The array was repeatedly rinsed with PBS buffer and deionized water, and finally 15 mL of 1 wt% BSA was added to repair the non-specific binding sites on the particle surface to obtain the cDNA functionalized AuNHs array AuNHs@cDNA;

[0027] 3.3) Add 400 μL of H1 activated by TCEP to the Au@Pt NRs prepared in step 1), incubate at 37 °C for 2 hours, and finally add 100 μL of 1 wt% BSA solution to the solution to block the non-specific binding sites on the particle surface. Finally, centrifuge at 10000 rpm for 10 minutes to remove excess reagents and nucleic acid chains to obtain Au@Pt NRs@H1 of H1-functionalized Au@Pt NRs;

[0028] 3.4) Drop the Au@Pt NRs@H1 prepared in step 3.3) onto the surface of the cDNA-functionalized AuNHs array prepared in step 3.2), and place it in an incubator at 37 °C for 2 hours to prepare a dual-functional nanozyme SERS detection platform for detecting miRNA markers related to cerebral infarction. Among them, the nucleotide sequence of H1 is SH-AAAAGTGCTT; the nucleotide sequence of cDNA is SH-CTACCTGCACTGTAAGCACTTTT; the target miRNA to be detected is the biomarker miR-106a-5p of cerebral infarction.

[0029] A dual-functional nanozyme SERS detection platform for ultrasensitive detection of miRNAs related to cerebral infarction is prepared based on the preparation method of a dual-functional nanozyme SERS detection platform for ultrasensitive detection of miRNAs related to cerebral infarction as described above.

[0030] A detection method for a dual-functional nanozyme SERS detection platform for ultrasensitive detection of miRNAs related to cerebral infarction, based on a dual-functional nanozyme SERS detection platform for ultrasensitive detection of miRNAs related to cerebral infarction as described above, includes the following steps:

[0031] 1) Prepare miR-106a-5p solutions with different concentrations respectively, spot the miRNA solutions with different concentrations onto the SERS detection platform for detecting miRNA markers related to cerebral infarction prepared in claim 7, place it in a 37 °C incubator for hybridization reaction, and use the characteristic peak of oxTMB at 1601 cm -1 as the fitting curve between the logarithm of the miR-106a-5p concentration and the SERS intensity;

[0032] 2) Collect 15 clinical samples each from healthy people and patients with cerebral infarction. Drop the test solution: a mixture of patient serum, H2O2, and TMB onto the platform through a one-step operation, place it at 30 °C for hybridization reaction. miR-106a-5p in the serum will competitively bind to cDNA, and H1 will be forced to detach from the platform due to weak binding force. This competitive process causes the concentration of nanozyme on the platform to be forced to decrease. Therefore, the amount of oxTMB decreases;

[0033] 3) Perform SERS detection at room temperature. Substitute the characteristic peak intensity at 1601 cm -1 into the fitting curve determined in step 1) to measure the concentration of miR-106a-5p in the sample to be tested.

[0034] Preferably, the concentration of the TMB solution is 0.9 mM, the concentration of the H2O2 solution is 0.5 M, and the incubation time is not less than 20 minutes.

[0035] (III) Beneficial effects

[0036] The present invention provides a dual-functional nanozyme SERS detection platform and a preparation method for ultrasensitive detection of brain infarction-related miRNAs, having the following beneficial effects:

[0037] 1. The present invention integrates the efficient catalytic characteristics of nanozymes into the recognition competition strategy, demonstrating higher sensitivity and specificity in detecting CI-related miRNAs, and providing a new research approach for the early diagnosis of CI.

[0038] 2. The present invention can achieve single-step and ultrasensitive detection of target miRNAs in patients' sera, with a detection limit (LOD) of 0.96 fM, which is consistent with the results of real-time quantitative polymerase chain reaction (qRT-PCR). It provides a new method for the effective detection of miRNAs and has important clinical value for the early detection of CI.

[0039] 3. The present invention develops a convenient and ultrasensitive miRNA detection method, which can more efficiently and accurately detect diseases and meet the needs of large-scale population for early diagnosis of CI.

[0040] In summary, this study successfully developed a dual-functional nanozyme SERS detection platform for ultrasensitive detection of CI-related miRNAs. By designing an Au@Pt NRs@H1-AuNHs@cDNA composite structure and using a competitive recognition strategy, a SERS detection platform with nanozyme function was developed, and rapid and accurate detection of CI-related miR-106a-5p was achieved. At the same time, the efficient catalytic characteristics of Au@Pt NRs were integrated into the recognition competition strategy, effectively improving the detection sensitivity. In addition, this method can rapidly detect target miRNAs in patients' sera, with an LOD of 0.96 fM, which is consistent with the results of qRT-PCR. In short, this dual-functional nanozyme SERS detection platform provides a new method for the early detection of CI. Brief description of the drawings

[0041] Figure 1It is the process and schematic diagram of detection by a dual-functional nanozyme SERS detection platform; among them, (A) is the synthesis of Au@Pt NRs, (B) is the fabrication of AuNHs arrays and the construction of the detection platform, and (C) is the clinical application process of the detection platform;

[0042] Figure 2 It is the transmission electron microscope (TEM) image of Au@Pt nanorods;

[0043] Figure 3 It is the partially enlarged high-resolution transmission electron microscope (HR TEM) image of Au@Pt nanorods;

[0044] Figure 4 It is the energy spectrum diagram and elemental mapping image of Au@Pt nanorods by energy dispersive spectrometer (EDX);

[0045] Figure 5 It is the ultraviolet-visible (UV-vis) absorption spectra and solution color images under three different conditions;

[0046] Figure 6 It is the surface-enhanced Raman scattering (SERS) spectrum image of 4-MBA (1×10 -8 M)-labeled Au@Pt nanorods and pure 4-MBA (1×10 -2 M);

[0047] Figure 7 It is the transmission electron microscope (TEM) image of AuNHs;

[0048] Figure 8 It is the partially enlarged high-resolution transmission electron microscope (HRTEM) image of AuNHs;

[0049] Figure 9 It is the ultraviolet-visible-near-infrared (UV-Vis-NIR) spectrum image of AuNHs;

[0050] Figure 10 It is the scanning electron microscope (SEM) image of AuNHs arrays;

[0051] Figure 11 It is the Raman spectrum image of 4-MBA (1×10 -8 M)-labeled AuNHs arrays and 4-MBA (1×10 -2 M);

[0052] Figure 12 It is the SERS spectrum images of six randomly selected different positions on the surface of 4-MBA (1×10 -2 M)-labeled AuNHs arrays;

[0053] Figure 13 It isFigure 12 Signal intensity histogram at 1073 cm in -1 ;

[0054] Figure 14 is the SERS spectrogram of the AuNHs array labeled with 4-MBA (1×10 -2 M) storing different times (0 days, 7 days, 14 days);

[0055] Figure 15 is Figure 14 Signal intensity line graph at 1073 cm in -1 ;

[0056] Figure 16 is the relationship curve of the signal intensity at 1601 cm of the signal molecule oxTMB generated by the catalysis of Au@Pt NRs on TMB oxidation with temperature; -1 ;

[0057] Figure 17 is the relationship curve of the signal intensity at 1601 cm of the signal molecule oxTMB generated by the catalysis of Au@Pt NRs on TMB oxidation with pH; -1 ;

[0058] Figure 18 is the relationship curve of the signal intensity at 1601 cm of the signal molecule oxTMB generated by the catalysis of Au@Pt NRs on TMB oxidation with incubation time; -1 ;

[0059] Figure 19 is the relationship curve of the signal intensity at 1601 cm of the signal molecule oxTMB generated by the catalysis of Au@Pt NRs on TMB oxidation with TMB concentration; -1 ;

[0060] Figure 20 is the relationship curve of the signal intensity at 1601 cm of the signal molecule oxTMB generated by the catalysis of Au@Pt NRs on TMB oxidation with H2O2 concentration; -1 ;

[0061] Figure 21 is the Michaelis-Menten equation and double-reciprocal curve graph of Au@Pt NRs;

[0062] Figure 22 is the graph of the nanozyme SERS detection platform prepared in six different batches;

[0063] Figure 23 is Figure 22 Signal intensity line graph at 1601 cm in -1 ;

[0064] Figure 24SERS spectrogram of the nanozyme SERS detection platform for detecting different miRNA sequences;

[0065] Figure 25 is Figure 24 histogram of the signal intensity at 1601 cm -1 in;

[0066] Figure 26 SERS spectrogram of miR-106a-5p in sera with different concentrations;

[0067] Figure 27 is Figure 26 calibration curve of the characteristic peak intensity at 1601 cm -1 in and the logarithm of the miR-106a-5p concentration;

[0068] Figures 28 to 30 MRI image of a healthy person;

[0069] Figures 31 to 33 MRI image of a CI patient;

[0070] Figure 34 SERS spectrogram of miR-106a-5p in sera of healthy subjects and CI patients;

[0071] Figure 35 is for healthy subjects and CI patients at Figure 34 histogram of the signal intensity at 1601 cm -1 in. Detailed implementation

[0072] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Apparently, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0073] The instrument equipment and test conditions used in the present invention are as follows:

[0074] The scanning electron microscope (SEM) photos were measured by a S-4800 II type field emission scanning electron microscope of Hitachi, Japan. The test condition was a voltage of 10.0 kV.

[0075] The transmission electron microscope (TEM) images were measured by a Tecnai 12 transmission electron microscope of Philips. The test condition was a voltage of 120 kV.

[0076] High-resolution transmission electron microscopy (HRTEM) images and selected area electron diffraction (SAED) patterns were measured by a Tecnai G2 F30 S-TWIN, 152 FEI field emission transmission electron microscope. The test conditions were an acceleration voltage of 200 kV.

[0077] Ultraviolet-visible spectral data were measured by a Cary 60 ultraviolet-visible spectrophotometer produced by Agilent Technologies.

[0078] Raman spectra were measured by a DXRxi micro-Raman spectrometer produced by Thermo Fisher Scientific.

[0079] As Figure 1 shown, a preparation method of a bifunctional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA, the preparation method of the bifunctional nanozyme SERS detection platform for ultrasensitive detection of miR-106a-5p related to brain infarction includes the following steps:

[0080] 1) Synthesize AuNRs by the seed-mediated method and grow Pt on the surface of the product to prepare gold-platinum nanorods Au@Pt NRs;

[0081] 2) Synthesize gold nanohexagonal plates AuNHs by the seed growth method and prepare an AuNHs array by the oil-water interface self-assembly method;

[0082] 3) Modify the nucleic acid aptamer complementary strand H1 on the Au@Pt NRs obtained in step 1) through Au-S bonds and bind it to the nucleic acid aptamer cDNA functionalized miR-106a-5p corresponding to step 2) of the assembled AuNHs array to construct a bifunctional nanozyme SERS detection platform.

[0083] Example 1

[0084] Preparation and characterization of Au@Pt NRs@H1

[0085] 1) Synthesize AuNRs by the seed growth method. Add 200 μL (25 mM) of chloroauric acid (HAuCl4) to 20 mL (0.1 M) of cetyltrimethylammonium bromide (CTAB) solution, then add 1.2 mL (0.01 M) of sodium borohydride (NaBH4) solution and stir for 120 seconds. Subsequently, the gold seed solution was left standing at room temperature for 120 minutes.

[0086] 2) Prepare the growth solution by mixing 4 mL (25 mM) HAuCl4, 4.4 mL (4 mM) silver nitrate (AgNO3), 200 mL (0.1 M) CTAB, and 1.4 mL (0.788 mM) ascorbic acid (L-AA) solution.

[0087] 3) Mix the growth solution prepared in step 1.2) with 2 mL of gold seed solution and reflux for 24 hours. Finally, AuNRs are obtained by centrifuging at 10,000 rpm for 12 minutes.

[0088] 4) Mix 1 mL of AuNRs suspension with 5 μL (0.01 M) H2PtCl6 solution. Then add 0.6 mL (0.1 M) L-AA solution to the mixture and reflux at room temperature for 180 minutes. Finally, Au@PtNRs are obtained by centrifuging at 10,000 rpm for 12 minutes.

[0089] 5) As Figure 2 shown in the TEM image of Au@Pt NRs, the morphology of Au@Pt NRs is in the shape of regular rods. Figure 3 is the local enlarged image of Au@Pt NRs. Figure 4 Energy-dispersive spectroscopy (EDX) and elemental mapping confirm that gold and platinum are the main components of Au@Pt NRs, and copper doping plays a key role in controlling their growth and shape. In Figure 5 Au@Pt NRs solution shows an obvious absorption peak at 725 nm. When H2O2 and TMB are both present, the solution becomes colorless. When Au@Pt NRs are added simultaneously, the solution changes from colorless to blue and shows an obvious absorption peak at 651 nm. From Figure 6 in, 4-MBA (1×10 -8 M)-labeled Au@Pt NRs can significantly enhance the Raman peak of 4-MBA, but the Raman signal intensity of 4-MBA is extremely low, proving that Au@Pt NRs have excellent SERS enhancement performance. The EF value of Au@Pt NRs is calculated by the formula: EF = IS / IR·CR / CS to be 1.2×10 7 .

[0090] Example 2

[0091] Preparation and Characterization of Au@Pt NRs@cDNA

[0092] 2.1) Dissolve 0.208 g of polyvinylpyrrolidone (PVP) in 6 mL of ultrapure water at 35 °C and stir until the solution becomes transparent. Then, quickly add 3 mL of PVP solution to 60 μL (50 mM) HAuCl4 solution and stir rapidly for 3 minutes to ensure thorough mixing of the two. Next, add 96 μL (15 mM) of freshly prepared AA solution to the mixed solution and continue stirring for 30 minutes until the solution turns dark purple.

[0093] 2.2) To ensure complete reaction, the mixture was allowed to stand at room temperature for 10 hours. After that, excess reactants were removed from the surface by centrifuging at 10,000 rpm for 18 minutes and washing three times each with absolute ethanol and deionized water. Finally, the product was dissolved in deionized water to obtain a gold nanohexagonal plate (AuNHs) solution.

[0094] 2.3) Take 2 mL of the AuNHs solution obtained in step 2.1) and 4 mL of n-hexane and add them to a beaker. Subsequently, add 2 mL of ethanol solution and let it stand for 180 seconds. At the oil-water interface, the AuNHs self-assembled to form a closely packed nano-film with metallic luster.

[0095] 2.4) Use piranha solution (formed by mixing concentrated sulfuric acid and 30% hydrogen peroxide in a ratio of 7:3) to completely remove all organic substances on the silicon wafer.

[0096] 2.5) Transfer the AuNHs monolayer film formed at the oil-water interface in step 2.3) to the silicon wafer treated in step 2.4) and dry it in a thermostat.

[0097] 2.6) Figure 7 The transmission electron microscope image of AuNHs in Figure 8 shows that individual AuNHs have regular morphology, sharp edges, good dispersibility, and can better capture miRNA. Figure 9 is the HRTEM image of AuNHs. Figure 10 The scanning electron microscope image of Figure 11 shows uniformly arranged and regularly shaped gold nanohexagonal plates. In addition, -2 is the Raman spectrum comparison between the AuNHs array labeled with 4-MBA (1×10 -8 M) and 4-MBA (1×10 8 M), with an EF = 1.8×10 Figure 12 indicating that the AuNHs array has a significant SERS enhancement effect. Figure 13 shows the SERS spectra at six randomly selected positions on the surface of the 4-MBA-labeled AuNHs array, which has high reproducibility. -1 The histogram in Figure 14 corresponds to the signal intensities at different positions at 1073 cm Figure 15The SERS spectra of the 4-MBA-labeled AuNHs arrays stored at room temperature for 0 days, 7 days, and 14 days are shown. Compared with the newly prepared arrays, the signal intensity on the array surface decreased, but this change gradually stabilized over time, indicating that the array has good stability.

[0098] Example 3

[0099] Optimized Preparation of a Bifunctional Nanozyme SERS Detection Platform

[0100] 1) Synthesize Au@Pt NRs as in Example 1.

[0101] 2) Synthesize AuNHs arrays as in Example 2.

[0102] 3) To link cDNA, mix 400 μL of cDNA (0.1 mM) with 40 μL of TCEP (1 M) solution and react at room temperature for 30 minutes to activate the nucleic acid aptamer. Couple the activated cDNA to the surface of the AuNHs array and incubate at 37 °C for 120 minutes to allow the cDNA to fully bind to the AuNHs surface. Rinse the array repeatedly with PBS buffer and deionized water, and finally add 15 mL of 1 wt% BSA to repair the non-specific binding sites on the particle surface to obtain a cDNA-functionalized AuNHs array (AuNHs@cDNA).

[0103] 4) Add 400 μL of H1 activated by TCEP (1 M, 40 μL) to the prepared Au@Pt NRs and incubate at 37 °C for 2 hours. Finally, add 100 μL of 1 wt% BSA solution to the solution to block the non-specific binding sites on the particle surface. Finally, centrifuge at 10,000 rpm for 10 minutes to remove excess reagents and nucleic acid chains to obtain H1-functionalized Au@PtNRs (Au@PtNRs@H1).

[0104] 5) Drop the prepared Au@Pt NRs@H1 onto the surface of the prepared cDNA-functionalized AuNHs array and place it in an incubator at 37 °C for 2 hours to prepare a SERS detection platform for detecting CI-related miRNA markers. The nucleotide sequence of H1 is SH-AAAAGTGCTT; the nucleotide sequence of cDNA is SH-CTACCTGCACTGTAAGCACTTTT; the target miRNA to be detected is miR-106a-5p, a biomarker of CI.

[0105] 6) This study analyzed the effects of temperature, pH, incubation time, TMB concentration, and H2O2 concentration to obtain the optimal performance of the nanozyme SERS detection platform. As Figure 16 、 17As shown, when the pH value and temperature of the experiment were set to 4.5 and 30 °C respectively, the signal intensity of the Au@Pt NRs-catalyzed oxidation of TMB to generate the oxTMB signal molecule was the highest at 1601 cm -1 . As shown in Figure 19 and 20 , when the TMB concentration was selected as 0.9 mM and the H2O2 concentration was 0.5 M for the experiment, the signal intensity of the Au@Pt NRs-catalyzed oxidation of TMB to generate the oxTMB signal molecule was the highest at 1601 cm -1 . In addition, the incubation time was also an important parameter affecting the target detection. As shown in Figure 18 , when the time was 20 min, the solution completely turned blue, and the signal intensity gradually stabilized. Figure 21 shows the peroxidase-like reaction kinetics of the Au@Pt NRs nanozyme. The Michaelis equation and double-reciprocal curve of this nanozyme were fitted, and Vmax = 0.5147 μM s -1 , Km = 0.275 mM, and it had excellent peroxidase activity. See Table 1.

[0106] Table 1. The 5′-3′ nucleotide sequences listed in Table 1 were used in the experiment

[0107] Name Sequence (5′-3′) miR-106a-5p AAAAGUGCUUACAGUGCAGGUAG cDNA SH-CTACCTGCACTGTAAGCACTTTT <![CDATA[H1]]> SH-AAAAGTGCTT MT1 AAAAGUGCUUAGAGUGCAGGUAG MT3 AAUAGACCUUACAGUGCAGGUAG Random sequence GGUUUACUUUAGAGACUAGAUC

[0108] Example 4

[0109] Platform specificity and reproducibility test of the bifunctional nanozyme SERS platform

[0110] 1) A bifunctional nanozyme SERS detection platform was prepared as in Example 3.

[0111] 2) Under the optimized experimental conditions, the reproducibility and specificity of the detection platform were evaluated in this study. As shown in Figure 22 , six nanozyme SERS detection platforms were prepared, and the SERS spectra of different batches of platforms were recorded. Figure 23 is Figure 22 the scatter plot of the average signal intensity at 1601 cm -1 , and RSD = 3.53%. Figure 24 and Figure 25 show the SERS spectra measured by using the nanozyme SERS detection platform to detect the target miR-106a-5p, with MT1, MT3, random RNA sequences, and blank as interferences. When the target was present, the SERS signal intensity decreased significantly. In contrast, when the interfering strand, random strand, and blank were present, the interfering strand, random strand, and blank all showed obvious SERS signals. This indicates that the SERS detection platform constructed in this study has good reproducibility and specificity.

[0112] Example 5

[0113] Quantitative detection of miR-106a-5p using a SERS detection platform

[0114] 1) A bifunctional nanozyme SERS detection platform was prepared in the same manner as in Example 3.

[0115] 2) Under the above optimized experimental conditions, the SERS platform was used to detect miR-106a-5p at different concentrations (10 -15 M - 10 -9 M) in serum. As Figure 26 shown, the platform detected miR-106a-5p in serum at different concentrations (concentration range from 10 -15 M to 10 -9 M). As Figure 26 shown, as the concentration of the target miRNA increased, Au@Pt NRs continuously detached from the platform, the concentration of the nanozyme continuously decreased, the oxidation of oxTMB gradually decreased, and the SERS signal gradually weakened. As Figure 27 shown, the SERS intensity of miR-106a-5p at 1601 cm -1 followed the linear regression equation y = -2949.16x - 23837.15 (R 2 = 0.9825). The LOD calculated according to this equation was as low as 0.96 fM, as shown in Table 2.

[0116] Table 2 Detection of biomarkers by different methods

[0117] Detection method Biomarker Detection limit Electrochemical method miR-21 2.6 fM Fluorescence detection method miR-21 0.1 pM Colorimetric method miR-148a 1.9 nM SERS miR-96-5p 3.7 fM SERS miR-106a-5p 0.96 fM

[0118] Example 6 Characterization of clinical samples

[0119] Samples from healthy individuals and patients with cerebral infarction were characterized by MRI. Figures 28 to 30 is the MRI image of a healthy individual, Figures 31 to 33 is the MRI image of the patient. As Figure 29 and Figure 32 shown, by comparing the DWI images of normal individuals, the DWI image of this patient showed patchy high signals in the left parietal lobe, indicating acute ischemia, cytotoxic edema, and restricted diffusion of water molecules in the brain tissue. Figure 28 and Figure 31 The apparent diffusion coefficient (ADC) is mainly used to describe the speed and range of molecular diffusion movement in DWI, and can quantitatively calculate the movement information of water molecules. It usually shows weakened signals and is lower than normal in the area of acute cerebral infarction. Figure 30 and Figure 33 are the fluid-attenuated inversion recovery sequence (FLAIR) of magnetic resonance imaging, where Figure 33It was shown that in addition to the acute cerebral infarction lesions, there were also scattered multiple ischemic infarction lesions in the bilateral parietal lateral ventricles, subcortical anterior parietal lobes and corona radiata of the patient.

[0120] Example 7

[0121] Detecting the content of miR-106a-5p in the sera of healthy people and cerebral infarction patients using a dual-functional nanozyme SERS detection platform

[0122] 1) A dual-functional nanozyme SERS detection platform was prepared in the same way as in Example 3.

[0123] 2) The SERS spectra of the sera of 15 healthy subjects and 15 cerebral infarction patients were tested using the dual-functional nanozyme SERS detection platform, and the miRNA content was calculated by substituting into the linear regression equation and the results were compared with those of qRT-PCR to analyze the reliability of this platform in detecting miR-106a-5p in real clinical samples. Figure 34 is the SERS spectrum of the serum of CI patients, Figure 35 is Figure 34 The histogram of the signal intensity at 1601 cm -1 . The results of detecting the content of miR-106a-5p by the SERS detection platform were compared with those of qRT-PCR (Table 3), and the relative error between the two was very small, proving that the dual-functional nanozyme SERS detection platform proposed in this study has high accuracy in detecting miR-106a-5p. Therefore, this dual-functional nanozyme SERS detection platform can be used as a reliable tool for biomarker detection and has good clinical application potential.

[0124] Table 3 Comparison of the expression levels of miR-106a-5p in the sera of cerebral infarction detected by SERS and qRT-PCR

[0125]

[0126] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A preparation method of a dual-functional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA, characterized in that: The preparation method of the dual-functional nanozyme SERS detection platform for ultrasensitive detection of miR-106a-5p associated with cerebral infarction comprises the following steps: 1) AuNRs were synthesized by seed-mediated method, and Pt was grown on the surface of the product to prepare Au@Pt NRs; 2) Synthesize gold nanohexagonal AuNHs using the seed growth method and prepare AuNHs arrays via oil-water interface self-assembly method; 3) The aptamer complementary chain H1 is modified on the Au@Pt NRs obtained in step 1) through Au-S bonds, and is combined with the assembled AuNHs array in step 2) of the aptamer cDNA functionalization corresponding to miR-106a-5p to construct a dual-functional nanozyme SERS detection platform.

2. Preparation method of a bifunctional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA according to claim 1, characterized in that: The specific implementation method of step 1) is: 1.1) AuNRs were synthesized by seed growth method: 200 μL chloroauric acid was added to 20 mL hexadecyltrimethylammonium bromide solution, followed by 1.2 mL sodium borohydride solution and stirring for 120 seconds. Then, the gold seed solution was allowed to stand at room temperature for 120 minutes. 1.2) Prepare a growth solution by mixing 4 mL of chloroauric acid, 4.4 mL of silver nitrate, 200 mL of hexadecyltrimethylammonium bromide, and 1.4 mL of ascorbic acid solution; 1.3) The growth solution prepared in step 1.2) was mixed with 2 mL of the gold seed solution and refluxed for 24 hours. Finally, AuNRs were obtained by centrifugation at 10,000 rpm for 12 minutes. 1.4) The AuNRs suspension was mixed with the H2PtCl6 solution, and then 0.6 mL of ascorbic acid solution was added to the mixture, and refluxed at room temperature for 180 min. Finally, the mixture was centrifuged at 10,000 rpm for 12 min to obtain Au@Pt NRs.

3. The preparation method of a bifunctional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA according to claim 2, characterized in that: In the step 1.4), the volume ratio of AuNRs to H2PtCl6 is 200:

1.

4. The preparation method of a bifunctional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA according to claim 1, wherein: The specific implementation method of step 2) is: 2.1) Dissolve 0.208 g of polyvinyl pyrrolidone in 6 mL of ultrapure water at 35°C and stir until the solution becomes transparent. Then, quickly add 3 mL of the polyvinyl pyrrolidone solution to 60 μg of chloroauric acid solution and stir rapidly for 3 minutes to ensure that the two are fully mixed. Next, add 96 μL of freshly prepared AA solution to the mixed solution and continue stirring for 30 minutes until the solution turns dark purple. 2.2) To ensure the complete reaction, the mixture was allowed to stand at room temperature for 10 hours, then centrifuged at 10,000 rpm for 18 minutes, and washed three times with anhydrous ethanol and deionized water to remove excess reactants from the surface. Finally, the product was dissolved in deionized water to obtain a gold nanohexagonal plate AuNHs solution; 2.3) Add the gold nanohexagonal plate AuNHs solution obtained in step 2.1) and n-hexane into a beaker, then add ethanol solution and let stand for 180 seconds. At the oil-water interface, AuNHs self-assemble to form a densely packed nanofilm with metallic luster; 2.4) Use piranha solution to completely remove organic matter on the silicon wafer; 2.5) Transfer the AuNHs monolayer film formed at the oil-water interface in step 2.3) onto the silicon wafer treated in step 2.4), and dry it in a thermostat.

5. The preparation method of a bifunctional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA according to claim 4, wherein: In step 2.3), the volume ratio of AuNHs, n-hexane, and ethanol is 1:2:

1.

6. The preparation method of a bifunctional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA according to claim 1, characterized in that: The specific implementation method of step 3) is as follows: 3.1) To ligate cDNA, mix 400 μL of cDNA with 40 μL of TCEP solution, and incubate at room temperature for 30 minutes to activate the nucleic acid aptamer; 3.2) Couple the activated cDNA in step 3.1) to the surface of the AuNHs array, and incubate at 37 °C for 120 minutes to allow the cDNA to bind completely to the AuNHs surface. Rinse the array repeatedly with PBS buffer and deionized water, and finally add 15 mL of 1 wt% BSA to repair the non-specific binding sites on the particle surface to obtain the cDNA-functionalized AuNHs array AuNHs@cDNA; 3.3) Add 400 μL of TCEP-activated H1 to the Au@Pt NRs prepared in step 1), incubate at 37 °C for 2 hours, and finally add 100 μL of 1 wt% BSA solution to the solution to block the non-specific binding sites on the particle surface. Finally, centrifuge at 10,000 rpm for 10 minutes to remove the excess reagents and nucleic acid strands to obtain the H1-functionalized Au@Pt NRs Au@PtNRs@H1; 3.4) Drop the Au@Pt NRs@H1 prepared in step 3.3) onto the surface of the cDNA-functionalized AuNHs array prepared in step 3.2), and place it in an incubator at 37 °C for 2 hours to prepare a dual-functional nanozyme SERS detection platform for detecting miRNA markers related to cerebral infarction. Among them, the nucleotide sequence of H1 is SH-AAAAGTGCTT; the nucleotide sequence of cDNA is SH-CTACCTGCACTGTAAGCACTTTT; the target miRNA to be detected is the biomarker miR-106a-5p of cerebral infarction.

7. A dual-functional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNAs, characterized in that: Prepared based on the preparation method of a dual-functional nanozyme SERS detection platform for ultrasensitive detection of miRNA related to cerebral infarction according to any one of claims 1-6.

8. A detection method for a dual-functional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA, based on the dual-functional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA described in claim 7, characterized in that: Including the following steps: 1) Prepare miR-106a-5p solutions with different concentrations respectively. Spot the miRNA solutions with different concentrations onto the SERS detection platform for detecting miRNA markers related to cerebral infarction prepared in claim 7, and place it in an incubator at 37°C for hybridization reaction. Use the characteristic peak of oxTMB at 1601 cm -1 as the fitting curve between the logarithm of the miR-106a-5p concentration and the SERS intensity; 2) Collect 15 clinical samples each from healthy people and patients with cerebral infarction. Drop the test solution, including a mixture of patient serum, H2O2, and TMB, onto the platform through a one-step operation, and place it at 30 °C for a hybridization reaction. miR-106a-5p in the serum will competitively bind to cDNA, and H1 will be forced to detach from the platform due to its weak binding force. This competition process causes the concentration of the nanozyme on the platform to be forced to decrease. Therefore, the amount of oxTMB decreases; 3) Perform SERS detection at room temperature, and substitute the characteristic peak intensity of the sample to be measured at 1601 cm -1 into the fitting curve determined in step 1) to measure the concentration of miR-106a-5p in the sample to be measured.

9. The detection method of a dual-functional nanozyme SERS detection platform for ultrasensitive detection of brain infarction-related miRNA according to claim 8, characterized in that: The concentration of the TMB solution is 0.9 mM, the concentration of the H2O2 solution is 0.5 M, and the incubation time is not less than 20 minutes.

Images