Nucleic acid aptamer, nucleic acid aptamer derivative and application thereof

Abstract

The invention belongs to the technical field of biomedical detection, and discloses a nucleic acid aptamer, a nucleic acid aptamer derivative and application thereof. An aptamer DNA long single chain targeting DLL3 is screened through an exponential enrichment systematic evolution (SELEX) technology, sequence optimization is performed on the aptamer DNA long single chain to obtain another two short chains, the aptamer can specifically target tumor cell surface DLL3, and the aptamer and small cell lung cancer cells SHP77, H69 and the like with high expression of the DLL3 have a specific targeting recognition effect. The invention also discloses screening and optimization of the nucleic acid aptamer. The nucleic acid aptamer has the advantages of being high in affinity and specificity, free of immunogenicity, simple and stable in chemical synthesis, easy to store and mark and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedical detection, and particularly relates to a nucleic acid aptamer specifically targeting Delta-like ligand 3, a nucleic acid aptamer derivative, and their applications. Background Art

[0002] Delta-like ligand 3 (DLL3) is a cell surface protein and is regarded as a selective marker for high-grade neuroendocrine tumors, which is characterized by low or no expression on the surface of normal adult human tissue cells. DLL3 expression is observed in more than 75% of patients with small cell lung cancer (SCLC), and the expression of DLL3 in SCLC exists in all disease stages and during the treatment process. Preclinical studies in mouse models have shown that DLL3 regulates SCLC tumor growth through the Snail pathway. Knockout of DLL3 results in reduced tumor proliferation, while overexpression of DLL3 usually promotes tumor proliferation. Secondly, in tumors with high expression of DLL3, the immune-related signaling pathways are inhibited. In mouse models, DLL3 is used as a target for radioimmunotherapy. The tumor selectivity of DLL3 expression has promoted the development of several DLL3-targeted therapies, and these treatment regimens are currently being clinically studied in patients with various high-grade neuroendocrine cancers.

[0003] SC16 is a humanized monoclonal antibody against DLL3 that can selectively bind to human and murine DLL3 and has been used for targeted therapy and molecular imaging in small cell lung cancer and neuroendocrine prostate cancer. Compared with traditional monoclonal antibodies, aptamers have advantages in tumor diagnosis and precision therapy. Aptamers are highly structured DNA or RNA fragments that can specifically bind to cellular target molecules, have high affinity, and specifically recognize one or a class of ligand molecules, and are called "chemically synthesized antibodies" (Chemical antibody). Since aptamers can form specific three-dimensional structures, such as hairpins, G-quadruplexes, etc., through intermolecular interactions such as van der Waals forces, hydrogen bonds, electrostatic interactions, and hydrophobic interactions, aptamers can achieve high-affinity and high-specific binding to target substances. Systematic Evolution of Ligands by Exponential enrichment (SELEX) technology is a technology for screening aptamers that can bind to target molecules efficiently and specifically. The aptamers screened by SELEX technology can bind to a wide range of target substances such as biomacromolecules, cells, viruses, bacteria, and tissues, and many aptamer sequences have been reported so far. The aptamers screened by SELEX technology have a similar ability to specifically recognize targets as monoclonal antibodies, but have the following advantages over antibodies: ① It belongs to an in vitro screening system and does not require immune cells or animals; ② It can be prepared by a large number of chemical syntheses with small batch-to-batch differences; ③ It has good stability and is easy to store and transport; ④ It has a small molecular weight (4-50 kDa); ⑤ It is easy to increase its serum stability by labeling, modification, structure modification, etc.; ⑥ It has low toxicity and no immunogenicity and can be administered locally or intravenously in large doses. Based on the above advantages, aptamers have been widely used in many fields such as disease diagnosis and treatment, drug screening, and molecular imaging.

[0004] At present, there is no research report on aptamers specifically targeting DLL3, and it is urgent to develop novel aptamers against DLL3 with high specificity and high stability for tumor diagnosis and treatment. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an aptamer specifically targeting Delta-like ligand 3, an aptamer derivative, and their applications. The aptamer described herein can specifically target DLL3 on the surface of tumor cells and has specific targeting recognition effects on small cell lung cancer cells SHP77, H69, etc. with high expression of DLL3. The present invention also discloses the screening and optimization of the aptamer. The aptamer has the advantages of high affinity and specificity, no immunogenicity, simple chemical synthesis, stability, easy storage and labeling, etc.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a nucleic acid aptamer specifically targeting Delta-like ligand 3, and its nucleotide sequence is selected from any one of the following: i. Nucleic acid aptamer D3A1, whose nucleotide sequence is as shown in SEQ ID NO:1; ii. Nucleic acid aptamer D3A2, whose nucleotide sequence is as shown in SEQ ID NO:2; iii. Nucleic acid aptamer D3A1T, whose nucleotide sequence is as shown in SEQ ID NO:3; iv. Nucleic acid aptamer D3A2T, whose nucleotide sequence is as shown in SEQ ID NO:4; v. An oligonucleotide sequence with a homology of more than 60% to any one of the nucleic acid aptamers described in i-iv; vi. A truncated sequence of the nucleic acid aptamer described in i or ii; vii. A DNA sequence hybridizing with any one of the nucleic acid aptamers described in i-iv; viii. An RNA sequence reverse transcribed from any one of the nucleic acid aptamers described in i-iv.

[0007] The present invention screened a long single-stranded DNA of a nucleic acid aptamer targeting DLL3 through the exponential enrichment system evolution (SELEX) technology, and optimized its sequence to obtain two other short strands. Through in vitro affinity detection and targeting detection at the level of small cell lung cancer tumor cells, and through a series of experiments, it was confirmed that the nucleic acid aptamer of the present invention can specifically target and recognize tumor cells with high expression of DLL3 such as SHP77 and H69, and can perform molecular diagnosis on tumors with high expression of DLL3 at the cellular level and in a tumor-bearing mouse model.

[0008] As a preferred embodiment of the nucleic acid aptamer specifically targeting Delta-like ligand 3 of the present invention, its nucleotide sequence is an oligonucleotide sequence with a homology of 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more than 99% to any one of the nucleic acid aptamers described in i-iv.

[0009] Preferably, the nucleic acid aptamer is in the form of a lyophilized powder; the nucleic acid aptamer of the present invention is synthesized by a solid-phase synthesis method, preferably in the form of a freeze-dried powder.

[0010] In a second aspect, the present invention provides a derivative of a nucleic acid aptamer specifically targeting Delta-like ligand 3, which is obtained by modifying any one of the nucleic acid aptamers described in i-iv above.

[0011] As a preferred embodiment of the nucleic acid aptamer derivative specifically targeting Delta-like ligand 3 according to the present invention, the modification includes labeling with a label or chemical modification.

[0012] As a further preferred embodiment of the nucleic acid aptamer derivative specifically targeting Delta-like ligand 3 according to the present invention, the label includes at least one of an isotope label, a fluorescent label, a biotin label, an enzyme label, and a chemiluminescent label.

[0013] As a further preferred embodiment of the nucleic acid aptamer derivative specifically targeting Delta-like ligand 3 according to the present invention, the chemical modification includes at least one of methylation modification, amination modification, thiolation modification, phosphorylation modification, thio modification, carboxylation modification, and isotopic modification.

[0014] In one embodiment, the nucleic acid aptamer derivative is a derivative of a nucleic acid aptamer obtained by labeling a cyanine dye group at the 5'-end of any one of the nucleic acid aptamers in i-iv.

[0015] Preferably, the nucleic acid aptamer derivative is a lyophilized powder; the nucleic acid aptamer derivative according to the present invention is synthesized by a solid-phase synthesis method, preferably in the form of a lyophilized powder.

[0016] In a third aspect, the present invention provides a reagent for detecting Delta-like ligand 3, comprising the nucleic acid aptamer and / or the nucleic acid aptamer derivative described above.

[0017] In a fourth aspect, the present invention provides a method for detecting Delta-like ligand 3, which comprises mixing a sample to be tested with the nucleic acid aptamer and / or the nucleic acid aptamer derivative described above, and detecting Delta-like ligand 3 in the sample.

[0018] In a fifth aspect, the present invention applies the nucleic acid aptamer, the nucleic acid aptamer derivative, and the reagent in the preparation of a product for detecting or purifying Delta-like ligand 3.

[0019] As a preferred embodiment of the application according to the present invention, the product includes at least one of a kit, a biosensor, and a detection chip.

[0020] In a sixth aspect, the present invention applies the nucleic acid aptamer, the nucleic acid aptamer derivative, and the reagent in the recognition and binding of non-therapeutic or diagnostic purposes and / or tumor cells, and in the preparation of drugs for diagnosing and / or treating tumors.

[0021] As a preferred embodiment of the application according to the present invention, the tumor is small cell lung cancer; the tumor cells are small cell lung cancer cells.

[0022] Compared with the prior art, the beneficial effects of the present invention are: The nucleic acid aptamer obtained by screening in the present invention has high affinity, no immunogenicity, can be chemically synthesized in vitro, has a small molecular weight, can be labeled or modified at different sites, and the nucleic acid aptamer sequence is stable and easy to preserve. Detecting the expression of Delta-like ligand 3 on the surface of tumor cells by using the nucleic acid aptamer of the present invention is efficient, simple and rapid in operation. The synthesis cost of the nucleic acid aptamer of the present invention is lower than the preparation cost of antibodies, has a short cycle and good repeatability. Brief Description of the Drawings

[0023] Figure 1 It is a schematic diagram of the SELEX screening principle in Example 1; Figure 2 It is the enrichment process of nucleic acid aptamers with the increase of screening rounds in Example 1; Figure 3 It is a schematic diagram of the preparation process of nucleic acid aptamers in Example 3; Figure 4 It is a high-resolution mass spectrum of nucleic acid aptamers in Example 3; Figure 5 It is the in vitro serum stability detection of nucleic acid aptamers in Example 4; Figure 6 It is the structure of nucleic acid aptamers in Example 5; Figure 7 It is the affinity detection (surface plasmon resonance SPR) of two long-chain nucleic acid aptamers in Example 6; Figure 8 It is the affinity detection (surface plasmon resonance SPR) of two truncated nucleic acid aptamers in Example 6; Figure 9 It is the western blot experimental result of DLL3 protein expression in small cell lung cancer tumor cells in Example 7; Figure 10 It is a high-resolution mass spectrum of nucleic acid aptamers labeled with cyanine dye groups in Example 8; Figure 11 It is the flow cytometry experimental result of nucleic acid aptamers recognizing small cell lung cancer cells SHP77 and H69 in Example 9; Figure 12 It is the confocal experimental result of nucleic acid aptamers recognizing small cell lung cancer cells SHP77 and H69 in Example 9; Figure 13 It is the flow cytometry detection result of the affinity of nucleic acid aptamers for small cell lung cancer cells SHP77 in Example 10; Figure 14 It is the in vivo fluorescence imaging result of nucleic acid aptamer D3A1T on small cell lung cancer SHP77 tumor-bearing mice in Example 11.

[0024] Figure 15Results of in vivo radionuclide imaging of the nucleic acid aptamer D3A1T in nude mice bearing small cell lung cancer cell line SHP77 in Example 11. Detailed implementation mode

[0025] In the present invention, the nucleic acid aptamer refers to an aptamer composed of nucleic acids, that is, a ligand molecule that uses the three-dimensional structure formed by the secondary structure and further the tertiary structure of single-stranded nucleic acids based on hydrogen bonds, etc. to firmly and specifically bind to the target substance and has the ability to specifically hinder or inhibit the physiological activity of the target substance. Nucleic acid aptamers are generally known as RNA aptamers composed only of RNA and DNA aptamers composed only of DNA, but the nucleic acids constituting the nucleic acid aptamers in this specification are not particularly limited. For example, it includes DNA aptamers, RNA aptamers, aptamers composed of a combination of DNA and RNA, aptamers containing modified nucleic acids in a part thereof, and aptamers composed only of modified nucleic acids. Preferably, it is a DNA aptamer. The nucleic acid refers to a biological macromolecule composed of nucleotides as constituent units in principle, and they are connected by phosphodiester bonds. It includes DNA formed by connecting deoxyribonucleotides having any one of adenine, guanine, cytosine, and thymine bases only, RNA formed by connecting ribonucleotides having any one of adenine, guanine, cytosine, and uracil bases only, or a combination thereof.

[0026] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0027] Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels. The nucleic acid aptamer sequences and nucleic acid aptamers labeled with cyanine dye groups in the examples were all synthesized by Shanghai Sangon Biotech Co., Ltd.; DLL3 protein was purchased from ABP Biosciences, and the product catalog number was RP02041; anti-Delta-like ligand 3 antibody was purchased from Abcam, and the product catalog number was ab229902; the washing buffer was a DPBS solution containing 5 mM MgCl2 and 4.5 mg / mL glucose; the binding buffer was prepared by adding 0.1 mg / mL tRNA and 1 mg / mL bovine serum albumin to the washing buffer.

[0028] Example 1: Screening of nucleic acid aptamers Couple DLL3 protein and HSA protein. Take 300 μL of carboxyl magnetic beads, wash them 4 times with ultrapure water, and discard the supernatant; add the prepared EDC and NHS (pre-mixed in advance), and incubate at room temperature for 15 - 20 min. Separate the magnetic beads with a magnetic separator, discard the supernatant, wash twice with DPBS, add 100 ug of protein (prepared with NaAC in advance), and incubate at room temperature for 20 - 60 min. Separate the magnetic beads with a magnetic separator and discard the supernatant. Add ethanolamine for blocking and incubate at room temperature for 5 - 10 min. Separate the magnetic beads with a magnetic separator, discard the supernatant, and wash 4 times with DPBS. Then further perform the iterative screening process (see Figure 1 ), taking the first round of screening as an example, the specific steps are as follows: (1) Take a dry powder of the Lib library (a random DNA sequence library with a base number of 76 bp), centrifuge at 14000 rpm for 5 - 10 min, add DPBS and vortex to dissolve, centrifuge at 14000 rpm for 5 - 10 min and then perform denaturation and renaturation (95℃ for 5 - 10 min, 4℃ for 10 - 20 min, equilibrate to room temperature); (2) Add the library to the positive - screening magnetic beads, slowly pipette and mix evenly with a pipette gun, and incubate at room temperature for 30 - 45 min; (3) Separate the magnetic beads with a magnetic separator, take the supernatant, add it to the positive - screening magnetic beads, incubate at room temperature for 30 - 45 min, and wash 3 times with DPBS; (4) Add ultrapure water to the magnetic beads and perform a boiling water bath for 5 - 10 min, separate the magnetic beads with a magnetic separator, and retain the supernatant; (5) Perform PCR amplification on the supernatant, and the number of cycles for each round of amplification is determined by denaturing PAGE; (6) After the amplification is completed, separate the single - strand by the streptavidin magnetic bead method; (7) Subsequent screening can be adjusted according to the screening results of each round, and the operation steps are the same as above.

[0029] Finally, as Figure 2 shown, measure the affinity of the library obtained from each round of screening by flow cytometry.

[0030] Finally, aptamers D3A1 and D3A2 with strong affinity are screened out, and their nucleotide sequences are as follows: The nucleotide sequence of D3A1 is: 5’-TCCAGCACTCCACGCATAACCCTGGGGGAGGGAGTTACGTTTGGGTGGGTCGAGGGGTTATGCGTGCTACCGTGAA-3’; The nucleotide sequence of D3A2 is: 5’-TCCAGCACTCCACGCATAACGGGGGTGGGGCTTTTAAATATGGTTGGGGGGGTCGAGTTATGCGTGCTACCGTGAA-3’。

[0031] Example 2: Optimization of Nucleic Acid Aptamer The primer-binding regions at both ends of the original sequence of the nucleic acid aptamer screened in Example 1 were removed by truncating the primer-end sequences.

[0032] The nucleotide sequence of D3A1 was removed from the 1st nucleotide at the 5' end including 1-11 nucleotides of the 1st nucleotide residue at the 5' end, and the nucleotide sequence of D3A1 was removed from the 1st nucleotide at the 3' end including 1-11 nucleotides of the 1st nucleotide residue at the 3' end. The nucleic acid aptamer composed of the remaining nucleotide residues was designated as D3A1T, and its nucleotide sequence was: 5’-ACGCATAACCCTGGGGGAGGGAGTTACGTTTGGGTGGGTCGAGGGGTTATGCGT-3’。

[0033] The nucleotide sequence of D3A2 was removed from the 1st nucleotide at the 5' end including 1-12 nucleotides of the 1st nucleotide residue at the 5' end, and the nucleotide sequence of D3A2 was removed from the 1st nucleotide at the 3' end including 1-12 nucleotides of the 1st nucleotide residue at the 3' end. The nucleic acid aptamer composed of the remaining nucleotide residues was designated as D3A2T, and its nucleotide sequence was: 5’-CGCATAACGGGGGTGGGGCTTTTAAATATGGTTGGGGGGGTCGAGTTATGCG-3’。

[0034] Example 3: Preparation of Nucleic Acid Aptamer The nucleic acid aptamers of Example 1 and Example 2 were synthesized by solid-phase synthesis. DNA containing a solid-phase carrier and protecting groups was synthesized by multi-step solid-phase synthesis, and finally the end product was obtained by ammonia deprotection and purification. The schematic of the preparation process is as Figure 3 shown. The oligonucleotide sequence was synthesized using the phosphoramidite technique in solid-phase synthesis.

[0035] The specific solid-phase synthesis method of this example is as follows: First, according to the scale, synthesis is carried out on a solid support (CPG carrier) made of controlled pore glass using a nucleic acid synthesizer; all phosphoramidite monomers can be removed under alkaline conditions; all phosphoramidite monomers are dissolved in anhydrous acetonitrile (100 mM), and molecular sieves are added for drying; an acetonitrile solution of 5-ethylmercapto-1H-tetrazole (0.6 M) is used as the activator solution; the coupling time is 200 seconds; for unreacted active groups, a mixed reagent of acetic anhydride, N-methylimidazole, pyridine, and acetonitrile (N-methylimidazole / acetonitrile is 1:4; acetic anhydride / pyridine / acetonitrile is 2:3:5) is used as the capping reagent for cleavage and deprotection of the oligomers bound to the solid support. Secondly, after the solid-phase synthesis is completed, the dried solid support is treated with an ammonia water solution at 55 °C for 16 hours, the solution is evaporated, and the solid residue is redissolved in water, and the target nucleic acid strand is obtained by HPLC purification. As Figure 4 shown, quality inspection is carried out using high-resolution mass spectrometry. The results show that the molecular weight of D3A1 is 23628.27 Da, the molecular weight of D3A2 is 23642.29 Da, the molecular weight of D3A1T is 16925.95 Da, and the molecular weight of D3A2T is 16322.57 Da, indicating that all DNA sequences are correct.

[0036] Example 4: In vitro serum stability detection of nucleic acid aptamers The stability of nucleic acid aptamers determines their subsequent practical application possibilities. The nucleic acid aptamers prepared in Example 1 and Example 2 are respectively dissolved in RPMI1640 medium containing 10% FBS, with a concentration of 3 μM, and divided into 8 tubes, which are incubated in a 37 °C incubator for 0 h, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, and 48 h respectively. Immediately after the incubation, they are placed in a 95 °C constant-temperature metal bath for denaturation for 5 minutes, cooled on ice, and then stored at -80 °C. After all samples are collected, agarose gel electrophoresis is run and imaged.

[0037] As Figure 5 shown, compared with the long-chain D3A1 and D3A2, the short-chain nucleic acid aptamers D3A1T and D3A2T obtained by truncation and optimization have relatively higher in vitro stability.

[0038] Example 5: Structure detection of nucleic acid aptamers G-quadruplexes as the three-dimensional structure of aptamers may be important because they improve the properties of nucleic acids, such as higher resistance to nuclease degradation. For the characterization of quadruplex types and their formation, circular dichroism (CD) spectroscopy is one of the most commonly used identification methods.

[0039] The aptamer samples of Example 1 and Example 2 obtained were placed in a thermostatic metal bath and heated at 95 °C for 5 minutes, then left standing at room temperature for 10 minutes at 4 °C and equilibrated to room temperature. The samples were diluted to 1 μM in DPBS (supplemented with 5 mM MgCl2) solution, and then scanned from 200 nm to 300 nm in a 1 mm, 400 μL detection dish (protected under nitrogen throughout the experiment).

[0040] As Figure 6 shown, the aptamers D3A1, D3A2, D3A1T, and D3A2T all have characteristic peaks of the G-quadruplex structure.

[0041] Example 6: Affinity Detection of Aptamers By SPR detection method, the affinity difference between the target protein and the aptamer was measured to evaluate the binding and dissociation kinetic characteristics of the aptamer and the target protein. The specific experimental steps are as follows: (1) Coupling of the target protein DLL3: Using a CM5 chip, a mixture of 50 mM N-hydroxysuccinimide (NHS) and 200 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) was injected for 7 minutes to activate the sensor surface. Then the target protein DLL3 was diluted to 30 μg / mL with 10 mM Acetate, pH 4.5, and fixed on the surface of the CM5 chip at a flow rate of 10 μL / min with a target coupling of 1000 RU. Finally, the surface was blocked with 1 M ethanolamine (pH 8.5).

[0042] (2) Test conditions for aptamers D3A1 and D3A2: The binding characteristics of the target protein DLL3 and D3A1, D3A2 were preliminarily determined and evaluated by manual mode. 800 nM was determined as the highest analysis concentration for D3A1 and D3A2, and 2-fold serial dilutions were made, with a total of 6 analysis concentrations. The concentration gradients were 0 nM, 50 nM, 100 nM, 200 nM, 400 nM, 800 nM. When analyzing the samples, the flow rate was set at 30 μL / min, the binding time was 120 s, and the dissociation time was 720 s.

[0043] (3) Test conditions for aptamer D3A1T: The binding characteristics of the target protein DLL3 and D3A1T were preliminarily determined and evaluated by manual mode. 200 nM was determined as the highest analysis concentration for D3A1T, and 2-fold serial dilutions were made, with a total of 9 analysis concentrations. The concentration gradients were 0 nM, 1.56 nM, 3.125 nM, 6.25 nM, 12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM. When analyzing the samples, the flow rate was set at 30 μL / min, the binding time was 120 s, and the dissociation time was 720 s.

[0044] (4)Test conditions for nucleic acid D3A2T: Manually determine and evaluate the binding characteristics of the target protein DLL3 and D3A2T. Determine 200 nM as the highest analytical concentration of D3A2T, and perform 2-fold serial dilution to set a total of 10 analytical concentrations. The concentration gradients are 0 nM, 0.78 nM, 1.56 nM, 3.125 nM, 6.25 nM, 12.5 nM, 25 nM, 50 nM, 100 nM, and 200 nM respectively. When analyzing samples, set the flow rate to 30 μL / min, the binding time to 120 s, and the dissociation time to 720 s.

[0045] (4)Determination of kinetic parameters: The experiment adopts multi-cycle operation, with the response signal plotted with the analysis time as the abscissa and the response value as the ordinate. The obtained data is fitted using the BIAcore T200 analysis software, and the fitting model used is the 1:1 Langmuir binding model to determine kinetic constants such as the binding rate constant, dissociation rate constant, and binding-dissociation constant.

[0046] As Figure 7 and Figure 8 shown, the binding-dissociation constants of the nucleic acid aptamers D3A1, D3A2, D3A1T, and D3A2T are 82.5 nM, 54.8 nM, 2.358 nM, and 2.668 nM respectively, and D3A1T has the highest affinity for the DLL3 protein.

[0047] Example 7: Detection of DLL3 protein expression in tumor cells Evaluate the expression of DLL3 in each cell line of small cell lung cancer for subsequent applications of nucleic acid aptamers. The protein expression of DLL3 is detected using western blot experiments, and whole cell extracts are obtained from the cell lines. Specifically as follows: Mix 20 μg of whole protein from small cell lung cancer cells SHP77 and H69 with protein loading buffer and boil at 100 °C for 10 minutes. Separate the proteins using a 10% SDS-AGE gel (constant voltage 100 V, 80 minutes). Transfer the proteins onto a PVDF membrane (Millipore) and further incubate with anti-DLL3 antibody. Immobilon Western Chemiluminescent HRP Substrate (Millipore) is used for chemiluminescent detection of proteins.

[0048] As Figure 9 shown, small cell lung cancer cells SHP77 and H69 highly express DLL3.

[0049] Example 8: Aptamer Labeled with Cyanine Dye Group The aptamers D3A1, D3A2, D3A1T, and D3A2T were labeled with the cyanine dye group Cy5 respectively. The specific steps are as follows: The dissolved Cy5 active ester (dissolved in DMSO, equivalent 10) was added to the amino-modified aptamer, and an appropriate amount of carbonate solution was added. The mixture was ultrasonically mixed until completely dissolved and reacted at 25 °C for 1 h. After the reaction, it was sent for HPLC purification to obtain the Cy5-fluorescently labeled aptamer.

[0050] As Figure 10 shown, mass spectrometry quality inspection confirmed each labeled aptamer derivative.

[0051] Example 9: Specific Target Recognition and Binding Experiment of Aptamer (1) Take each of the Cy5-labeled aptamers in Example 8, and then perform flow cytometry on the human SCLC cell lines SHP77 and H69. Respective cell lines (5×10 5 cells / tube) were collected, washed twice with washing buffer, and then incubated with the DNA aptamer (250 nM) in binding buffer at 4 °C for 30 minutes. After incubation, the samples were washed three times with washing buffer and then analyzed by the BD FACSVerse™ system.

[0052] (2) Use the Cy5-labeled aptamer in Example 8, and then perform confocal imaging detection on the human SCLC cell lines SHP77 and H69. Respective cell lines (5×10 5 cells / tube) were collected, washed twice with washing buffer, and then incubated with the DNA aptamer (250 nM) in binding buffer at 4 °C for 30 minutes. After incubation, the samples were washed three times with washing buffer and then imaged and recorded by a Leca Zeiss TCS SP8 confocal microscope.

[0053] Another control DNA strand (Con) with no binding ability and a control DNA strand of a random sequence (Lib) were used for comparison. The nucleotide sequence of Con is as shown in SEQ ID NO.5 (SEQ ID NO.5: CGTACGGTCGACGCTAGCTCTAACTGATTATTATTATTATTATTATT ATTCGGTTAGACACGTGGAGCTCGGATCC); the nucleotide sequence of Lib was obtained by randomly combining specific bases with a number of 76 during DNA synthesis without specifying the base type, resulting in a library with the same length but random sequences). The results are as Figure 11 and Figure 12As shown, the nucleic acid aptamers D3A1, D3A2, D3A1T, and D3A2T can all specifically target the human SCLC cell lines SHP77 and H69 with high DLL3 expression.

[0054] Example 10: Detection of the Affinity of Nucleic Acid Aptamers for Cell Surface DLL3 Flow cytometry can be used to make a relative quantitative assessment of the affinity of nucleic acid aptamers, that is, to determine their dissociation constants. Prepare the Cy5-labeled nucleic acid aptamers in Example 8 at gradient concentrations, and note to ensure that the final incubation volume is 200 μL. Collect SHP77 cells (5×10 5 cells / tube), wash the cells twice with the washing buffer, and then mix them with the pre-prepared nucleic acid aptamers at gradient concentrations in the binding buffer and incubate at 4°C for 30 minutes. After the incubation, wash three times with the washing buffer and then analyze the samples using the BD FACSVerse™ system.

[0055] The results are as Figure 13 shown. The dissociation constants of the nucleic acid aptamers D3A1, D3A2, D3A1T, and D3A2T are 114.4 nM, 104.6 nM, 30.6 nM, and 100.5 nM, respectively, which are consistent with the results in Example 6. D3A1T has the highest affinity for the DLL3 protein.

[0056] Example 11: Specific Recognition of Tumors in Tumor-Bearing Mice by Nucleic Acid Aptamer D3A1T Perform in vivo fluorescence imaging experiments and radionuclide imaging on the nucleic acid aptamer D3A1T in small animals, that is, the fluorescence and radionuclide imaging experiments for the specific recognition of subcutaneous small cell lung cancer by D3A1T.

[0057] (1) Model construction Construct an SHP77 tumor-bearing mouse model with high DLL3 expression. The model construction method includes the following steps: Use the human SCLC tumor cells SHP77 with high DLL3 expression determined by Western blot for subculture in advance; digest the cultured tumor cells and resuspend them in DPBS, then perform cell counting and mix them with Matrigel (Corning) at a ratio of 1:1. Place the mixed cell suspension on ice and perform tumor implantation as soon as possible; take 100 μL of the cell suspension (which contains 5×10 6 cells) and inject it into the right posterior flank of 5-week-old NZG mice (Vital River) to establish a subcutaneous xenograft tumor model. Measure the tumor size with a vernier caliper. The tumor volume (mm 3 ) is calculated as length × width 2 ×0.5. Wait for the tumor size to grow to 250 - 500 mm3 It can be used for in vivo imaging and a model has been successfully constructed.

[0058] (2) The successfully constructed SHP77 tumor-bearing mouse model was used to conduct small animal fluorescence in vivo imaging and PET imaging experiments respectively, which specifically included the following steps: For in vivo fluorescence imaging, 6 SHP77 tumor-bearing mice were prepared, and 1 nmol of Cy5-labeled D3AT1 was injected into each mouse via the tail vein; 30 min after the injection, the mice were completely anesthetized with isoflurane (concentration: 3%), and the mice were placed in a small animal in vivo fluorescence imager for imaging.

[0059] For PET imaging, 3 SHP77 tumor-bearing mice were prepared, and 150 uCi 68 of radioactively labeled D3A1T prepared with

[0060] The results of fluorescence imaging are as Figure 14 shown. Compared with the Cy5-labeled random sequence control strand (Cy5-Lib, the Lib sequence used is the aforementioned random sequence), Cy5-labeled D3A1T significantly targeted and accumulated in the tumor sites of SHP77 tumor-bearing mice. In vitro organ distribution showed that Cy5-D3A1T was mainly metabolized through the liver and kidneys, and accumulated in the remaining normal organs.

[0061] The PET imaging results of three SHP77 tumor-bearing mice (M1, M2, M3) are as Figure 15 shown. The short half-life radionuclide 68 Ga-labeled D3A1T significantly accumulated in the tumor, and most of the nucleic acid aptamers were cleared from the kidneys or livers, indicating that D3A1T can achieve specific in vivo targeting and recognition of DLL3-positive tumor cells.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A nucleic acid aptamer, characterized in that, Its nucleotide sequence is selected from any one of the following: i. The nucleic acid aptamer D3A1, whose nucleotide sequence is shown in SEQ ID NO:1; ii. The nucleic acid aptamer D3A2, whose nucleotide sequence is shown in SEQ ID NO:2; iii. The nucleic acid aptamer D3A1T, whose nucleotide sequence is shown in SEQ ID NO:3; iv. The nucleic acid aptamer D3A2T, whose nucleotide sequence is shown in SEQ ID NO:

4.

2. The nucleic acid aptamer according to claim 1, wherein Its nucleotide sequence is selected from any one of the following: vi. The truncated sequence of the nucleic acid aptamer described in i or ii; vii. The DNA sequence hybridized with the nucleic acid aptamer described in any one of i-iv; viii. The RNA sequence reverse transcribed from the nucleic acid aptamer described in any one of i-iv.

3. A nucleic acid aptamer derivative, characterized in that, It is obtained by modifying any one of the nucleic acid aptamers described in i-iv of claim 1.

4. The nucleic acid aptamer derivative according to claim 3, wherein The modification includes labeling with a label or chemical modification.

5. The nucleic acid aptamer derivative according to claim 4, wherein The label includes at least one of an isotope label, a fluorescent label, a biotin label, an enzyme label, and a chemiluminescent label; The chemical modification includes at least one of methylation modification, amination modification, mercaptan modification, phosphorylation modification, thiolation modification, carboxylation modification, and isotopic modification.

6. The nucleic acid aptamer derivative according to claim 3, wherein The nucleic acid aptamer derivative is a derivative of the nucleic acid aptamer obtained by labeling a cyanine dye group at the 5' end of the nucleic acid aptamer described in any one of i-iv of claim 1.

7. A reagent for detecting Delta-like ligand 3, characterized in that, It includes the nucleic acid aptamer described in claim 1 and / or the nucleic acid aptamer derivative described in any one of claims 3-6.

8. Use of the nucleic acid aptamer described in claim 1 or 2, the nucleic acid aptamer derivative described in any one of claims 3-6, or the reagent described in claim 7 in the preparation of a product for detecting or purifying Delta-like ligand 3.

9. The application according to claim 8, characterized in that, The product includes at least one of a kit, a biosensor, and a detection chip.

10. Use of the nucleic acid aptamer described in claim 1 or 2, the nucleic acid aptamer derivative described in any one of claims 3-6, and the reagent described in claim 7 in the recognition binding and / or tumor cells for non-therapeutic or diagnostic purposes, and in the preparation of a drug for diagnosing and / or treating tumors.

Images