A method for constructing a cloned cell line of mandarin fish brain cells

Abstract

The present invention discloses a method for constructing a cloned cell line of mandarin fish brain cells. In the present invention, the brain tissue of Siniperca chuatsi is subjected to primary culture using M199 medium. After several passages, a passaged cell line of mandarin fish brain is successfully constructed. Then, it is diluted and cultured using L15 cloning nutrient solution. After dilution culture, single cells in each well are cultured into cell colonies and then subjected to passage culture. Good growth states can be maintained during the passage process, and the cell morphologies are basically consistent. The cloned passaged cell line of mandarin fish brain obtained by single cell cloning can be passaged more than 50 generations. The cells cryopreserved in the original cell bank, master cell bank, and working cell bank can be normally passaged after resuscitation. Moreover, the constructed cloned passaged cell line of mandarin fish brain is sensitive to various aquatic viruses such as SGIV, SKIV, LMBV, ISKNV, and MSRV, and can provide a good cell platform for the isolation, identification, culture, and vaccine research of aquatic viruses. In addition, the construction method of the present invention is simple and has high repeatability.

Description

Technical Field

[0001] The present invention belongs to the technical field of cell culture, and particularly relates to a method for constructing a cloned cell line of mandarin fish brain cells. Background Art

[0002] Wolf, the originator of international fish passage cell lines, the establisher of the first fish cell line in the world (the gonadal cell line of stingray and trout RTG, 1962), and the recognized creator of fish cell culture methods. Since Wolf established the first fish cell line in the world, in the past more than 60 years, hundreds of cell lines of dozens of fish species have been successfully established globally. The research on fish cells started much later than that on other animal cells, but in the past 20 years, the research on fish cells has developed very rapidly.

[0003] A cell line refers to a cell population that proliferates after the primary cell culture is successfully passaged for the first time, or also refers to cultured cells that can be continuously passaged for a long time. Since there is no screening and purification, the cell types in the passaged cell line are heterogeneous, and the passaged cell line is only a certain dominant population. A cell strain is a cell population formed by the proliferation of a single cell through single-cell isolation culture or screening methods. Since it is formed by the division and proliferation of a single cell to form a cell population with the same genetic traits, it has very similar morphological characteristics and basically the same physiological and biochemical characteristics, and has great applications in aspects such as cell characteristics, genetics, functional research, and vaccine preparation.

[0004] Currently, the conventional single-cell isolation techniques mainly include the limited dilution method, the infinite dilution method, the cloning ring method, and the micromanipulation method. These four methods all have their advantages and disadvantages in operation, but their ultimate goal is to place a single cell for culture in a certain culture space. The difficulty lies in that in many cases, a single cell grows slowly or even cannot divide and proliferate, or starts to die after dividing and proliferating for several days, resulting in a very low cloning efficiency of the cells and being unable to obtain a stable single-cell clone.

[0005] There is relatively little research on the monoclonal culture of fish cells in China because the research on fish cells lags behind that on other animal cells. There are fewer researchers on fish cells, and there is no special research on the culture medium applied to fish cell culture, etc., which makes most of the current fish cell cultures limited to ordinary primary culture and passage culture. Therefore, so far, there has been no report in China on monoclonal passage cell lines obtained by single-cell cloning technology in fish cell culture. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for constructing a cloned passage cell line of mandarin fish brain.

[0007] The technical solution adopted by the present invention is:

[0008] In the first aspect of the present invention, there is provided a method for constructing a cloned and subcultured cell line of mandarin fish brain, comprising the following steps:

[0009] 1) Primary culture: Take fresh mandarin fish, take the brain tissue and disperse it into tissue blocks, digest the tissue blocks with digestive fluid and then add M199 nutrient solution for culture;

[0010] 2) Subculture: After the primary cells grow into a monolayer, add digestive fluid for digestion, then add M199 nutrient solution to disperse and suspend the cells, perform subculture, and continue to culture until a monolayer is formed;

[0011] 3) Single cell cloning:

[0012] S1 Dilution culture: Select the cells that have just grown into a monolayer, add digestive fluid for digestion, centrifuge to discard the supernatant, resuspend with L15 cloning nutrient solution and then perform dilution culture;

[0013] S2 Cell subculture: After the cells grow into a monolayer, add digestive fluid for digestion, then add L15 cloning nutrient solution to disperse and suspend the cells, and perform subculture.

[0014] In some embodiments of the present invention, the mandarin fish is soaked and disinfected with 70-75% alcohol for 2-3 minutes before taking the brain tissue.

[0015] In some embodiments of the present invention, after taking the brain tissue, it is washed 2-4 times with M199 medium containing antibiotics.

[0016] In some embodiments of the present invention, the tissue blocks are 0.3-0.5 cm 3 small brain tissue blocks.

[0017] In some embodiments of the present invention, the culture medium is changed every 2-5 days during the primary culture process.

[0018] In some embodiments of the present invention, the M199 nutrient solution is M199 medium containing 10-20 v / v% fetal bovine serum.

[0019] In some embodiments of the present invention, the M199 nutrient solution further contains 200-400 IU / ml penicillin and 200-400 μg / ml streptomycin.

[0020] In some embodiments of the present invention, during the subculture, subculture is performed at a ratio of 1:(2-5).

[0021] In some embodiments of the present invention, the digested cells in step S1 can be cryopreserved.

[0022] In some embodiments of the present invention, the cryopreservation solution used in the cell cryopreservation treatment is M199 medium containing 35-45 v / v% fetal bovine serum and 8-12 v / v% dimethyl sulfoxide.

[0023] In some embodiments of the present invention, after adding the cell cryopreservation solution, the cells are dispersed and suspended to make the cell concentration about (1-3)×10 6 cells / ml.

[0024] In some embodiments of the present invention, when diluting and culturing the cryopreserved cells, the cells should be thawed first, preferably thawed in a water bath at 28-32 °C.

[0025] In some embodiments of the present invention, the specific operation of the dilution culture is as follows: the cells are diluted to about 200 cells / mL, and after culturing for 20-28 hours, L15 cloning nutrient solution is supplemented and then the culture is continued; 1 / 2-1 / 3 of the L15 cloning nutrient solution is replaced every two days.

[0026] In some embodiments of the present invention, the L15 nutrient solution is L15 medium containing 10-20 v / v% fetal bovine serum.

[0027] In some embodiments of the present invention, after the cells are passaged 2-4 times, the cell culture solution can be replaced with L15 nutrient solution.

[0028] In some embodiments of the present invention, the digestive solution is 0.15-0.35% trypsin digestive solution.

[0029] In some embodiments of the present invention, the digestion conditions are 26-30 °C for 8-12 min.

[0030] In some embodiments of the present invention, the culture temperature is 26-30 °C.

[0031] In some embodiments of the present invention, the centrifugation conditions are 800-1500 rpm for 2-6 min.

[0032] In some embodiments of the present invention, single cell cloning is performed when most of the cell contours are clearly observed under the microscope during subculture.

[0033] In some embodiments of the present invention, the L15 cloning nutrient solution comprises: 10 - 30 v / v% fetal bovine serum, 10 - 15 v / v% M199 cell growth solution, 10 - 15 v / v% L15 cell growth solution, and 40 - 70 v / v% L15 medium; the L15 medium mainly contains various high-concentration amino acids and uses galactose as a carbon source, and its nutrition is richer than that of M199, which is suitable for the culture of rapidly proliferating cells. The M199 cell growth solution and the L15 cell growth solution are rich in various components beneficial to the cell adhesion and growth during the original cell culture process, which is more conducive to the proliferation and division of single cells and the formation of single-cell colonies in the later stage.

[0034] The preparation method of the M199 cell growth solution is as follows: resuspend the digested cells in step S1 with M199 nutrient solution, and collect the supernatant culture solution after forming a 70 - 90% confluent layer;

[0035] The preparation method of the L15 cell growth solution: resuspend the digested cells in step S1 with L15 nutrient solution, and collect the supernatant culture solution after forming a 70 - 90% confluent layer.

[0036] In some embodiments of the present invention, the M199 cell growth solution and the L15 cell growth solution need to be further filtered.

[0037] In some embodiments of the present invention, the filtration is filtration with a 0.1 - 0.45 μm filter membrane.

[0038] In the second aspect of the present invention, a Siniperca chuatsi brain cloned and subcultured cell line is provided, which was deposited at the Guangdong Provincial Microbial Culture Collection Center on June 28, 2022, with the deposit number GDMCC No: 62565, and the taxonomic name is Siniperca chuatsi brain cloned and subcultured cell line.

[0039] In the third aspect of the present invention, an application of the Siniperca chuatsi brain cloned and subcultured cell line described in the second aspect of the present invention in constructing a cell bank is provided.

[0040] In the fourth aspect of the present invention, an application of the Siniperca chuatsi brain cloned and subcultured cell line described in the second aspect of the present invention in the isolation of aquatic animal viruses is provided.

[0041] In some embodiments of the present invention, the aquatic animal virus is Epinephelus coioides ranavirus, Oplegnathus punctatus ranavirus, Micropterus salmoides ranavirus, Siniperca chuatsi infectious spleen and kidney necrosis virus, or Dicentrarchus labrax rhabdovirus.

[0042] In the fifth aspect of the present invention, an application of the Siniperca chuatsi brain cloned and subcultured cell line described in the second aspect of the present invention in the culture of aquatic animal viruses is provided.

[0043] In some embodiments of the present invention, the aquatic animal virus is grouper ranavirus, spotted knifejaw iridovirus, largemouth bass iridovirus, siniperca chuatsi infectious spleen and kidney necrosis virus or perch rhabdovirus.

[0044] The sixth aspect of the present invention provides the use of the siniperca chuatsi brain cloned and passaged cell line described in the second aspect of the present invention in the detection of aquatic animal viruses for non-diagnostic purposes.

[0045] In some embodiments of the present invention, the aquatic animal virus is grouper ranavirus, spotted knifejaw iridovirus, largemouth bass iridovirus, siniperca chuatsi infectious spleen and kidney necrosis virus or perch rhabdovirus.

[0046] The seventh aspect of the present invention provides the use of the siniperca chuatsi brain cloned and passaged cell line described in the second aspect of the present invention as a host cell for studying aquatic animal viruses.

[0047] In some embodiments of the present invention, the aquatic animal virus is grouper ranavirus, spotted knifejaw iridovirus, largemouth bass iridovirus, siniperca chuatsi infectious spleen and kidney necrosis virus or perch rhabdovirus.

[0048] The eighth aspect of the present invention provides the use of the siniperca chuatsi brain cloned and passaged cell line described in the second aspect of the present invention in screening and / or preparing drugs for preventing and / or treating aquatic animal viruses.

[0049] In some embodiments of the present invention, the aquatic animal virus is grouper ranavirus, spotted knifejaw iridovirus, largemouth bass iridovirus, siniperca chuatsi infectious spleen and kidney necrosis virus or perch rhabdovirus.

[0050] The ninth aspect of the present invention provides the use of the siniperca chuatsi brain cloned and passaged cell line described in the second aspect of the present invention as a biological model for drug screening, drug preparation, drug evaluation, gene screening and function analysis, pathogen function research, cell engineering breeding or immune-related functional gene research

[0051] In some embodiments of the present invention, the drug is a drug for preventing and / or treating diseases caused by aquatic animal viruses.

[0052] In some embodiments of the present invention, the drug is a vaccine.

[0053] In some embodiments of the present invention, the aquatic animal virus is grouper ranavirus, spotted knifejaw iridovirus, largemouth bass iridovirus, siniperca chuatsi infectious spleen and kidney necrosis virus or perch rhabdovirus.

[0054] The beneficial effects of the present invention are:

[0055] The present invention uses the ordinary culture medium M199 to perform primary culture on the brain tissue of Siniperca chuatsi. After several passages, a subculture cell line of Siniperca chuatsi brain is successfully constructed. After cryopreservation, it is resuscitated and diluted with L15 cloning nutrient solution for culture. After dilution culture, the single cells in each well are cultured into cell colonies and then subcultured. Good growth status can be maintained during the subculture process, and the cell morphology is basically the same. The Siniperca chuatsi brain clone subculture cell line obtained by single cell cloning can be subcultured for more than 50 generations. The cells cryopreserved in the original cell bank, basic cell bank and working cell bank can be normally subcultured after resuscitation, laying a foundation for related research on fish cell single cell clones. And the obtained Siniperca chuatsi brain clone subculture cell line SBCC was deposited on June 28, 2022 at the Guangdong Provincial Culture Collection Center of Microorganisms, No. 59 Building, 5th Floor, 100 Xianlie Middle Road, Guangzhou, with the deposit number GDMCC No: 62565 and the taxonomic name of Siniperca chuatsi brain clone subculture cell line.

[0056] Moreover, the Siniperca chuatsi brain clone subculture cell line constructed by the present invention is very sensitive to SGIV, SKIV, LMBV, ISKNV, MSRV viruses, which cover both marine and freshwater fish viruses. Therefore, it provides a good cell platform for the isolation, identification, culture, detection and vaccine research of marine and freshwater fish viruses.

[0057] The method for constructing the Siniperca chuatsi brain clone subculture cell line of the present invention is simple to operate, without any expensive instruments and reagents. Using subculture cells of different passages to perform single cell cloning according to the technical scheme of the present invention can prepare multi-well single cell clone communities with high cloning success rate and strong repeatability. Using this technical scheme can also be applied to construct clone subculture cell lines of other fish subculture cell lines established with M199 culture medium. Description of the Drawings

[0058] Figure 1 It is a figure of fibroblast-like cells in the early stage of the subculture cell line in Example 1.

[0059] Figure 2 It is that in Example 1, the outlines of most cells are very clear at the 35th passage of the subculture cell line.

[0060] Figure 3 It is the figure taken every day for the first 9 days of a single cell in well C8 under an inverted microscope in Example 1.

[0061] Figure 4 It is the cell number curve graph of a single cell in well C8 in the first 10 days in Example 1.

[0062] Figure 5 It is the cell morphology diagram of the Siniperca chuatsi brain clone subculture cell line SBCC in Example 1; Figure 5 A is the cell morphology diagram on the first day after the clone community in the 96-well plate is subcultured to the 24-well plate; Figure 5B is the monolayer cell morphology diagram of SBCC strain F0 during subculture; Figure 5 C is the monolayer cell morphology diagram of SBCC strain F50 during subculture.

[0063] Figure 6 It is the diagram of Comparative Example 3: Figure 6 A is the diagram with only 3 cells on the 8th day; Example 1 at the same stage is as Figure 6 C; Figure 6 B is the diagram of rounding, shrinking and dying starting from the 14th day; Example 1 at the same stage is as Figure 6 D.

[0064] Figure 7 It is the cytopathic effect (CPE) diagram of cells after virus infection in Example 3 and Example 4; Figure 7 A is the lesion diagram of SGIV-HN strain, Figure 7 B is the lesion diagram of SKIV-SD strain, Figure 7 C is the lesion diagram of LMBV, Figure 7 D is the lesion diagram of MSRV, Figure 7 E is the lesion diagram of ISKNV.

[0065] Figure 8 It is the karyotype analysis result diagram of the brain clone subculture cell line SBCC of mandarin fish. Detailed implementation manners

[0066] The following will clearly and completely describe the concept and the resulting technical effects of the present invention in combination with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts shall fall within the scope of protection of the present invention.

[0067] In the following examples, M199 culture medium, Leibovitz’s L-15 culture medium, 0.25% trypsin digestion solution and fetal bovine serum are all purchased from GIBCO Company. Penicillin and streptomycin are purchased from North China Pharmaceutical Company. The DNA extraction kit is purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. The virus nucleic acid extraction kit, PrimeScript TM One Step RT-PCR kit and Premix Taq TM enzymes are all purchased from Takara Biotechnology (Beijing) Co., Ltd. Mandarin fish are purchased from a farm in Foshan City, Guangdong Province.

[0068] The spotted knifejaw iridovirus SD strain of the present invention was isolated and identified by the Aquatic Animal Medicine Laboratory of the College of Ocean Sciences, South China Agricultural University ("Isolation, identification and genomic analysis of an ISKNV-type megalocytivirus from spotted knifejaw (Oplegnathus punctatus). " Aquaculture 532 (2021): 736032.), and this strain is currently preserved in the Aquatic Animal Medicine Laboratory of the College of Ocean Sciences, South China Agricultural University.

[0069] The Singapore grouper iridovirus SGIV-HN strain of the present invention was isolated and identified by the Aquatic Animal Medicine Laboratory of the College of Ocean Sciences, South China Agricultural University (Isolation and identifcation of Singapore grouper iridovirus Hainan strain (SGIV HN) in China. Archives of Virology (2019) 164: 1869–1872.)

[0070] Example 1 Construction of a mandarin fish brain cloned and passaged cell line

[0071] Including the following steps:

[0072] 1) Primary culture of mandarin fish brain tissue: Take one live mandarin fish (Siniperca chuatsi) weighing about 500 g, soak it in 75% alcohol for 2 - 3 minutes, then aseptically cut out the brain tissue, wash it 3 times with M199 medium containing 800 IU / ml penicillin and 800 μg / ml streptomycin, and cut it into small pieces of 0.5 cm 3 and then inoculate them into a 25 cm 2 cell culture flask. Drop 50 μl of 0.25% trypsin digestion solution on the tissue, place it at 28 °C for 10 minutes, and then add 7 ml of M199 nutrient solution (containing 20 v / v% fetal bovine serum, 200 IU / ml penicillin and 200 μg / ml streptomycin). Incubate in a 28 °C cell culture incubator, and change half of the cell culture medium every 3 days until the primary cells grow into a good monolayer.

[0073] Result: On the 2nd day of primary culture, cells could be seen migrating out of the brain tissue. On the 5th day, cell colonies were formed. On the 15th day, a cell monolayer was formed.

[0074] 2) Subculture: After the primary cells grew into a good monolayer, discard the cell culture medium, add 0.5 ml of 0.25% trypsin digestion solution and digest at 28 °C. After digestion, discard the digestion solution, add 2 ml of M199 nutrient solution (20 v / v% fetal bovine serum, 200 IU / ml penicillin and 200 μg / ml streptomycin) to disperse and suspend the cells. Take 1 ml of the cell suspension into a 25 cm 2 cell culture flask, and supplement with 6 ml of M199 nutrient solution. Incubate in a 28 °C cell culture incubator. When a good monolayer is grown, subculture the cells in the same method as above.

[0075] Results: In subsequent subcultures, the cells grew well and could be subcultured once every 3 - 5 days on average. After the content of fetal bovine serum was reduced, the cells did not show obvious discomfort in growth. The cell morphology in the early stage of F1 - F15 was fibroblast-like ( Figure 1 ), and when subcultured to the 35th passage, under an inverted microscope, the outlines of most cells were very clear ( Figure 2 ), and the cells were cryopreserved.

[0076] 3) Single-cell cloning:

[0077] A. Cell cryopreservation:

[0078] Select 3 flasks of F35 cells that have grown into a good monolayer, discard the cell culture medium, add 1 ml of 0.25% trypsin digestion solution to each and digest at 28 °C. After digestion, discard the digestion solution, add 12 ml of cell cryopreservation solution (L15 medium containing 40 v / v% fetal bovine serum and 10 v / v% dimethyl sulfoxide) to disperse and suspend the cells. Take 100 μl of the cell suspension, add 100 μl of 0.1% trypan blue staining solution, mix well, then pipette 20 μl onto a cell counting plate and count the cells on a countstar cell counter. Subsequently, dilute the cell concentration to 2×10 2 cells / ml with the cell cryopreservation solution, and aliquot into cell cryopreservation tubes, 1.5 ml / tube. Place the cryopreservation tubes in a programmable freezing container, leave them in an -80 °C refrigerator overnight and then transfer them to liquid nitrogen for storage. 6

[0079] B. Dilution culture:

[0080] a. Preparation of L15 cloning nutrient solution: Take out two cryopreserved tubes of F35 cells from liquid nitrogen, quickly agitate and melt them in warm water at 30 °C. After centrifuging at 1000 rpm for 3 minutes at room temperature, discard the supernatant. Resuspend one tube with 1 ml of L15 nutrient solution (containing 20 v / v% fetal bovine serum) and transfer it to a 25 cm 2 cell culture flask, and supplement with 6 ml of L15 nutrient solution; Resuspend the other tube with 1 ml of M199 nutrient solution (containing 20 v / v% fetal bovine serum) and transfer it to a 25 cm​2 In the cell culture flask, add 6 ml of M199 nutrient solution. After culturing the cells revived with M199 nutrient solution for 24 hours, aspirate the supernatant and filter it through a 0.22 μm filter to obtain M199 cell growth solution; after culturing the cells revived with L15 nutrient solution for 24 hours, aspirate the supernatant and filter it through a 0.22 μm filter to obtain L15 cell growth solution; 20 v / v% fetal bovine serum, 10 v / v% M199 cell growth solution, 10 v / v% L15 cell growth solution and 60 v / v% L15 medium are used to form L15 cloning nutrient solution.

[0081] b. Dilution operation: Take out a cryopreserved F35 generation cell from liquid nitrogen, quickly agitate and melt it in warm water at 30 °C. After centrifuging at 1000 rpm for 3 minutes at room temperature, discard the supernatant, add 1 ml of L15 cloning nutrient solution to disperse and suspend the cells. Take 100 μl of cell suspension and add 100 μl of 0.1% trypan blue staining solution. After mixing, aspirate 20 μl and transfer it to a cell counting chamber. Perform cell counting on a countstar cell counter. Subsequently, dilute the cell suspension to 200 cells / ml, aspirate the cell dilution to each well of a 96-well cell culture plate, 4 μl / well, and culture it in a cell incubator at 28 °C for 24 hours. Observe and record the well positions of single cells under an inverted microscope, and supplement 200 μl of L15 cloning nutrient solution to each well. Replace half of the L15 cloning nutrient solution every 2 days until a good cell colony grows and then proceed with subculture.

[0082] C. Subculture of cells after cloning: Discard the single-well cell culture medium, add 30 μl of 0.25% trypsin digestion solution and digest it at 28 °C. After digestion is complete, discard the digestion solution, add 100 μl of L15 cloning nutrient solution to disperse and suspend the cells, and then aspirate all of it into one well of a 24-well cell culture plate, and supplement 900 μl of L15 cloning nutrient solution; the cell morphology diagram on the first day after subculturing the cloned colonies from the 96-well plate to the 24-well plate is shown in Figure 5 A. The statistical results of cloning success rate are shown in Table 1.

[0083] Table 1 Statistical results of single-cell cloning success rate

[0084] Number of adherent holes Number of successfully cloned Cloning success rate Example 1 (L15 cloning nutrient solution) 28 / 96 19 / 28 68％ Comparative Example 1 (M199 nutrient solution) 13 / 96 0 / 13 0％ Comparative Example 2 (L15 nutrient solution) 10 / 96 0 / 10 0％ Comparative Example 3 (M199 cloning nutrient solution Ⅰ) 21 / 96 2 / 21 10％ Comparative Example 4 (M199 cloning nutrient solution Ⅱ) 22 / 96 7 / 22 32％

[0085] Until a good monolayer grows, discard the single-well cell culture medium, add 100 μl of 0.25% trypsin digestion solution and digest it at 28 °C. After digestion is complete, discard the digestion solution, add 500 μl of L15 cloning nutrient solution to disperse and suspend the cells, and then aspirate all of it into one well of a 6-well cell culture plate, and supplement 3 ml of L15 cloning nutrient solution.

[0086] After a good monolayer is grown, the cell culture medium of the single well is discarded, and 300 μl of 0.25% trypsin digestion solution is added for digestion at 28°C. After digestion, the digestion solution is discarded, and 1 ml of L15 nutrient solution (containing 15 v / v% fetal bovine serum) is added to disperse and suspend the cells, and then all of them are aspirated to 25 cm 2 For the cell culture flask, add 6 ml of L15 nutrient solution.

[0087] After the cells have grown into a good monolayer, the cell culture medium was discarded, and 0.5 ml of 0.25% trypsin digestion solution was added to digest at 28°C. After digestion, the digestion solution was discarded, and 2 ml of L15 nutrient solution (containing 10 v / v% fetal bovine serum) was added to disperse and suspend the cells. Then 1 / 3 of the cell suspension was pipetted onto a 25 cm 2 Add 6 ml of L15 nutrient solution (containing 10 v / v% fetal bovine serum) to the cell culture bottle. After the cells grow into a good monolayer again, subculture them to F55 using the same method as mentioned above. At this point, a monoclonal cell line of mandarin fish brain cells is established, and this generation of cells is recorded as the F0 generation of the SBCC strain. The SBCC strain F0 generation mandarin fish brain cloned cell line was preserved in the Guangdong Provincial Microbiological Culture Collection Center on June 28, 2022. The address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The preservation number is GDMCC No: 62565, and the taxonomic name is mandarin fish brain cloned cell line. The dense monolayer cell morphology of the SBCC strain F0 generation during the subculture process is shown in the figure. Figure 5 B.

[0088] Result 1: 24 hours after single cell cloning, single cells with clear outlines can be seen attached to the wall in multiple wells (28 / 96). Take the cell clone well at position C8 and take photos every day ( Figure 3 ): On the first day, a single cell can be seen attached to the wall; on the second day, a single cell can be seen dividing into two cells; on the third day, 8 cells can be seen; on the fourth day, 13 cells can be seen; on the fifth day, 23 cells can be seen; on the sixth day, 47 cells can be seen; on the seventh day, 93 cells can be seen; on the eighth day, 244 cells can be seen; on the ninth day, 524 cells can be seen; on the tenth day, more than 1,000 cells can be seen; on the 21st day, a good cell colony can be seen, and the subculture process can be carried out. Basically, most of the clone wells have good proliferation and division growth (28 / 28), and the number of cells in each cell clone well shows an exponential growth curve ( Figure 4 ), and each hole can form a larger area (about 0.16cm) within 3 weeks. 2 ) cell colonies (19 / 28). A large area (about 0.16 cm) was formed within 3 weeks. 2 ) cell colonies were used as the criterion for successful cloning.

[0089] Result 2: The cloned cell line of Siniperca chuatsi has been subcultured for more than 50 generations (see Figure 2 for the cell picture of F50 of SBCC strain).Figure 5 C), cells of each passage generation grew adherently, and the cell morphology was basically the same after passage, and it could be defined as a monoclonal passage cell line. The cells of SBCC strain F1 - F10 were cryopreserved in liquid nitrogen as the original cell bank of the mandarin fish brain cloned passage cell line SBCC, the cells of SBCC strain F11 - F20 were cryopreserved in liquid nitrogen as the basic cell bank of the mandarin fish brain cloned passage cell line SBCC, and the cells of SBCC strain F21 - F30 were cryopreserved in liquid nitrogen as the working cell bank of the mandarin fish brain cloned passage cell line SBCC.

[0090] In Comparative Example 1, M199 nutrient solution was used for cloning culture

[0091] It included the following steps:

[0092] 1) Primary culture of Siniperca chuatsi brain tissue: The method was the same as step 1) of Example 1.

[0093] 2) Subculture: The method was the same as step 2) of Example 1.

[0094] 3) Single - cell cloning:

[0095] A. Cell cryopreservation: The method was the same as step 3)A of Example 1.

[0096] B. Dilution culture:

[0097] a. Preparation of cloning nutrient solution: No cloning nutrient solution was required.

[0098] b. Dilution operation: The operation method was the same as the dilution operation of Example 1, but M199 nutrient solution (containing 20 v / v% fetal bovine serum) was used for culture.

[0099] Result: When using M199 nutrient solution for resuscitation and dilution culture, only a few wells (13 / 96) showed single cells with clear outlines adhering to the wall 24 hours after cloning, and none of them could proliferate and grow, and they gradually died as their morphology gradually unfolded. The statistical results of the cloning success rate are shown in Table 1.

[0100] In Comparative Example 2, L15 nutrient solution was used for cloning culture

[0101] It included the following steps:

[0102] 1) Primary culture of Siniperca chuatsi brain tissue: The method was the same as step 1) of Example 1.

[0103] 2) Subculture: The method was the same as step 2) of Example 1.

[0104] 3) Single - cell cloning:

[0105] A. Cell cryopreservation: The method was the same as step 3)A of Example 1.

[0106] B. Dilution culture:

[0107] a. Preparation of cloning nutrient solution: No cloning nutrient solution is required.

[0108] b. Dilution operation: The operation method is the same as the dilution operation in Example 1, but L15 nutrient solution (containing 20 v / v% fetal bovine serum) is used for cultivation.

[0109] Results: For resuscitation using L15 medium and cloning culture using L15 nutrient solution, only a few wells showed single cells with clear outlines attached to the wall (10 / 96) 24 hours after cloning, and none of them could proliferate and grow, and they gradually died as their morphology gradually unfolded. The results are compared with Comparative Example 1. The statistical results of the cloning success rate are shown in Table 1.

[0110] Comparative Example 3 uses M199 cloning nutrient solution I (containing 10 v / v% M199 cell growth solution) for cloning culture

[0111] including the following steps:

[0112] 1) Primary culture of mandarin fish brain tissue: The method is the same as step 1) in Example 1.

[0113] 2) Subculture: The method is the same as step 2) in Example 1.

[0114] 3) Single cell cloning:

[0115] A. Cell cryopreservation: The method is the same as step 3)A in Example 1.

[0116] B. Dilution culture:

[0117] a. Preparation of M199 cloning nutrient solution I: Take out a vial of cryopreserved cells from liquid nitrogen, quickly agitate and melt it in warm water at 30 °C, centrifuge at 1000 rpm for 3 minutes at room temperature, discard the supernatant, add 1 ml of M199 nutrient solution (containing 20 v / v% fetal bovine serum), resuspend, and transfer it to a 25 cm 2 cell culture flask, supplement with 6 ml of M199 nutrient solution, incubate at 28 °C, after 24 hours of culture, aspirate the supernatant, filter it through a 0.22 μm filter to obtain M199 cell growth solution, and add the M199 cell growth solution to M199 nutrient solution (containing 20 v / v% fetal bovine serum) at a volume ratio of 1:9 to form M199 cloning nutrient solution I.

[0118] b. Dilution operation: The operation method is the same as the dilution operation in Example 1, but the above-mentioned M199 cloning nutrient solution I is used for cultivation.

[0119] Results: Using the original M199 medium for resuscitation and M199 cloning culture solution I (containing 10 v / v% M199 cell growth solution) for single-cell cloning culture, single cells with clear outlines were visible adhering to the walls of the multi-well plates 24 hours after cloning (21 / 96). However, most single-cell wells could not divide and proliferate normally and gradually died as the cell morphology unfolded. Although some single-cell wells could divide and proliferate normally (8 / 21), the growth was extremely slow ( Figure 6 A: There were only 3 cells on the 8th day; Example 1 at the same time was as Figure 6 C), and then the cell morphology slowly began to shrink ( Figure 6 B: Shrinking and dying began on the 14th day; Example 1 at the same time was as Figure 6 D), and finally only 2 / 21 single-cell wells were successfully cloned within 3 weeks. It can be seen that using M199 cell growth solution can promote the adhesion and growth of single cells to a certain extent. The statistical results of the cloning success rate are shown in Table 1.

[0120] Comparative Example 4 used M199 cloning nutrient solution II (containing 10 v / v% L15 cell growth solution and 10 v / v% M199 cell growth solution) for cloning culture

[0121] including the following steps:

[0122] 1) Primary culture of mandarin fish brain tissue: The method was the same as step 1) of Example 1.

[0123] 2) Subculture: The method was the same as step 2) of Example 1.

[0124] 3) Single-cell cloning:

[0125] A. Cell cryopreservation: The method was the same as step 3)A of Example 1.

[0126] B. Dilution culture:

[0127] a. Preparation of M199 cloning nutrient solution II: Take out two cryopreserved cells from liquid nitrogen, quickly agitate and melt them in warm water at 30°C, centrifuge at 1000 rpm for 3 minutes at room temperature and then discard the supernatant. Add 1 ml of L15 nutrient solution (containing 20 v / v% fetal bovine serum) to one tube, resuspend it and transfer it to a 25 cm 2 cell culture flask, and supplement with 6 ml of L15 nutrient solution; add 1 ml of M199 nutrient solution (containing 20 v / v% fetal bovine serum) to the other tube, resuspend it and transfer it to a 25 cm 2In the cell culture flask, add 6 ml of M199 nutrient solution. After culturing the cells revived with M199 nutrient solution for 24 hours, aspirate the supernatant and filter it through a 0.22 μm filter to obtain M199 cell growth solution; after culturing the cells revived with L15 nutrient solution for 24 hours, aspirate the supernatant and filter it through a 0.22 μm filter to obtain L15 cell growth solution; 20 v / v% fetal bovine serum, 10 v / v% M199 cell growth solution, 10 v / v% L15 cell growth solution and 60 v / v% M199 medium are used to form M199 clone nutrient solution II.

[0128] b. Dilution operation: The operation method is the same as the dilution operation in Example 1, but use the above M199 clone nutrient solution II for culture (containing 10 v / v% L15 cell growth solution and 10 v / v% M199 cell growth solution).

[0129] Results: Using the original M199 medium for resuscitation and using M199 clone culture solution II (containing 10 v / v% L15 cell growth solution and 10 v / v% M199 cell growth solution) for single-cell cloning culture, single cells with clear outlines can be seen adhering to the wall in 24 hours after cloning in multiple holes (22 / 96). Although some single-cell holes can divide and proliferate normally (14 / 22), finally 7 / 22 single-cell holes are cloned successfully within 3 weeks. Thus, it can be seen that L15 cell growth solution also has a good promoting effect on the adhesion and growth of single cells. When L15 cell growth solution and M199 cell growth solution are used in combination, the promoting effect on the adhesion and growth of single cells is more obvious. The statistical results of the cloning success rate are shown in Table 1.

[0130] Example 2 Establishment of the original cell bank, basic cell bank and working cell bank of the cloned and subcultured cell line of mandarin fish brain

[0131] Take the cells F1 - F10 of the cloned and subcultured cell line of mandarin fish brain in Example 1 and store them in liquid nitrogen as the original cell bank of the cloned and subcultured cell line SBCC of mandarin fish brain, take the cells F11 - F20 and store them in liquid nitrogen as the basic cell bank of the cloned and subcultured cell line SBCC of mandarin fish brain, and take the cells F21 - F30 and store them in liquid nitrogen as the working cell bank of the cloned and subcultured cell line SBCC of mandarin fish brain.

[0132] (1) Cryopreservation of cells: Select a well-grown monolayer of 75 cm 2One bottle of cells. Discard the cell culture medium, add 1 ml of 0.25% trypsin digestion solution, and digest at 28 °C. After digestion, discard the digestion solution, add 4 ml of cell cryopreservation solution (L15 medium containing 40 v / v% fetal bovine serum and 10 v / v% dimethyl sulfoxide) to disperse and suspend the cells. Take 100 μl of cell suspension, add 100 μl of 0.1% trypan blue staining solution, mix well, aspirate 20 μl and transfer it to a cell counting chamber, and perform cell counting on a countstar cell counter. Subsequently, dilute the cell concentration to 1×10 6 cells / ml with cell cryopreservation solution, and aliquot into cell cryopreservation tubes, 1.5 ml / tube. Place the cryopreservation tubes in a programmable cooling box, place them in an -80 °C refrigerator overnight, and then transfer them to liquid nitrogen for storage.

[0133] (2) Cell recovery: Take out the cryopreserved cells from liquid nitrogen, quickly agitate and melt them in warm water at 30 °C. After centrifuging at 1000 rpm for 3 minutes at room temperature, discard the supernatant, add 1 ml of L15 nutrient solution (containing 10 v / v% fetal bovine serum), resuspend the cells, and transfer them to a 25 cm 2 cell culture flask. Supplement with 6 ml of L15 nutrient solution, and culture in a 28 °C cell incubator.

[0134] Example 3 Virus proliferation and infection experiment of mandarin fish brain cloned and passaged cell line

[0135] Take the F11, F21, and F50 cells of the SBCC strain of the mandarin fish brain cloned and passaged cell line in Example 1, as well as the F65 and F105 cells of the mandarin fish brain passaged cell line, and perform proliferation and infection tests with the SGIV-HN strain (Singapore grouper iridovirus) and the SKIV-SD strain (spotted knifejaw iridovirus), and measure the virus content of the propagated virus.

[0136] Virus proliferation and infection: Passage the cells into 8 25 cm 2 cell flasks. After growing into a good monolayer, randomly select 1 flask for counting. Subsequently, inoculate the above 2 viruses at a multiplicity of infection M0I = 0.005 into 6 flasks of cells with a good monolayer, 3 flasks / virus, and take another 1 flask as a blank control. When the cytopathic effect (CPE) reaches more than 80%, freeze-thaw at -20 °C or below and harvest the virus solution. Measure the virus content of the propagated virus and calculate the average virus titer of the 3 flasks of virus.

[0137] Virus content determination: Add the cell suspension to a 96-well cell culture plate, 100 μl / well (cell density is about 4×10 5 cells / ml), and culture in a 28 °C incubator for 24 hours to form a monolayer of cells. Take the virus solution, perform 10-fold serial dilutions with serum-free L15 medium, and take 10 -5 to 10 -8A total of 4 dilutions were inoculated into a 96-well cell culture plate with monolayer cells, 100 μl / well. Six wells were set for each dilution, and six normal cell control wells were also set. Finally, 100 μl of L15 maintenance medium supplemented with 4% fetal bovine serum was added to each well, and the culture was continued for 7 days to observe cytopathic effect, and the TCID was calculated by the Reed-Muench method. 50 。

[0138] Results: The virus titers of the SGIV-HN strain prepared from the brain clone passage cell lines of mandarin fish at each passage were much higher than those prepared from the brain passage cells of mandarin fish, about 1 titer higher. The virus titer of the SKIV virus prepared from the brain clone passage cell lines of mandarin fish was on average about 0.5 titer higher than that on the brain passage cells of mandarin fish. It can be seen that the brain clone passage cell lines of mandarin fish are significantly superior to the brain passage cell lines in virus infection. The virus titer results are shown in Table 2, and the cytopathic effect (CPE) is shown in Figure 7 A- Figure 7 B.

[0139] Table 2 Virus titers of the virus solutions obtained after cells were infected with the virus

[0140]

[0141]

[0142] Example 4 Experiment on isolation of pathological samples from brain clone passage cell lines of mandarin fish

[0143] (1) Source of pathological samples: Pathological sample 1 was from mandarin fish infected with the rhabdovirus MSRV in a perch farm in Guangdong, pathological sample 2 was from mandarin fish infected with the infectious spleen and kidney necrosis virus ISKNV in a mandarin fish farm in Guangdong, and pathological sample 3 was from perch infected with the largemouth bass iridovirus LMBV in a perch farm in Guangdong.

[0144] (2) Pathogen isolation: The spleen and kidney tissues of each pathological sample were mixed, added with L15 medium without serum, homogenized thoroughly, and repeatedly frozen and thawed 3 times at -20 °C, centrifuged at 5000 r / min for 10 minutes at 4 °C, the supernatant was filtered through a 0.22 μm filter, and the filtrate was stored at -20 °C for standby. After the SBCC strain F30 cells grew to a good monolayer, the above supernatant filtrate was inoculated into the cells at a volume ratio of 1:10, cultured at 28 °C, and after 7 days, the virus culture solution was collected, repeatedly frozen and thawed 3 times at -20 °C, and then the virus culture solution was blindly passaged 3 times on the SBCC strain cells.

[0145] (3) Virus identification: The virus solution of the above pathological sample 1 was harvested. After extracting the nucleic acid of the tissue with a virus nucleic acid extraction kit, reverse transcription was carried out using the PrimeScript TM One Step RT-PCR kit according to the instructions.

[0146] MSRV specific PCR identification primers:

[0147] Forward primer: ATAAGGGTAGTTGAGAAGAAG;

[0148] Reverse primer: CTTCTTGTTGCTCTTCTTAAA;

[0149] The expected amplified fragment size is 372 bp;

[0150] PCR amplification system:

[0151]

[0152] Reaction program: 50 °C for 30 min; 94 °C for 2 min; 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, 30 cycles;

[0153] The PCR products were observed by 1% agarose gel electrophoresis.

[0154] Harvest the virus solution of the above-mentioned diseased material 2, extract the DNA of the tissue with a DNA extraction kit, and then perform PCR amplification with Premix Taq TM enzyme.

[0155] ISKNV specific PCR identification primers:

[0156] Forward primer: ATGTCTGCAATCTCAGGTGCAAACG;

[0157] Reverse primer: TTACAGAGGGAAGCCTGCGGCGCCG;

[0158] The expected amplified fragment size is 1300 bp;

[0159] PCR amplification system:

[0160]

[0161] Reaction program: 94 °C for 5 min; 94 °C for 30 s, 56 °C for 30 s, 72 °C for 90 s, 30 cycles; 72 °C for 5 min.

[0162] The PCR products were observed by 1% agarose gel electrophoresis.

[0163] Harvest the virus solution of the above-mentioned diseased material 3, extract the DNA of the tissue with a DNA extraction kit, and then perform PCR amplification with Premix Taq TM enzyme.

[0164] LMBV specific PCR identification primers:

[0165] Forward primer: TTTCGGGCAGCAGTTTTCGGT;

[0166] Reverse primer: CCGTAGTTGGTGGAGCC;

[0167] The expected amplified fragment size is 1029 bp

[0168] PCR amplification system:

[0169]

[0170] Reaction program: 94°C for 5 min; 94°C for 30 s, 56°C for 30 s, 72°C for 90 s, 30 cycles; 72°C for 5 min.

[0171] The PCR products were observed by 1% agarose gel electrophoresis.

[0172] Results: For samples 1, 2, and 3, after blind passage in SBCC for 3 generations, obvious cytopathic effects were observed. After sequencing verification, they were identified as MSRV, ISKNV, and LMBV respectively. It was proved that MSRV virus, ISKNV virus, and LMBV virus could be successfully isolated using SBCC strain cells. CPE was seen Figure 7 C- Figure 7 E.

[0173] Example 5 Identification of the cloned and passaged cell line of mandarin fish brain

[0174] Karyological examination: Karyological examination was performed on cells of the cloned and passaged cell line F20, F50, and F60 of mandarin fish brain. The cells were transferred to 25 cm 2 culture flasks. When a 70% - 80% confluent layer was formed, colchicine with a final concentration of 0.2 μg / ml was added, and the cells were further cultured in a 28°C cell incubator for 6 hours. The cells were digested with 0.25% trypsin, washed once with sterile PBS, and then the cells were resuspended in freshly prepared 0.05% (w / v) KCl solution and hypotonic treated at 37°C for 30 minutes; centrifuged at 1000 r / min at room temperature for 5 minutes, and a fixative of methanol: glacial acetic acid in a ratio of 3:1 was added, gently shaken and resuspended, allowed to act at room temperature for 20 minutes, then centrifuged again at room temperature to collect the cells, and secondary fixation was performed with a new fixative. Clean glass slides were pre-cooled in a refrigerator below -20°C to form ice slides. The treated cells were aspirated and dropped onto the inclined ice slides from a height of about 60 cm, 1 drop per ice slide. After air-drying at room temperature naturally, the cells were treated with freshly prepared 10% Giemsa stain for about 15 - 30 minutes, rinsed with tap water, air-dried at room temperature, and observed, photographed, and counted under a phase contrast microscope. Chromosomes of 50 randomly selected cells from each passage were counted.

[0175] Results: Cytological examinations were performed on F20, F50, and F60. The results showed that in all the generations of cells examined, the chromosome mode was 46, the karyotypes of each generation did not change, and the karyotypes were the same. As Figure 8 。

[0176] The above specific embodiments have described the present invention in detail. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those of ordinary skill in the relevant art, various changes can be made without departing from the spirit of the present invention. In addition, without conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other.

Claims

1. A method for constructing a cloned and subcultured cell line of mandarin fish brain, comprising the following steps: 1) Primary culture: Take fresh mandarin fish, take the brain tissue and disperse it into tissue blocks, digest the tissue blocks with a digestive solution, and then add M199 nutrient solution for culture; 2) Subculture: After the primary cells grow into a monolayer, add a digestive solution for digestion, then add M199 nutrient solution to disperse and suspend the cells, perform subculture, and continue to culture until a monolayer is formed; 3) Single cell cloning: S1 Dilution culture: Select the cells that have grown into a monolayer, add a digestive solution for digestion, centrifuge to discard the supernatant, resuspend with L15 cloning nutrient solution and then perform dilution culture; S2 Cell subculture: After the cells grow into a monolayer, add a digestive solution for digestion, then add L15 cloning nutrient solution to disperse and suspend the cells, and perform subculture; The L15 cloning nutrient solution contains: 10 - 30 v / v% fetal bovine serum, 10 - 15 v / v% M199 cell growth solution, 10 - 15 v / v% L15 cell growth solution, and 40 - 70 v / v% L15 medium; The preparation method of the M199 cell growth solution is: Resuspend the digested cells in step S1 with M199 nutrient solution, and collect the supernatant culture solution after forming a 70 - 90% confluent layer; The preparation method of the L15 cell growth solution: Resuspend the digested cells in step S1 with L15 nutrient solution, and collect the supernatant culture solution after forming a 70 - 90% confluent layer; The M199 nutrient solution is M199 medium containing 10 - 20 v / v% fetal bovine serum; The L15 nutrient solution is L15 medium containing 10 - 20 v / v% fetal bovine serum.

2. According to the method described in claim 1, characterized in that, the M199 nutrient solution further contains 200 - 400 IU / ml penicillin and 200 - 400 μg / ml streptomycin.

3. According to the method described in claim 1, characterized in that, After the cells are subcultured 2 - 4 generations after cloning, the cell culture solution can be replaced with L15 nutrient solution.

4. According to the method described in claim 1, characterized in that, In the subculture, subculture is performed at a ratio of 1:(2 - 5).

5. According to the method described in claim 1, characterized in that, The digestive solution includes trypsin digestive solution; the digestion conditions are 26 - 30°C for 8 - 12 min.

6. According to the method described in claim 1, characterized in that, The culture temperature is 26 - 30°C.

7. According to the method described in claim 1, characterized in that, The centrifugation conditions are 800 - 1500 rpm for 2 - 6 min.

Images