A method for attenuating vesicular stomatitis virus, attenuated virus strain and application thereof

Abstract

The present invention discloses a method for attenuating vesicular stomatitis virus, an attenuated virus strain, and applications thereof. The method comprises deleting amino acids of varying numbers and positions in the amino acid sequence encoding the M protein of the vesicular stomatitis virus, and utilizing a reverse genetic manipulation system to obtain an attenuated vesicular stomatitis virus with the corresponding deletions. This method reduces the virulence of the vesicular stomatitis virus by deleting the M gene, laying the foundation for VSV to become a safer vaccine vector for emerging viral diseases and an oncolytic virus vector.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a method for attenuating vesicular stomatitis virus, an attenuated virus strain and an application thereof. Background Art

[0002] Vesicular stomatitis virus (VSV) is a typical non-segmented, enveloped, negative-strand RNA virus belonging to the genus Vesiculovirus in the family Rhabdoviridae. VSV offers the following advantages as a vaccine vector: it can induce strong cellular and humoral immunity, typically requiring only a single dose to produce robust protection; it has strong replication capacity and can grow at high titers on Vero cells; its genome can accommodate exogenous genes for at least 4.5 kb, and its structure allows for the insertion of exogenous genes at multiple sites. VSV also has the potential to be used as a novel cancer treatment.

[0003] The matrix protein (M) and glycoprotein (G) of VSV are the main pathogenic determinants of wild-type VSV and are also the main targets of attenuation. Moreover, a notable feature of the VSV virus is that the VSV virus particles have no particular selectivity for the type of glycoprotein that can enter the viral envelope. Therefore, glycoproteins of other viruses can be used to replace the G protein of VSV, ensuring the integrity of the VSV virus particles while also acting as antigens to stimulate the body's immune system. However, wild-type VSV is neurotoxic when injected intracranially, so attenuation is an important safety feature of VSV as a vaccine vector and oncolytic virus vector. How to obtain an attenuated virus strain of vesicular stomatitis virus has become an urgent problem that needs to be solved. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for attenuating vesicular stomatitis virus, an attenuated virus strain and its application. The present invention reduces the virulence of vesicular stomatitis virus by deleting the M gene, laying the foundation for VSV to become a safer vaccine vector and oncolytic virus vector for emerging viral diseases.

[0005] The technical solution adopted by the present invention to solve its technical problem is:

[0006] A method for attenuating a vesicular stomatitis virus comprises: deleting amino acids of different numbers and positions in the amino acid sequence of the M protein encoded by the vesicular stomatitis virus to obtain an attenuated vesicular stomatitis virus with the corresponding amino acid deletions.

[0007] The parent viruses targeted by the attenuation method include Vesicularstomatitis Indiana virus.

[0008] As a preferred embodiment, the amino acid deletions of different numbers and positions are selected from one of the following (a) to (l): (a) deletion of 3 amino acids at positions 33 to 35 of the M protein;

[0009] (b) 6 amino acids at positions 33 to 38 of the M protein are missing;

[0010] (c) 9 amino acids at positions 33 to 41 of the M protein are missing;

[0011] (d) 12 amino acids at positions 33 to 44 of the M protein are missing;

[0012] (e) 15 amino acids from positions 33 to 47 of the M protein are missing;

[0013] (f) 18 amino acids from positions 33 to 50 of the M protein are missing;

[0014] (g) 21 amino acids at positions 33 to 53 of the M protein are missing;

[0015] (h) 24 amino acids from positions 33 to 56 of the M protein are missing;

[0016] (i) 27 amino acids from positions 33 to 59 of the M protein are missing;

[0017] (j) 30 amino acids from positions 33 to 62 of the M protein are deleted;

[0018] (k) 18 amino acids from position 18 to 35 of the M protein are deleted;

[0019] (l) A total of 24 amino acids from positions 12 to 35 of the M protein are missing.

[0020] To attenuate the vesicular stomatitis virus, the present invention deletes amino acids in different numbers and positions in the amino acid sequence of the M protein encoded by the vesicular stomatitis virus. It was found that only by deleting a specific number of amino acids at specific positions can the basic function of the virus be not affected while achieving a sufficient attenuation effect, thereby obtaining a vesicular stomatitis virus strain with significantly reduced virulence, which can be used as a safer vaccine vector and oncolytic virus vector for emerging viral diseases.

[0021] As a preferred embodiment, the nucleotide sequence of the vesicular stomatitis virus M protein after amino acid deletion is shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13 or SEQ ID NO.14.

[0022] As a preferred embodiment, the amino acid sequence of the vesicular stomatitis virus M protein after amino acid deletion is shown as SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27 or SEQ ID NO.28.

[0023] A vesicular stomatitis attenuated virus strain prepared based on an attenuation method.

[0024] A plasmid for preparing a vesicular stomatitis attenuated virus strain, wherein the plasmid contains a nucleotide sequence of one of SEQ ID NO.3 to SEQ ID NO.14; or the plasmid contains an amino acid sequence of one of SEQ ID NO.17 to SEQ ID NO.28.

[0025] As a preferred embodiment, the basic plasmid used in the construction of the plasmid contains the nucleotide sequence shown in SEQ ID NO.29, or the basic plasmid used in the construction of the plasmid contains the amino acid sequence shown in SEQ ID NO.30.

[0026] A method for preparing a vesicular stomatitis attenuated virus strain based on an attenuation method and its use in preparing a vaccine vector or an oncolytic virus vector.

[0027] The beneficial effects of the present invention are as follows: the attenuated vesicular stomatitis virus strain obtained by the attenuation method of the present invention has good growth characteristics on Vero-E6 cells; the one-step virus growth curve shows that the attenuated virus strain and the parent virus strain have similar growth curves, and the virus titer is significantly lower than that of the parent virus strain; when cells are infected with the same dose and observed at the same time, it is found that the CPE produced by the cytopathic effect is significantly smaller than that of the parent virus VSV Indiana; and when Balb / C mice are immunized with intranasal drops, it is found that the virus strain is non-pathogenic to mice and has a smaller weight loss than that of the parent virus VSV Indiana. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 An agarose gel electrophoresis diagram of the amino acid-deficient plasmid provided by the present invention;

[0029] Figure 2 The agarose gel electrophoresis diagram of the RT-PCR identification of the M gene deleted vesicular stomatitis virus provided by the present invention;

[0030] Figure 3The first set of virus growth curves for the M gene-deficient vesicular stomatitis virus and the parent virus VSV-WT provided by the present invention; in the figure: Hours post-infection: hours after infection; Virus titers: virus titers;

[0031] Figure 4 A second set of virus growth curves for the M gene-deficient vesicular stomatitis virus and the parent virus VSV-WT provided by the present invention;

[0032] Figure 5 The third group of virus growth curves of the M gene-deficient vesicular stomatitis virus and the parent virus VSV-WT provided by the present invention;

[0033] Figure 6 The size of the lesions produced 24 hours after the M gene-deficient vesicular stomatitis virus and the parent virus VSV-WT were infected into Vero cells;

[0034] Figure 7 A comparison of the changes in mouse body weight 14 days after challenge with rVSV-GFP-MΔ1, rVSV-GFP-MΔ2, rVSV-GFP-MΔ3+15, rVSV-GFP-MΔ12, rVSV-GFP-MΔ15, rVSV-GFP-MΔ21, and the parental virus VSV-WT provided by the present invention; in the figure: Days post challenge: days after challenge; Weight: weight;

[0035] Figure 8 A comparison of the changes in mouse body weight 14 days after challenge with rVSV-GFP-MΔ1, rVSV-GFP-MΔ2, rVSV-GFP-MΔ3+21, rVSV-GFP-MΔ6, rVSV-GFP-MΔ24, rVSV-GFP-MΔ3 and the parental viruses VSV-WT and rVSV-GFP-MΔ3+15 provided by the present invention; in the figure: Days post challenge: days after challenge; Weight: weight; Figure 9 This is a comparison chart of the changes in mouse body weight 14 days after challenge with rVSV-GFP-MΔ1, rVSV-GFP-MΔ2, rVSV-GFP-MΔ9, rVSV-GFP-MΔ30, rVSV-GFP-MΔ18, rVSV-GFP-MΔ27 and the parental virus VSV-WT and rVSV-GFP-MΔ3+21 provided by the present invention. DETAILED DESCRIPTION

[0036] The present invention provides a method for attenuating vesicular stomatitis virus, comprising the steps of: deleting amino acids of varying numbers and positions in the amino acid sequence encoding the M protein of the vesicular stomatitis virus to obtain an attenuated vesicular stomatitis virus having the corresponding amino acid deletions. The present invention preferably utilizes a reverse genetics system to generate a series of random amino acid deletions in the M protein coding region, and then assesses the toxicity of the resulting randomly deleted viruses, which can enhance the safety of VSV as a vaccine vector or oncolytic virus vector.

[0037] In the present invention, the parent virus targeted by the attenuation method preferably includes Vesicular stomatitis Indiana virus (abbreviated as VSV-WT).

[0038] VSV M protein is a multifunctional protein that is responsible for ribonucleoprotein (RNP) condensation during viral assembly and plays a key role in viral budding, which is also the cause of cytopathic effect (CPE). We performed random amino acid deletions at different positions and in different numbers on the M gene: 1 amino acid was deleted at position 51 of the M protein coding region; 2 amino acids at positions 33 and 51; 34 amino acids at positions 2 to 35; 24 amino acids at positions 12 to 35; 18 amino acids at positions 18 to 35; 30 amino acids at positions 33 to 62; 40 amino acids at positions 33 to 72; 42 amino acids at positions 51 to 92; 48 amino acids at positions 93 to 140; 60 amino acids at positions 129 to 188; 36 amino acids at positions 177 to 212; and 41 amino acids at positions 189 to 229. Virus rescue using a reverse genetic operating system revealed that only viruses lacking specific amino acids at positions 12 to 35, 18 to 35, and 33 to 62 of the M protein coding region could be successfully rescued, while deletion mutants at other sites were not successfully rescued, indicating that the deletion of amino acids between positions 12 to 62 of the M protein coding region does not affect the basic function of the virus. On this basis, we conducted a more systematic and detailed study of amino acids 33 to 62 in the M protein coding region to explore the attenuating effect of missing amino acids in different numbers and positions on the virus.

[0039] In the present invention, the amino acid deletions of different numbers and positions are preferably selected from one of the following (a) to (l): (a) deletion of 3 amino acids at positions 33 to 35 encoding the M protein; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO.3; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO.17;

[0040] (b) 6 amino acids at positions 33 to 38 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO. 4; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO. 18;

[0041] (c) 9 amino acids from positions 33 to 41 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO.5; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO.19;

[0042] (d) 12 amino acids at positions 33 to 44 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO.6; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO.20;

[0043] (e) 15 amino acids from positions 33 to 47 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO. 7; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO. 21;

[0044] (f) 18 amino acids from positions 33 to 50 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown as SEQ ID NO.8; the amino acid sequence of the M gene after the deletion is shown as SEQ ID NO.22;

[0045] (g) 21 amino acids from positions 33 to 53 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO.9; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO.23;

[0046] (h) 24 amino acids from positions 33 to 56 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO. 10; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO. 24;

[0047] (i) 27 amino acids from positions 33 to 59 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO.11; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO.25;

[0048] (j) 30 amino acids from positions 33 to 62 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO.12; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO.26;

[0049] (k) 18 amino acids from positions 18 to 35 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown in SEQ ID NO.13; the amino acid sequence of the M gene after the deletion is shown in SEQ ID NO.27;

[0050] (1) A total of 24 amino acids from positions 12 to 35 encoding the M protein are deleted; the nucleotide sequence of the M gene after the deletion is shown as SEQ ID NO.14; the amino acid sequence of the M gene after the deletion is shown as SEQ ID NO.28.

[0051] The attenuated vesicular stomatitis virus strain obtained by the attenuation method of the present invention has good growth characteristics on Vero-E6 cells; the one-step growth curve of the virus shows that the attenuated virus strain and the parent virus strain have similar growth curves, and the virus titer is significantly lower than the parent virus strain; the same dose of infected cells, at the same time, found that the CPE produced by the cytopathic effect was significantly reduced relative to the parent virus VSV Indiana; and nasal immunization of Balb / C mice found that the virus strain was non-pathogenic to mice and had a small weight loss relative to the parent virus VSV Indiana. The present invention reduces the virulence of vesicular stomatitis virus by means of M gene deletion, laying the foundation for VSV to become a safer vaccine vector and oncolytic virus vector for emerging viral diseases.

[0052] The present invention also provides a vesicular stomatitis attenuated virus strain prepared by the attenuation method described in the above technical solution, wherein the vesicular stomatitis attenuated virus strain uses Vesicular stomatitis Indiana virus as the parent virus, and the amino acids encoding the M protein are deleted by one of the following (a) to (l):

[0053] (a) 3 amino acids at positions 33 to 35 of the M protein are missing;

[0054] (b) 6 amino acids at positions 33 to 38 of the M protein are missing;

[0055] (c) 9 amino acids at positions 33 to 41 of the M protein are missing;

[0056] (d) 12 amino acids at positions 33 to 44 of the M protein are missing;

[0057] (e) 15 amino acids from positions 33 to 47 of the M protein are missing;

[0058] (f) 18 amino acids from positions 33 to 50 of the M protein are missing;

[0059] (g) 21 amino acids at positions 33 to 53 of the M protein are missing;

[0060] (h) 24 amino acids from positions 33 to 56 of the M protein are missing;

[0061] (i) 27 amino acids from positions 33 to 59 of the M protein are missing;

[0062] (j) 30 amino acids from positions 33 to 62 of the M protein are deleted;

[0063] (k) 18 amino acids from position 18 to 35 of the M protein are deleted;

[0064] (l) A total of 24 amino acids from positions 12 to 35 of the M protein are missing.

[0065] In the present invention, the nucleotide sequence encoding the M protein of the attenuated vesicular stomatitis virus strain is shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13 or SEQ ID NO.14.

[0066] In the present invention, the amino acid sequence encoding the M protein of the attenuated vesicular stomatitis virus strain is shown as SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27 or SEQ ID NO.28.

[0067] The present invention also provides a plasmid for preparing an attenuated vesicular stomatitis virus strain, the plasmid comprising nucleotides as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, or SEQ ID NO.14, or the corresponding amino acids as shown in SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, or SEQ ID NO.28. The plasmid of the present invention is a plasmid with random amino acid deletions in the M gene. The present invention does not specifically limit the method for constructing the deletion plasmid, and conventional deletion plasmid construction methods well known to those skilled in the art can be used for construction. In the present invention, the basic plasmid used in the construction of the plasmid preferably contains the nucleotide sequence shown in SEQ ID NO. 29 or the corresponding amino acid sequence shown in SEQ ID NO. 30. The present invention is not particularly limited to the type of basic plasmid, as long as the basic plasmid contains the nucleotide or amino acid sequence shown in SEQ ID NO. 29 or the corresponding nucleotide or amino acid sequence shown in SEQ ID NO. 30.

[0068] The present invention also provides primers for constructing the plasmid described in the above technical solution, and the nucleotide sequences of the primers are shown in SEQ ID NOs. 31 to 48.

[0069] The present invention also provides the use of the attenuation method described in the above technical solution, the attenuated vesicular stomatitis virus strain described in the above technical solution, or the plasmid described in the above technical solution in reducing the virulence of vesicular stomatitis virus, making VSV a safer vaccine vector and oncolytic virus vector.

[0070] The attenuation method of vesicular stomatitis virus M gene deletion and its application of the present invention are further introduced in detail below with reference to specific examples. The technical solutions of the present invention include but are not limited to the following examples.

[0071] Example 1

[0072] Construction of amino acid deletion plasmid of vesicular stomatitis virus M gene

[0073] A plasmid containing the full-length genome of the Indiana strain of vesicular stomatitis virus (VSV) expressing green fluorescent protein (GFP) was extracted (the method for constructing this plasmid is not particularly limited in the present invention; a plasmid containing the full-length genome of the Indiana strain of VSV expressing GFP can be constructed using conventional plasmids known to those skilled in the art (e.g., pBeloBAC11 or pBluescript), GFP protein, and the full-length VSV genome according to conventional recombinant plasmid construction methods). PCR amplification was performed using a series of amino acid deletion primers (primer sequences are shown in Table 1). After the molecular weight was confirmed to be correct by agarose gel electrophoresis, the target band was recovered and recombined at 50°C for 15 minutes. The recombinant product was transformed into Escherichia coli competent cells, colonies were picked and sequenced to verify its correctness, and the deletion plasmids VSV-GFP-MΔ1, VSV-GFP-MΔ2, VSV-GFP-MΔ3, VSV-GFP-MΔ6, VSV-GFP-MΔ9, VSV-GFP-MΔ12, VSV-GFP-MΔ15, VSV-GFP-MΔ18, VSV-GFP-MΔ21, VSV-GFP-MΔ24, VSV-GFP-MΔ27, VSV-GFP-MΔ30, VSV-GFP-MΔ3+15, and VSV-GFP-MΔ3+21 were successfully prepared using the endotoxin-free mini-preparation kit (Tian Gen, DP118-02) (the agarose gel electrophoresis diagram of the plasmid is shown in Figure 2). Figure 1 shown).

[0074] Among them, VSV-GFP-MΔ1 and VSV-GFP-MΔ2 are control schemes. VSV-GFP-MΔ1: one amino acid at position 51 of the M protein coding region is deleted; the nucleotide sequence of the encoding gene is shown in SEQ ID NO.1; the amino acid sequence of the encoding gene is shown in SEQ ID NO.15; VSV-GFP-MΔ2: two amino acids at positions 33 and 51 of the M protein coding region are deleted; the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2; the amino acid sequence of the encoding gene is shown in SEQ ID NO.16.

[0075] Table 1 Specific primer sequences

[0076]

[0077] Example 2

[0078] Rescue and verification of vesicular stomatitis virus with M gene deletion

[0079] BHK21 cells (purchased from Shanghai Jiao Tong University) were plated in 6 cm culture dishes. When the cell density reached about 70%, poxvirus (purchased from Shanghai Jiao Tong University) was taken to infect BHK21 cells. After 1 h of infection, the supernatant was discarded and serum-free DMEM medium was added. The M gene deletion series plasmids and auxiliary plasmids pBS-N, pBS-P, and pBS-L constructed in Example 1 were co-transfected into BHK21 cells. The medium was changed 4 h after transfection. After 48 h of culture, the culture dish was frozen and thawed, filtered with a 0.22 μm filter membrane, and inoculated into Vero cells. The fluorescence and cytopathic effect were observed, and the virus solution was harvested by freeze-thaw centrifugation after 100% fluorescence and cytopathic effect were observed. The corresponding names and corresponding amino acid deletions are shown in Table 2.

[0080] Table 2 Virus names and corresponding amino acid deletions

[0081] Virus name Corresponding amino acid deletion rVSV-GFP-MΔ1 The deletion of amino acid 51 encoding the M protein rVSV-GFP-MΔ2 The deletion of two amino acids at positions 33 and 51 encoding the M protein rVSV-GFP-MΔ3 The deletion of 3 amino acids at positions 33 to 35 encoding the M protein rVSV-GFP-MΔ6 The deletion of 6 amino acids at positions 33 to 38 encoding the M protein rVSV-GFP-MΔ9 The deletion of 9 amino acids from position 33 to 41 encoding the M protein rVSV-GFP-MΔ12 The deletion of 12 amino acids at positions 33 to 44 encoding the M protein rVSV-GFP-MΔ15 The deletion of 15 amino acids from positions 33 to 47 encoding the M protein rVSV-GFP-MΔ18 The deletion of 18 amino acids from positions 33 to 50 encoding the M protein rVSV-GFP-MΔ21 The deletion of 21 amino acids from positions 33 to 53 encoding the M protein rVSV-GFP-MΔ24 The deletion of 24 amino acids from positions 33 to 56 encoding the M protein rVSV-GFP-MΔ27 The deletion of 27 amino acids from positions 33 to 59 encoding the M protein rVSV-GFP-MΔ30 The deletion of 30 amino acids from position 33 to 62 encoding the M protein rVSV-GFP-MΔ3+15 The deletion of 18 amino acids from positions 18 to 35 encoding the M protein rVSV-GFP-MΔ3+21 The deletion of 24 amino acids from positions 12 to 35 encoding the M protein .

[0082] The viral RNA was extracted using EZNA Viral RNA Kit (Omega, R6874-01) and amplified by RT-PCR using the primers in Table 3. The molecular weight was confirmed by agarose gel electrophoresis ( Figure 2 ), and the PCR products were sequenced, indicating that the virus harvested was the vesicular stomatitis virus with the corresponding amino acid deletion.

[0083] Table 3 Identification primer sequences

[0084] Primer name Primer sequence (5′-3′) VSV-SH-P-F682 agaggagagttcatctctg(SEQ ID NO.49) VSV-GFP-R39 caccaccccggtgaacagctcctcg(SEQ ID NO.50) .

[0085] Example 3

[0086] Determination of the titer of vesicular stomatitis virus with M gene deletion

[0087] Vero cells were plated in 96-well plates. After the cells grew into a monolayer, 50 μL of M gene-deficient vesicular stomatitis virus was added to 450 μL of 2% FBS DMEM and shaken to mix well as system 1. The final concentration was 10 -1 ; Take out 50 μL from system 1 and add it to 450 μL 2% FBS DMEM, shake and mix it as system 2, and the final concentration is 10 -2 ; Similarly, the virus solution was diluted 10 times continuously until it was 10 -10 Then discard the culture medium in the 96-well plate, wash the plate with PBS, add 100 μL of the corresponding dilution of virus solution to each well, repeat 3 times for each gradient, culture in a cell culture incubator at 37°C and 5% CO2 for 48 hours, observe the fluorescence, and calculate the TCID using the Reed-Muench method.50 , virus titers are shown in Table 4.

[0088] Table 4 Summary of M gene-deleted vesicular stomatitis virus titers

[0089] Virus name <![CDATA[Virus titer (TCID 50 / ml)]]> rVSV-GFP-MΔ1 <![CDATA[10 9.5 ]]> rVSV-GFP-MΔ2 <![CDATA[10 8.75 ]]> rVSV-GFP-MΔ3 <![CDATA[10 9.5 ]]> rVSV-GFP-MΔ6 <![CDATA[10 9.5 ]]> rVSV-GFP-MΔ9 <![CDATA[10 8.5 ]]> rVSV-GFP-MΔ12 <![CDATA[10 9.25 ]]> rVSV-GFP-MΔ15 <![CDATA[10 8.5 ]]> rVSV-GFP-MΔ18 <![CDATA[10 8.75 ]]> rVSV-GFP-MΔ21 <![CDATA[10 9.25 ]]> rVSV-GFP-MΔ24 <![CDATA[10 8.5 ]]> rVSV-GFP-MΔ27 <![CDATA[10 6.75 ]]> rVSV-GFP-MΔ30 <![CDATA[10 6.5 ]]> rVSV-GFP-MΔ3+15 <![CDATA[10 10.5 <!-- 7 -->]]> rVSV-GFP-MΔ3+21 <![CDATA[10 9.5 ]]> .

[0090] Example 4

[0091] Determination of the Growth Curve of M Gene-deleted Vesicular Stomatitis Virus

[0092] Vero cells were plated in 48-well plates. After the cells grew into a full monolayer, the M gene-deficient vesicular stomatitis virus rVSV-GFP-MΔ1, rVSV-GFP-MΔ2, rVSV-GFP-MΔ3, rVSV-GFP-MΔ6, rVSV-GFP-MΔ9, rVSV-GFP-MΔ12, rVSV-GFP-MΔ15, rVSV-GFP-MΔ18, rVSV-GFP-MΔ21, rVSV-GFP-MΔ24, rVSV-GFP-MΔ27, rVSV-GFP-MΔ30, rVSV-GFP-MΔ3+15, rVSV-GFP-MΔ3+21 and the parental virus VSV-WT strain were inoculated with a multiplicity of infection (MOI) of 0.001 into the cells, and three replicates were performed. The cells were cultured in a 37°C, 5% CO2 incubator. The virus was harvested at 24, 48, 72, and 96 hours after infection. The virus solution harvested at different time points was serially diluted 10-fold, with three replicates for each dilution. The virus was inoculated into Vero cells grown to a monolayer in a 96-well plate and cultured in a cell culture incubator at 37°C and 5% CO2 for 48 hours. The fluorescence was observed and the TCID was calculated using the Reed-Muench method. 50 After the data analysis is completed, the growth curve of the M gene-deficient vesicular stomatitis virus is drawn ( Figure 3-Figure 5 ),from Figure 4 As can be seen from the figure, rVSV-GFP-MΔ3 and VSV-WT exhibited nearly identical growth characteristics, reaching peak viral titers 48 hours after infection. Furthermore, with the exception of rVSV-GFP-MΔ27 and rVSV-GFP-MΔ30, all deletion viruses maintained high titers and exhibited weaker growth relative to VSV-WT. These results suggest that M gene deletion can weaken VSV replication.

[0093] Example 5

[0094] Plaque size of M gene-deficient vesicular stomatitis virus

[0095] Vero cells were plated in 6-well plates, and after the cells grew into a full monolayer, the M gene-deficient vesicular stomatitis virus rVSV-GFP-MΔ1, rVSV-GFP-MΔ2, rVSV-GFP-MΔ3, rVSV-GFP-MΔ6, rVSV-GFP-MΔ9, rVSV-GFP-MΔ12, rVSV-GFP-MΔ15, rVSV-GFP-MΔ18, rVSV-GFP-MΔ21, rVSV-GFP-MΔ24, rVSV-GFP-MΔ27, and rVSV- GFP-MΔ30, rVSV-GFP-MΔ3+15, rVSV-GFP-MΔ3+21 and the parent virus VSV-WT were inoculated into cells at a multiplicity of infection (MOI) of 0.001 and cultured in a 37°C, 5% CO2 incubator for 6 h. The virus solution was discarded and 1% low-melting-point agarose was added. After solidification, the cells were cultured in a 37°C, 5% CO2 incubator for 48 h. The cells were fixed with 4% paraformaldehyde at room temperature for 30 min. After discarding the paraformaldehyde, the cells were stained with crystal violet at room temperature for 20 min. The agarose was discarded, the cells were washed and photographed ( Figure 6 ).from Figure 6 It can be seen that the plaques produced by infection with the M gene-deficient vesicular stomatitis virus rVSV-GFP-MΔ1 and rVSV-GFP-MΔ2 were significantly larger than those of VSV-WT, indicating that the attenuation effect of the corresponding M gene deletion was not good; while the plaques produced by infection with rVSV-GFP-MΔ15, rVSV-GFP-MΔ18, rVSV-GFP-MΔ21, rVSV-GFP-MΔ24, rVSV-GFP-MΔ27, rVSV-GFP-MΔ30, rVSV-GFP-MΔ3+15, and rVSV-GFP-MΔ3+21 were significantly smaller than those of VSV-WT, indicating that the deletion of corresponding amino acids at specific positions and numbers on the M gene would reduce the virulence of VSV, and the attenuation effect was obvious.

[0096] Example 6

[0097] M gene-deficient vesicular stomatitis virus challenge experiment

[0098] 4-5 week old Balb / C female mice were divided into 13 groups, 4 mice in each group, and 10 6PFU dose of viruses rVSV-GFP-MΔ1, rVSV-GFP-MΔ2, rVSV-GFP-MΔ3, rVSV-GFP-MΔ6, rVSV-GFP-MΔ9, rVSV-GFP-MΔ12, rVSV-GFP-MΔ15, rVSV-GFP-MΔ18, rVSV-GFP-MΔ21, rVSV-GFP-MΔ24, rVSV-GFP-MΔ27, rVSV-GFP-MΔ30, rVSV-GFP-MΔ3+15, rVSV-GFP-MΔ3+21 The parent virus VSV-WT was challenged by nasal drops, and the mice were weighed and their status was observed and recorded every day. After 14 days of observation, it was found that one mouse attacked with the VSV-WT strain died on the 7th day; one mouse attacked with the rVSV-GFP-MΔ9 strain died on the 14th day; and except for the mice attacked with rVSV-GFP-MΔ12, rVSV-GFP-MΔ15, rVSV-GFP-MΔ21, rVSV-GFP-MΔ3+15 and rVSV-GFP-MΔ3+21 strains, the mice attacked with other strains had varying degrees of frizzled hair (Table 5). At the same time, according to the mouse weight change chart ( Figure 7-9 ) found that compared with mice infected with VSV-WT, rVSV-GFP-MΔ1, and rVSV-GFP-MΔ2 strains, mice infected with rVSV-GFP-MΔ3+15, rVSV-GFP-MΔ12, rVSV-GFP-MΔ21, and rVSV-GFP-MΔ15 strains had less weight loss, indicating that these four strains of M gene-deficient vesicular stomatitis virus have better attenuation effects, laying the foundation for the widespread application of safer VSV vaccine vectors and oncolytic virus vectors.

[0099] Table 5 M gene deletion vesicular stomatitis virus infection mouse status score table

[0100]

[0101] Note: The full score for mouse status is 10 points; 1 point will be deducted for every 0.5g decrease in body weight compared to the previous day; 1 point will be deducted for mild frizziness; 2 points will be deducted for moderate frizziness; and 3 points will be deducted for severe frizziness.

[0102] The embodiment described above is only a preferred solution of the present invention and does not limit the present invention in any form. Other variations and modifications are possible without exceeding the technical solution described in the claims.

Claims

1. A method for attenuating vesicular stomatitis virus, characterized in that: include: The amino acid sequence of the vesicular stomatitis virus M protein is deleted in different numbers and positions, and a reverse genetic operating system is used to obtain a vesicular stomatitis attenuated virus with the corresponding deletions; The amino acid deletions of different numbers and positions are selected from one of the following schemes: (a) 3 amino acids at positions 33 to 35 of the M protein are missing; (b) 6 amino acids at positions 33 to 38 of the M protein are missing; (d) 12 amino acids at positions 33 to 44 of the M protein are missing; (e) 15 amino acids from position 33 to 47 of the M protein are missing; (g) 21 amino acids from position 33 to 53 of the M protein are missing; (k) 18 amino acids from position 18 to 35 of the M protein are missing; (1) 24 amino acids from position 12 to 35 of the M protein are missing; The amino acid sequence of the vesicular stomatitis virus M protein after amino acid deletion is shown in SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.23, SEQ ID NO.27 or SEQ ID NO.

28.

2. The weakening method according to claim 1, characterized in that: The parent viruses targeted by the attenuation method include the Indiana strain of vesicular stomatitis.

3. The weakening method according to claim 1, characterized in that: The nucleotide sequence encoding the vesicular stomatitis virus M protein after amino acid deletion is shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.13 or SEQ ID NO.

14.

4. An attenuated vesicular stomatitis virus strain prepared based on the attenuation method according to any one of claims 1 to 3.

5. A plasmid for preparing a vesicular stomatitis attenuated virus strain, characterized in that: The plasmid contains a nucleotide sequence of one of SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.13, and SEQ ID NO.

14.

6. The plasmid according to claim 5, characterized in that The basic plasmid used in the construction of the plasmid contains the nucleotide sequence shown in SEQ ID NO.

29.

7. Use of a vesicular stomatitis attenuated virus strain prepared by the attenuation method according to any one of claims 1 to 3 in the preparation of a vaccine vector or an oncolytic virus vector.

Images