Poplar root hair development gene psbhlh89 and application thereof

Abstract

The application discloses a poplar root hair development gene PsbHLH89 and application thereof, and belongs to the technical field of plant genetic engineering; the application provides the poplar root hair development gene PsbHLH89 and the coding protein thereof on one hand, and provides the application of the poplar root hair development gene PsbHLH89 on the other hand. The application provides an important and possibly universal root hair development gene resource, the poplar root hair development gene provides material for later related research, and lays a foundation for plant root hair development research.

Description

TECHNICAL FIELD

[0001] The present application relates to a Populus root hair development gene PsbHLH89 and its application, and belongs to the technical field of plant genetic engineering. BACKGROUND

[0002] Populus belongs to Salicaceae and Populus, and the chromosome number is generally 2n=38, including Leuce, Aigeiros, Tacamahaca, Leucoides and Turanga, a total of 5 groups, about 30 species.

[0003] For a long time, Populus plants have been widely used in wood production, environmental protection and ecological greening, and have potential application values in rapid vegetation restoration, soil and water loss prevention and saline-alkali land repair, and can also be used as woody fiber energy plants for biomass energy development and utilization. Populus simonii belongs to the Tacamahaca group and is the main native tree species in northern China, which has the characteristics of tolerance to barren land, strong stress resistance, wide adaptability, easy reproduction, long life and good hybrid compatibility, but its growth period is short, and the time for forming wood is long, which cannot meet the demand of ecological protection and industrial timber.

[0004] Through cultivating Populus varieties with well-developed root systems, the wood yield can be improved, which is an important problem to be solved for the sustainable development of Populus industrialization.

[0005] Therefore, providing a Populus root hair development gene PsbHLH89 and its application helps to understand and deeply study the growth mechanism of Populus root hair development, lays a good foundation for subsequent genetic improvement of Populus, creation of new varieties with excellent traits, and has important significance for cultivating woody plant varieties with excellent growth traits and improving wood yield. SUMMARY

[0006] The present application aims to provide a Populus root hair development gene PsbHLH89, and transform Populus by using its expression vector, so as to provide a technical means for the cultivation or screening of excellent tree species, lay a foundation for exploring the molecular mechanism of Populus root hair development, and promote the development of forest tree molecular breeding technology.

[0007] The above object of the present application is achieved by the following technical scheme:

[0008] Based on analysis of QTL positioning results of quantitative traits of poplar hybrid offspring, a gene bHLH89 related to the maximum root length trait, i.e., the gene PsbHLH89 for regulating root hair development of poplar, is identified, and the coding region nucleotide sequence and the amino acid sequence are shown as SEQ ID NO. 7 and SEQ ID NO. 8 respectively.

[0009] Preferably, the CDS of the gene PsbHLH89 for regulating root hair development of poplar is 1362 bp in full length, encodes 453 amino acids and 1 stop codon.

[0010] Another object of the present application is to provide application of the gene PsbHLH89 for regulating root hair development of poplar in regulating root hair development of poplar.

[0011] The above object of the present application is achieved by the following technical scheme:

[0012] The application of the gene PsbHLH89 for regulating root hair development of poplar in regulating root hair development of poplar is characterized in that: the poplar contains the gene PsbHLH89 or the poplar overexpresses the gene PsbHLH89 or the poplar inhibits expression of the gene PsbHLH89.

[0013] Preferably, the application of the gene PsbHLH89 for regulating root hair development of poplar in regulating root hair development of poplar is characterized in that: a plant overexpression and inhibition expression vector containing the gene PsbHLH89 is constructed, and is heterologously transformed into Populus alba x Populus glandulosa, and transgenic positive plants are obtained through screening, and the transgenic plants for regulating root hair development are obtained through phenotype analysis of the positive plants and wild type plants.

[0014] Preferably, the application of the gene PsbHLH89 for regulating root hair development of poplar in regulating root hair development of poplar is characterized in that: it specifically includes the following steps:

[0015] 1) Populus simonii 'Tongliao1' cutting seedlings cultured in a greenhouse of China Forestry Science Research Institute in Haidian District of Beijing City are collected, RNA is extracted, cDNA is reversely transcribed, the CDS sequence of PsbHLH89 is cloned, and after the pMD19-T vector is connected and sequencing is performed, the overexpression vector and the inhibition expression vector are constructed, and are heterologously transformed into Populus alba x Populus glandulosa;

[0016] 2) Using hygromycin resistance and PCR technology, positive plants were screened by heterologous transformation of PsbHLH89 gene into 84K silver poplar, and transgenic positive plants were obtained. RNA was extracted and phenotypic statistics were performed to obtain transgenic plants that regulate root hair development.

[0017] 3) Through observation of root hair phenotype, it was demonstrated that PsbHLH89 is a gene that positively regulates root hair development and promotes root hair development.

[0018] 4) Using yeast one-hybrid and dual-luciferase assays, the regulatory effect of upstream gene PsGL2 on PsbHLH89 was verified. The results showed that PsGL2 has a regulatory effect on PsbHLH89 and inhibits the expression of PsbHLH89.

[0019] The above research results demonstrate that PsbHLH89 has a certain promoting effect on the development of root hairs in poplar trees, and it has important application value in molecular breeding of forest trees and the selection of superior varieties.

[0020] Compared with the prior art, the main beneficial technical effects of the present invention are as follows:

[0021] This invention uses *Populus alba* 84K as material to screen and identify the PsbHLH89 gene. Phenotypic identification of plants with overexpression and suppressed expression shows that it has the ability to promote root hair development, indicating that the PsbHLH89 gene can positively regulate root hair development in plants. This provides a new option for screening dominant root development genes and has important application value in the field of forest tree genetic engineering.

[0022] The present invention will be further described below with reference to specific embodiments and accompanying drawings, but this does not imply any limitation on the scope of protection of the present invention. Attached Figure Description

[0023] Figure 1-1 This is a detection of positive plants of the PsbHLH89 overexpressing transgenic 84K poplar line in Example 1 of the present invention;

[0024] Figure 1-2 This is a test of positive plants of the PsbHLH89 transgenic 84K silver poplar line in Example 1 of the present invention;

[0025] Figure 2-1 To identify the expression level of PsbHLH89 in the transgenic 84K silver poplar plant overexpressing PsbHLH89 in Example 1 of this invention;

[0026] Figure 2-2 This invention provides an identification of the expression level of PsbHLH89 in the transgenic 84K silver poplar plant in Example 1 of this invention.

[0027] Figure 3-1To detect the root hair development phenotype of the 84K silver poplar plant with the PsbHLH89 transgene in Example 1 of the present application;

[0028] Figure 3-2 To perform the yeast one-hybrid test for regulating the expression of PsbHLH89 by PsGL2 in Example 1 of the present application;

[0029] Figure 3-3 To perform the transient transformation test for regulating the expression of PsbHLH89 by PsGL2 in Example 1 of the present application. DETAILED DESCRIPTION

[0030] The present application will be further described below in conjunction with specific examples. The operations not described in detail in the following examples can be implemented by referring to the operations of molecular cloning and the operation instructions of the related kits.

[0031] Unless otherwise specified, the reagents involved in the following examples are all conventional reagents available on the market, and the methods used are all methods commonly used in the technical field.

[0032] Example 1:

[0033] I. Cloning of Populus simonii PsbHLH89 gene

[0034] Populus simonii (P. simonii 'Tongliao 1') was used as the material, and the total RNA of P. simonii leaves was extracted using the TIANGEN polysaccharide and polyphenol total RNA kit (TIANGEN, Beijing) according to the following method:

[0035] (1) 0.1 g of P. simonii leaf tissue was frozen with liquid nitrogen, ground in a mortar pre-cooled with liquid nitrogen, and the leaf tissue sample was kept in a frozen state during the grinding process. After the tissue sample was ground into powder, it was transferred to a 1.5 ml centrifuge tube, and then 500 μl of lysis buffer and 10 μl of commercially available β-mercaptoethanol were added to a 2 ml sterilized centrifuge tube. Then, the tissue and reagents were fully mixed using a vortex oscillator;

[0036] (2) Centrifuge at 12000 rpm for 2 minutes to collect the supernatant;

[0037] (3) Transfer the supernatant to a filter column, centrifuge at 12000 rpm for 2 minutes, and carefully pipette the supernatant into another centrifuge tube;

[0038] (4) Add 0.4 times (200 μl) of anhydrous ethanol to the centrifuge tube, mix well, and transfer to the adsorption column. Centrifuge the adsorption column at 12000 rpm for 15 seconds, and discard the liquid;

[0039] (5) Add 80 microliters of DNase working solution (10 microliters of DNase storage solution + 70 microliters of buffer) to the adsorption column, and stand at room temperature for 15 minutes;

[0040] (6) Add 350 microliters of deproteinizing solution to the adsorption column, centrifuge at 12000 rpm for 15 seconds, and discard the liquid;

[0041] (7) Add 500 microliters of rinsing solution to the adsorption column, centrifuge at 12000 rpm for 15 seconds, and discard the liquid;

[0042] (8) Repeat (7);

[0043] (9) Centrifuge at 12000 rpm for 2 minutes, move into a new centrifuge tube, dry, add 30 microliters of RNA-free ultrapure water, dissolve the precipitate, stand at room temperature for 2 minutes, centrifuge at 12000 rpm for 1 minute, and obtain the plant total RNA extraction solution;

[0044] Take 1.0 microliters of total RNA from each sample, reverse transcribe into cDNA by using Tengen reverse transcription reagent, and the experimental consumables are free of RNA contamination. The reaction is performed on ice; the reverse transcription steps are as follows:

[0045] 1) gDNA removal reaction (10 microliters of system) is shown in Table 1:

[0046] Table 1

[0047]

[0048] Reaction conditions: 42°C, reaction for 3 minutes;

[0049] 2) The reaction product of the previous step is used as a template for reaction (20 microliters of system) as shown in Table 2:

[0050] Table 2

[0051]

[0052] 3) Add 1) to 2), reaction conditions: 42°C, reaction for 15 minutes; 95°C, reaction for 3 minutes; when used, dilute 10 microliters of cDNA + 190 microliters of ultrapure water, which is Populus simonii cDNA template;

[0053] The primers (amplifon include start codon and stop codon) were designed by using Primer3 software for full-length amplification of the gene according to the published Populus tremula genome sequence; wherein, the PsbHLH89 ORF forward primer PsbHLH89-F is shown as SEQ ID NO. 1 in the sequence listing (Table 3), the reverse primer PsbHLH89-R is shown as SEQ ID NO. 2 (Table 4), the PsbHLH89 overexpression forward primer PsbHLH89-OE-F is shown as SEQ ID NO. 3 in the sequence listing (Table 5), the PsbHLH89 overexpression reverse primer PsbHLH89-OE-R is shown as SEQ ID NO. 4 (Table 6), the PsbHLH89 inhibition forward primer PsbHLH89-RNAi-F is shown as SEQ ID NO. 5 in the sequence listing (Table 7), and the PsbHLH89 inhibition reverse primer PsbHLH89-RNAi-R is shown as SEQ ID NO. 6 (Table 8);

[0054] Table 3

[0055] Name Sequence 1 (SEQ ID NO. 1) PsbHLH89-F ATGACAACTGGAAATATTGCTTCGAAG

[0056] Table 4

[0057] Name Sequence 2 (SEQ ID NO. 2) PsbHLH89-R TCATTCACGAGGCGACGGGTTC

[0058] Table 5

[0059]

[0060] Table 6

[0061]

[0062] Table 7

[0063]

[0064] Table 8

[0065]

[0066] The cDNA of Populus tremula was used as a template for PCR amplification with the corresponding primers, and the PCR reaction system (20 microliter system) is shown in Table 9 below:

[0067] Table 9

[0068]

[0069] The reaction conditions are shown in Table 10 below:

[0070] Table 10

[0071]

[0072] The gel was cut and the target fragment was recovered. The target fragment of PsbHLH89 was recovered by using the gel recovery kit of OMEGA Bio-Technology Company (USA). The specific operation steps were as follows:

[0073] 1) The target fragment band was cut and placed in a 1.5 ml sterilized centrifuge tube, 600 μl binding liquid was added, and the gel was melted at 50°C;

[0074] 2) The melted liquid was moved into a filter column, the filter column was installed in the centrifuge tube, 12500 r / min centrifugation was performed for 2 minutes, and the waste liquid was discarded;

[0075] 3) 600 μl elution liquid was added, 12500 r / min centrifugation was performed for 30 minutes, the waste liquid was discarded;

[0076] 4) Repeat (3);

[0077] 5) The filter column was centrifuged at 12500 r / min for 2 minutes;

[0078] 6) The filter column was moved into another 1.5 ml centrifuge tube, 30 μl sterilized deionized water was added, and the sample was left to stand at room temperature for 5 minutes, 12500 r / min centrifugation was performed for 2 minutes, and the elution could be repeated once;

[0079] 7) After 0.1% agarose gel electrophoresis detection, the sample was stored at -20°C;

[0080] After being connected to pMD19-T, sequencing was performed, the full-length cDNA sequence of the gene was 1383 bp, was named as PsbHLH89 gene, and the sequence was shown in SEQ ID NO. 7 (Table 11), and the expressed protein sequence was shown in SEQ ID NO. 8 (Table 12);

[0081] Table 11

[0082]

[0083] Table 12

[0084]

[0085]

[0086] II. Construction of PsbHLH89 gene plant expression vector

[0087] 1. Construction of overexpression and inhibition expression vector

[0088] The overexpression vector was constructed using the Gateway method, and the gel recovery product of the PCR-amplified PsbHLH89 with a Gateway tag was obtained, the forward primer PsbHLH89-OE-F was as shown in SEQ ID NO. 3 in the sequence listing (Table 5), and the reverse primer PsbHLH89-OE-R was as shown in SEQ ID NO. 4 (Table 6), the suppression expression vector was also constructed using the Gateway method, and the gel recovery product of the PCR-amplified PsbHLH89 RNAi target fragment with a Gateway tag was obtained, the forward primer PsbHLH89-RNAi-F was as shown in SEQ ID NO. 5 in the sequence listing (Table 7), and the reverse primer PsbHLH89-RNAi-R was as shown in SEQ ID NO. 6 (Table 8), which was first constructed in the pDONR222 intermediate vector through a BP reaction (Thermo, Shanghai, China), the BP reaction system is shown in Table 13, to obtain the recombinant plasmid pDONR222-PsbHLH89 / pDNOR222-PsbHLH89-RNAi, then, using an LR reaction (Thermo, Shanghai, China), PsbHLH89 was constructed into the pMDC32 vector to obtain pMDC32-PsbHLH89, and the PsbHLH89 RNAi target fragment was constructed into the pH7GWIWG2 vector to obtain pH7GWIWG2-PsbHLH89;

[0089] The BP reaction system (5 μL system) is shown in Table 13 below:

[0090] Table 13

[0091]

[0092] Reaction conditions: 16°C, reaction for 1 hour;

[0093] The ligation product was transformed into E. coli DH5α, and the specific transformation steps were as follows:

[0094] 1. Take 5 μL of the BP ligation product on an ice box, add 50 μL of E. coli competent DH5α produced by Beijing Quansiji Biological Technology Co., Ltd., and mix gently with a pipette, and incubate in an ice bath for 30 minutes;

[0095] 2. Place the transformed bacterial solution, heat shock at 42°C for 90 s, and then take it out and incubate in an ice bath for 5 minutes;

[0096] 3. Add 300 μL of LB liquid medium, incubate at 37°C, 180 rpm, and shake for 1 hour;

[0097] 4. Centrifuge at room temperature at 4000 rpm for 5 minutes, discard the supernatant, and resuspend the remaining bacterial solution;

[0098] 5. Spread the mixed transformants on LB solid plates containing 50 mg / L Kan, dry, seal, and invert in a 37℃ incubator for 12-14 hours;

[0099] Randomly pick several single colonies from the LB solid plates, add 300 microliters of LB liquid medium containing Kan (50 mg / L), and shake at 37℃, 180 rpm for 4-5 hours. Then use the bacterial solution as a template for PCR to detect positive clones;

[0100] The PCR reaction system (20 microliter system) is shown in Table 14 below:

[0101] Table 14

[0102]

[0103] The reaction conditions are shown in Table 15 below:

[0104] Table 15

[0105]

[0106] After the reaction, take 5 microliters of the PCR amplification product, use 0.1% agarose gel electrophoresis to detect, and take a photo under ultraviolet light of a gel imaging system. A band with the same size as the amplification primer is considered a positive clone. Select 3-5 PCR positive clones, entrust Beijing Qikexing Biological Technology Co., Ltd. to sequence, and confirm successful construction into the intermediate vector. According to the sequencing results, add the target strain into an equal volume of 50% sterile glycerol, shake well, pre-freeze in liquid nitrogen, and transfer to a -80℃ refrigerator for storage, or extract and store the pDNOR222-PsbHLH89 / pDNOR222-PsbHLH89-RNAi plasmid by expanding culture;

[0107] Perform enzyme digestion LR connection reaction on the pDNOR222-PsbHLH89 / pDNOR222-PsbHLH89-RNAi plasmid gene fragment;

[0108] The enzyme digestion reaction system (10 microliter system) is shown in Table 16 below:

[0109] Table 16

[0110]

[0111] Reaction conditions: 37℃, 3 hours;

[0112] Perform LR reaction connection on the pDNOR222-PsbHLH89 plasmid. The LR reaction system (5 microliter system) is shown in Table 17 below:

[0113] Table 17

[0114]

[0115] Reaction conditions: 25°C, reaction for 2.5 hours;

[0116] The ligation product was transformed into E. coli, single colonies were picked and sequenced, and the correct single colony was the pMDC32-PsbHLH89 / pH7GWIWG2-PsbHLH89 plasmid, and the overexpression vector pMDC32-PsbHLH89 and the inhibitory expression vector pH7GWIWG2-PsbHLH89 of the root hair development related gene PsbHLH89 of Populus tremula were finally cloned;

[0117] III. Genetic transformation and detection of PsbHLH89 gene

[0118] 1. Genetic transformation of PsbHLH89 gene

[0119] The constructed overexpression vector (pMDC32-PsbHLH89) and inhibitory expression vector (pH7GWIWG2-PsbHLH89) were transformed into Agrobacterium GV3101 by electroporation, and were transformed into 84K Agrobacterium-mediated genetic transformation of Populus tremula x Populus alba, and the transformation steps were as follows: 84K Agrobacterium for genetic transformation Populus tremula x Populus alba callus was cultured at a temperature of 23-25°C, with a light-dark cycle of 16 / 8 hours (day / night), and a light intensity of 50 μM m -2 s -1 The Agrobacterium containing the target expression vector was used to infect the callus at OD600=0.6-0.8, and the infected callus was placed on the L&M (Lloyd & McCown Woody Plant Basal Medium with Vitamins) basic medium for a total of 3 days of co-culture at a temperature of 22±2°C in the dark. The leaves after co-culture were transferred to L&M containing 0.5 mg / L 6-benzylaminopurine (6-BA) and 0.05 mg / L naphthaleneacetic acid (NAA), 3 mg / L hygromycin B, and 200 mg / L Timentin, and were cultured at a temperature of 23-25°C, with a light-dark cycle of 16 / 8 h (day / night), and a light intensity of 50 μM m -2 s -1The resistant adventitious buds were induced and screened under the conditions, and after 30-45 days of induction culture, the resistant adventitious buds were transferred to rooting culture medium containing 3 mg / L hygromycin B and 200 mg / L Timentin (1 / 2 Murashige and Skoog (MS) basic medium added with 0.05 mg / L IBA and 0.02 mg / L NAA) until induction of rooting, and then the DNA of the rooted plant leaves was extracted for PCR verification;

[0120] 2. Detection of overexpression and inhibition expression transgenic plants

[0121] The 84K silver gland poplar plants with resistance to overexpression and inhibition expression of the PsbHLH89 gene were obtained, the genomic DNA was extracted, the resistance gene on the expression vector was amplified by PCR, and a clear band was obtained, that is, the transgenic plant; as shown in the figure, it is the positive plant detection diagram of the wild type 84K silver gland poplar and the transgenic silver gland poplar with overexpression and inhibition expression of PsbHLH89 in Example 1 of the application; at the same time, RNA was extracted and RT-PCR was performed, 5 overexpression plants with higher expression than the wild type WT and 11 inhibition expression plants with lower expression than the wild type WT were screened out, and the naming conditions are as shown in the table; Figure 1-1 to 1-2 Figure 2-1 to 2-2 The quantitative primer is PsbHLH89-RT-F (SEQ ID NO. 9), see Table 18 below; PsbHLH89-RT-R (SEQ ID NO. 10), see Table 19 below;

[0122] Table 18

[0123] Name Sequence 9 (SEQ ID NO. 9) PsbHLH89-RT-F TTTCTCCACTGGCTTGCTTT

[0124] Table 19

[0125] Name Sequence 10 (SEQ ID NO. 10) PsbHLH89-RT-R TCTGTTACATCGGGCATCAA

[0126] Four, phenotype observation of PsbHLH89 transgenic plants

[0127] The transgenic strain 84K silver gland poplar was set up more than three biological repeats, and the wild type 84K silver gland poplar (WT) was set up as a control interval, the culture place was the tissue culture room of China Forestry Science Research Institute, the culture condition was 25 DEG C and 2500 lx, and after growing for one month, the root hair development condition was observed, and the results are shown in the table; Figure 3-1 Compared with the wild type, the root hair of the PsbHLH89 overexpression plant was promoted, and the development of the root hair of the PsbHLH89 inhibition expression plant was inhibited, which indicated that PsbHLH89 promoted the formation of the root hair;

[0128] Five, verification of the upstream gene of PsbHLH89 ​

[0129] The PsGL2 sequence was cloned in Populus simonii, the forward primer PsGL2-AD-F was shown as SEQ ID NO. 11 (Table 20) and the reverse primer PsGL2-AD-R was shown as SEQ ID NO. 12 (Table 21), and the PsbHLH89 promoter region sequence was also cloned, the forward primer proPsbHLH89-HIS2-F was shown as SEQ ID NO. 13 (Table 22) and the reverse primer proPsbHLH89-HIS2-R was shown as SEQ ID NO. 14 (Table 23), then the two sequences were constructed in pGADT7 and pHIS2 vectors respectively, and the "L-1 Box" like sequence of PsbHLH89 promoter region was also constructed in pHIS2, the forward primer L-1-F was shown as SEQ ID NO. 15 (Table 24) and the reverse primer L-1-R was shown as SEQ ID NO. 16 (Table 25), then the yeast one-hybrid test was carried out, and the results were shown as Figure 3-1 PsGL2 could bind to the PsbHLH89 promoter region, but the binding site was not the "L-1 Box" like sequence, which proved the regulatory effect of PsGL2 on PsbHLH89.

[0130] Table 20

[0131]

[0132] Table 21

[0133]

[0134] Table 22

[0135] Name Sequence 13 (SEQ ID NO. 13) proPsbHLH89-HIS2-F gactcactatagggcgCGCGGTTCAAAGCAAATCG

[0136] Table 23

[0137] Name Sequence 14 (SEQ ID NO. 14) proPsbHLH89-HIS2-R gcgtgagctccccgggCTTTTTGAAACGAAACGAAATGGGG

[0138] Table 24

[0139] Name Sequence 15 (SEQ ID NO. 15) L-1-F gactcactatagggcgAATAAAATGTAATAAAATGTAATAAAATGT

[0140] Table 25

[0141] Name Sequence 16 (SEQ ID NO. 16) L-1-R gcgtgagctccccgggACATTTTATTACATTTTATTACATTTTATT

[0142] PsGL2 was constructed on pGreenII-62-SK vector, forward primer PsGL2-SK-F was shown as SEQ ID NO. 17 (Table 26), reverse primer PsGL2-AD-R was shown as SEQ ID NO. 18 (Table 27), then, PsbHLH89 promoter sequence was constructed on pGreenII-62-LUC vector, forward primer proPsbHLH89-LUC-F was shown as SEQ ID NO. 19 (Table 28), reverse primer proPsbHLH89-LUC-R was shown as SEQ ID NO. 20 (Table 29), after transiently transforming tobacco, the results were shown as Figure 3-3 The addition of PsGL2 inhibited the fluorescence signal, proving that PsGL2 inhibited the expression of PsbHLH89.

[0143] Table 26

[0144] Name Sequence 17 (SEQ ID NO. 17) PsGL2-SK-F cgctctagaactagtggatccATGGGCGTCGACATGTCTAATCCACCCAA

[0145] Table 27

[0146] Name Sequence 18 (SEQ ID NO. 18) PsGL2-SK-R tcagcgtaccgaattggtaccTCAACTATCTTCACATTGCAAGCTTGTCTTG

[0147] Table 28

[0148] Name Sequence 19 (SEQ ID NO. 19) proPsbHLH89-LUC-F ctatagggcgaattgggtaccCGCGGTTCAAAGCAAATCG

[0149] Table 29

[0150] Name Sequence 20 (SEQ ID NO. 20) proPsbHLH89-LUC-R cgctctagaactagtggatccCTTTTTGAAACGAAACGAAATGGGG

[0151] The application provides an important and possibly universal root hair development gene resource, and the poplar root hair development gene provides material for subsequent related research and lays a foundation for plant root hair development research.

[0152] Obviously, the above examples of the application are only examples for clearly illustrating the application, and are not intended to limit the embodiments of the application. For ordinary skilled in the art, other different forms of changes or variations can be made on the basis of the above description, and all the embodiments cannot be exhausted here. Any obvious changes or variations derived from the technical solutions of the application are still within the protection scope of the application.

Claims

1. gene PsbHLH89 application in the positive regulation of poplar root hair development, the coding region nucleotide sequence of which is shown as SEQ ID NO. 7; and it has the ability to promote root hair development.

2. The gene of claim 1 PsbHLH89 In the application of regulating the development of root hair in poplar in a positive way, characterized in that: Poplar overexpression gene PsbHLH89 .

3. The gene of claim 1 PsbHLH89 In the application of regulating the development of root hair in poplar in a positive way, characterized in that: Construction of plant overexpression vector containing gene PsbHLH89 The plant overexpression vector containing gene was constructed and heterologously transformed into Populus alba var. pyramidalis 84K. Transgenic positive plants were obtained by screening. The transgenic plants with root hair development regulated were obtained by phenotype analysis of positive plants and wild type plants.

4. The gene of claim 1 PsbHLH89 In the application of regulating the development of root hair in poplar in a positive way, characterized in that: Specifically comprising the following steps: (1) Collecting Populus simonii cutting seedlings, extracting RNA, reverse transcribing into cDNA, cloning CDS sequence of PtoS1, connecting pMD19-T vector for sequencing, identifying correctly, constructing overexpression vector, and heterologous transforming into Populus alba 84K; PsbHLH89 (1) Collecting Populus simonii cutting seedlings, extracting RNA, reverse transcribing into cDNA, cloning CDS sequence of PtoS1, connecting pMD19-T vector for sequencing, identifying correctly, constructing overexpression vector, and heterologous transforming into Populus alba 84K; (2) Using hygromycin resistance and PCR technology, for PsbHLH89 Genetic heterologous transformation of 84K *Populus alba* was used to screen for positive plants, resulting in transgenic positive plants. RNA extraction and phenotypic analysis were performed on these transgenic plants. The transgenic plants were then observed, and the effects of their upstream genes on [the target gene / gene / etc.] were verified. PsbHLH89 The regulatory role of gene expression.

Images